Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_010474 Synechococcus sp. PCC 7002 plasmid pAQ7, complete sequence 0 crisprs NA 0 0 0 0
NC_010475 Synechococcus sp. PCC 7002, complete sequence 1 crisprs csa3,cas3,DinG,WYL,cas6,cas8b3,cas7,cas5,cas1,cas2,cas14j 0 2 0 0
NC_010477 Synechococcus sp. PCC 7002 plasmid pAQ3, complete sequence 0 crisprs NA 0 0 2 0
NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 1 crisprs cas4,WYL,csx1,cmr6gr7,cmr5gr11,cmr4gr7,cmr3gr5,cas10,cas2,cas1,csx18 0 138 0 0
NC_010476 Synechococcus sp. PCC 7002 plasmid pAQ1, complete sequence 0 crisprs NA 0 0 0 0
NC_010479 Synechococcus sp. PCC 7002 plasmid pAQ5, complete sequence 0 crisprs RT,WYL 0 0 0 0
NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 1 crisprs cas2,cas1,cas4,cas6,csc1gr5,csc2gr7,cas10d,cas3,WYL 0 80 0 0

Results visualization

1. NC_010480
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_010480_1 54528-61299 TypeIII NA
130 spacers
cas10,cmr3gr5,cmr4gr7,cmr5gr11,cmr6gr7,cas2,cas1,csx18,WYL

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_010480_1 1.1|54564|44|NC_010480|CRISPRCasFinder,CRT 54564-54607 44 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 54564-54607 0 1.0
NC_010480_1 1.2|54644|37|NC_010480|CRISPRCasFinder,CRT,PILER-CR 54644-54680 37 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 54644-54680 0 1.0
NC_010480_1 1.3|54717|38|NC_010480|CRISPRCasFinder,CRT,PILER-CR 54717-54754 38 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 54717-54754 0 1.0
NC_010480_1 1.4|54791|35|NC_010480|CRISPRCasFinder,CRT,PILER-CR 54791-54825 35 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 54791-54825 0 1.0
NC_010480_1 1.5|54862|43|NC_010480|CRISPRCasFinder,CRT,PILER-CR 54862-54904 43 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 54862-54904 0 1.0
NC_010480_1 1.6|54941|35|NC_010480|CRISPRCasFinder,CRT,PILER-CR 54941-54975 35 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 54941-54975 0 1.0
NC_010480_1 1.7|55012|37|NC_010480|CRISPRCasFinder,CRT,PILER-CR 55012-55048 37 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 55012-55048 0 1.0
NC_010480_1 1.8|55085|41|NC_010480|CRISPRCasFinder,CRT,PILER-CR 55085-55125 41 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 55085-55125 0 1.0
NC_010480_1 1.9|55162|38|NC_010480|CRISPRCasFinder,CRT,PILER-CR 55162-55199 38 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 55162-55199 0 1.0
NC_010480_1 1.10|55236|42|NC_010480|CRISPRCasFinder,CRT,PILER-CR 55236-55277 42 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 55236-55277 0 1.0
NC_010480_1 1.11|55314|40|NC_010480|CRISPRCasFinder,CRT,PILER-CR 55314-55353 40 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 55314-55353 0 1.0
NC_010480_1 1.12|55390|42|NC_010480|CRISPRCasFinder,CRT,PILER-CR 55390-55431 42 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 55390-55431 0 1.0
NC_010480_1 1.13|55468|40|NC_010480|CRISPRCasFinder,CRT,PILER-CR 55468-55507 40 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 55468-55507 0 1.0
NC_010480_1 1.14|55544|40|NC_010480|CRISPRCasFinder,CRT,PILER-CR 55544-55583 40 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 55544-55583 0 1.0
NC_010480_1 1.15|55620|39|NC_010480|CRISPRCasFinder,CRT,PILER-CR 55620-55658 39 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 55620-55658 0 1.0
NC_010480_1 1.16|55695|36|NC_010480|CRISPRCasFinder,CRT 55695-55730 36 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 55695-55730 0 1.0
NC_010480_1 1.17|55767|46|NC_010480|CRISPRCasFinder,CRT,PILER-CR 55767-55812 46 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 55767-55812 0 1.0
NC_010480_1 1.18|55849|40|NC_010480|CRISPRCasFinder,CRT,PILER-CR 55849-55888 40 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 55849-55888 0 1.0
NC_010480_1 1.19|55925|35|NC_010480|CRISPRCasFinder,CRT,PILER-CR 55925-55959 35 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 55925-55959 0 1.0
NC_010480_1 1.20|55996|39|NC_010480|CRISPRCasFinder,CRT,PILER-CR 55996-56034 39 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 55996-56034 0 1.0
NC_010480_1 1.21|56071|40|NC_010480|CRISPRCasFinder,CRT,PILER-CR 56071-56110 40 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 56071-56110 0 1.0
NC_010480_1 1.22|56147|39|NC_010480|CRISPRCasFinder,CRT,PILER-CR 56147-56185 39 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 56147-56185 0 1.0
NC_010480_1 1.22|56147|39|NC_010480|CRISPRCasFinder,CRT,PILER-CR 56147-56185 39 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 56222-56260 0 1.0
NC_010480_1 1.23|56222|39|NC_010480|CRISPRCasFinder,CRT,PILER-CR 56222-56260 39 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 56147-56185 0 1.0
NC_010480_1 1.23|56222|39|NC_010480|CRISPRCasFinder,CRT,PILER-CR 56222-56260 39 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 56222-56260 0 1.0
NC_010480_1 1.24|56297|38|NC_010480|CRISPRCasFinder,CRT,PILER-CR 56297-56334 38 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 56297-56334 0 1.0
NC_010480_1 1.24|56297|38|NC_010480|CRISPRCasFinder,CRT,PILER-CR 56297-56334 38 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 56371-56408 0 1.0
NC_010480_1 1.25|56371|38|NC_010480|CRISPRCasFinder,CRT,PILER-CR 56371-56408 38 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 56297-56334 0 1.0
NC_010480_1 1.25|56371|38|NC_010480|CRISPRCasFinder,CRT,PILER-CR 56371-56408 38 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 56371-56408 0 1.0
NC_010480_1 1.26|56445|37|NC_010480|CRISPRCasFinder,CRT,PILER-CR 56445-56481 37 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 56445-56481 0 1.0
NC_010480_1 1.27|56518|45|NC_010480|CRISPRCasFinder,CRT,PILER-CR 56518-56562 45 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 56518-56562 0 1.0
NC_010480_1 1.28|56599|40|NC_010480|CRISPRCasFinder,CRT,PILER-CR 56599-56638 40 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 56599-56638 0 1.0
NC_010480_1 1.29|56675|42|NC_010480|CRISPRCasFinder,CRT,PILER-CR 56675-56716 42 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 56675-56716 0 1.0
NC_010480_1 1.30|56753|48|NC_010480|CRISPRCasFinder,CRT,PILER-CR 56753-56800 48 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 56753-56800 0 1.0
NC_010480_1 1.31|56837|40|NC_010480|CRISPRCasFinder,CRT,PILER-CR 56837-56876 40 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 56837-56876 0 1.0
NC_010480_1 1.32|56913|36|NC_010480|CRISPRCasFinder,CRT,PILER-CR 56913-56948 36 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 56913-56948 0 1.0
NC_010480_1 1.33|56985|40|NC_010480|CRISPRCasFinder,CRT,PILER-CR 56985-57024 40 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 56985-57024 0 1.0
NC_010480_1 1.34|57061|43|NC_010480|CRISPRCasFinder,CRT,PILER-CR 57061-57103 43 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 57061-57103 0 1.0
NC_010480_1 1.34|57061|43|NC_010480|CRISPRCasFinder,CRT,PILER-CR 57061-57103 43 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 57698-57740 0 1.0
NC_010480_1 1.35|57140|39|NC_010480|CRISPRCasFinder,CRT 57140-57178 39 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 57140-57178 0 1.0
NC_010480_1 1.35|57140|39|NC_010480|CRISPRCasFinder,CRT 57140-57178 39 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 57777-57815 0 1.0
NC_010480_1 1.37|57323|42|NC_010480|CRISPRCasFinder,PILER-CR 57323-57364 42 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 57323-57364 0 1.0
NC_010480_1 1.37|57323|42|NC_010480|CRISPRCasFinder,PILER-CR 57323-57364 42 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 57960-58001 0 1.0
NC_010480_1 1.38|57401|41|NC_010480|CRISPRCasFinder,PILER-CR 57401-57441 41 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 57401-57441 0 1.0
NC_010480_1 1.39|57478|35|NC_010480|CRISPRCasFinder,PILER-CR 57478-57512 35 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 57478-57512 0 1.0
NC_010480_1 1.39|57478|35|NC_010480|CRISPRCasFinder,PILER-CR 57478-57512 35 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 58114-58148 0 1.0
NC_010480_1 1.40|57549|38|NC_010480|CRISPRCasFinder,PILER-CR 57549-57586 38 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 57549-57586 0 1.0
NC_010480_1 1.40|57549|38|NC_010480|CRISPRCasFinder,PILER-CR 57549-57586 38 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 58185-58222 0 1.0
NC_010480_1 1.41|57623|39|NC_010480|CRISPRCasFinder,PILER-CR 57623-57661 39 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 57623-57661 0 1.0
NC_010480_1 1.42|57698|43|NC_010480|CRISPRCasFinder,PILER-CR 57698-57740 43 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 57061-57103 0 1.0
NC_010480_1 1.42|57698|43|NC_010480|CRISPRCasFinder,PILER-CR 57698-57740 43 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 57698-57740 0 1.0
NC_010480_1 1.43|57777|39|NC_010480|CRISPRCasFinder 57777-57815 39 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 57140-57178 0 1.0
NC_010480_1 1.43|57777|39|NC_010480|CRISPRCasFinder 57777-57815 39 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 57777-57815 0 1.0
NC_010480_1 1.45|57960|42|NC_010480|CRISPRCasFinder,CRT 57960-58001 42 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 57323-57364 0 1.0
NC_010480_1 1.45|57960|42|NC_010480|CRISPRCasFinder,CRT 57960-58001 42 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 57960-58001 0 1.0
NC_010480_1 1.46|58038|40|NC_010480|CRISPRCasFinder,CRT,PILER-CR 58038-58077 40 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 58038-58077 0 1.0
NC_010480_1 1.47|58114|35|NC_010480|CRISPRCasFinder,CRT,PILER-CR 58114-58148 35 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 57478-57512 0 1.0
NC_010480_1 1.47|58114|35|NC_010480|CRISPRCasFinder,CRT,PILER-CR 58114-58148 35 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 58114-58148 0 1.0
NC_010480_1 1.48|58185|38|NC_010480|CRISPRCasFinder,CRT,PILER-CR 58185-58222 38 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 57549-57586 0 1.0
NC_010480_1 1.48|58185|38|NC_010480|CRISPRCasFinder,CRT,PILER-CR 58185-58222 38 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 58185-58222 0 1.0
NC_010480_1 1.49|58259|40|NC_010480|CRISPRCasFinder,CRT,PILER-CR 58259-58298 40 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 58259-58298 0 1.0
NC_010480_1 1.50|58335|42|NC_010480|CRISPRCasFinder,CRT,PILER-CR 58335-58376 42 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 58335-58376 0 1.0
NC_010480_1 1.51|58413|42|NC_010480|CRISPRCasFinder,CRT,PILER-CR 58413-58454 42 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 58413-58454 0 1.0
NC_010480_1 1.52|58491|43|NC_010480|CRISPRCasFinder,CRT,PILER-CR 58491-58533 43 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 58491-58533 0 1.0
NC_010480_1 1.53|58570|41|NC_010480|CRISPRCasFinder,CRT,PILER-CR 58570-58610 41 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 58570-58610 0 1.0
NC_010480_1 1.54|58647|36|NC_010480|CRISPRCasFinder,CRT,PILER-CR 58647-58682 36 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 58647-58682 0 1.0
NC_010480_1 1.55|58719|40|NC_010480|CRISPRCasFinder,CRT,PILER-CR 58719-58758 40 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 58719-58758 0 1.0
NC_010480_1 1.56|58795|42|NC_010480|CRISPRCasFinder,CRT,PILER-CR 58795-58836 42 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 58795-58836 0 1.0
NC_010480_1 1.57|58873|36|NC_010480|CRISPRCasFinder,CRT,PILER-CR 58873-58908 36 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 58873-58908 0 1.0
NC_010480_1 1.58|58945|42|NC_010480|CRISPRCasFinder,CRT,PILER-CR 58945-58986 42 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 58945-58986 0 1.0
NC_010480_1 1.59|59023|36|NC_010480|CRISPRCasFinder,CRT,PILER-CR 59023-59058 36 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 59023-59058 0 1.0
NC_010480_1 1.60|59095|38|NC_010480|CRISPRCasFinder,CRT 59095-59132 38 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 59095-59132 0 1.0
NC_010480_1 1.61|59169|46|NC_010480|CRISPRCasFinder,CRT 59169-59214 46 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 59169-59214 0 1.0
NC_010480_1 1.62|59251|42|NC_010480|CRISPRCasFinder,CRT,PILER-CR 59251-59292 42 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 59251-59292 0 1.0
NC_010480_1 1.63|59329|43|NC_010480|CRISPRCasFinder,CRT,PILER-CR 59329-59371 43 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 59329-59371 0 1.0
NC_010480_1 1.64|59408|39|NC_010480|CRISPRCasFinder,CRT,PILER-CR 59408-59446 39 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 59408-59446 0 1.0
NC_010480_1 1.65|59483|41|NC_010480|CRISPRCasFinder,CRT,PILER-CR 59483-59523 41 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 59483-59523 0 1.0
NC_010480_1 1.66|59560|38|NC_010480|CRISPRCasFinder,CRT,PILER-CR 59560-59597 38 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 59560-59597 0 1.0
NC_010480_1 1.67|59634|43|NC_010480|CRISPRCasFinder,CRT,PILER-CR 59634-59676 43 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 59634-59676 0 1.0
NC_010480_1 1.68|59713|38|NC_010480|CRISPRCasFinder,CRT,PILER-CR 59713-59750 38 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 59713-59750 0 1.0
NC_010480_1 1.69|59787|38|NC_010480|CRISPRCasFinder,CRT,PILER-CR 59787-59824 38 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 59787-59824 0 1.0
NC_010480_1 1.70|59861|40|NC_010480|CRISPRCasFinder,CRT,PILER-CR 59861-59900 40 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 59861-59900 0 1.0
NC_010480_1 1.71|59937|38|NC_010480|CRISPRCasFinder,CRT,PILER-CR 59937-59974 38 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 59937-59974 0 1.0
NC_010480_1 1.72|60011|39|NC_010480|CRISPRCasFinder,CRT,PILER-CR 60011-60049 39 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 60011-60049 0 1.0
NC_010480_1 1.73|60086|41|NC_010480|CRISPRCasFinder,CRT 60086-60126 41 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 60086-60126 0 1.0
NC_010480_1 1.74|60163|45|NC_010480|CRISPRCasFinder,CRT,PILER-CR 60163-60207 45 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 60163-60207 0 1.0
NC_010480_1 1.75|60244|39|NC_010480|CRISPRCasFinder,CRT,PILER-CR 60244-60282 39 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 60244-60282 0 1.0
NC_010480_1 1.76|60319|35|NC_010480|CRISPRCasFinder,CRT,PILER-CR 60319-60353 35 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 60319-60353 0 1.0
NC_010480_1 1.77|60390|41|NC_010480|CRISPRCasFinder,CRT,PILER-CR 60390-60430 41 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 60390-60430 0 1.0
NC_010480_1 1.78|60467|38|NC_010480|CRISPRCasFinder,CRT,PILER-CR 60467-60504 38 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 60467-60504 0 1.0
NC_010480_1 1.79|60541|42|NC_010480|CRISPRCasFinder,CRT,PILER-CR 60541-60582 42 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 60541-60582 0 1.0
NC_010480_1 1.80|60619|41|NC_010480|CRISPRCasFinder,CRT,PILER-CR 60619-60659 41 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 60619-60659 0 1.0
NC_010480_1 1.81|60696|39|NC_010480|CRISPRCasFinder,CRT,PILER-CR 60696-60734 39 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 60696-60734 0 1.0
NC_010480_1 1.82|60771|41|NC_010480|CRISPRCasFinder,CRT,PILER-CR 60771-60811 41 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 60771-60811 0 1.0
NC_010480_1 1.83|60848|41|NC_010480|CRISPRCasFinder,CRT,PILER-CR 60848-60888 41 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 60848-60888 0 1.0
NC_010480_1 1.84|60925|39|NC_010480|CRISPRCasFinder,CRT,PILER-CR 60925-60963 39 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 60925-60963 0 1.0
NC_010480_1 1.85|61000|40|NC_010480|CRISPRCasFinder,CRT,PILER-CR 61000-61039 40 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 61000-61039 0 1.0
NC_010480_1 1.86|61076|38|NC_010480|CRISPRCasFinder,CRT,PILER-CR 61076-61113 38 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 61076-61113 0 1.0
NC_010480_1 1.87|61150|39|NC_010480|CRISPRCasFinder,CRT,PILER-CR 61150-61188 39 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 61150-61188 0 1.0
NC_010480_1 1.88|61225|39|NC_010480|CRISPRCasFinder,CRT,PILER-CR 61225-61263 39 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 61225-61263 0 1.0
NC_010480_1 1.89|54564|49|NC_010480|CRT 54564-54612 49 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 54564-54612 0 1.0
NC_010480_1 1.90|54644|42|NC_010480|CRT 54644-54685 42 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 54644-54685 0 1.0
NC_010480_1 1.91|54717|43|NC_010480|CRT 54717-54759 43 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 54717-54759 0 1.0
NC_010480_1 1.92|54791|40|NC_010480|CRT 54791-54830 40 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 54791-54830 0 1.0
NC_010480_1 1.93|54862|48|NC_010480|CRT 54862-54909 48 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 54862-54909 0 1.0
NC_010480_1 1.94|54941|40|NC_010480|CRT 54941-54980 40 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 54941-54980 0 1.0
NC_010480_1 1.95|55012|42|NC_010480|CRT 55012-55053 42 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 55012-55053 0 1.0
NC_010480_1 1.96|55085|46|NC_010480|CRT 55085-55130 46 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 55085-55130 0 1.0
NC_010480_1 1.97|55162|43|NC_010480|CRT 55162-55204 43 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 55162-55204 0 1.0
NC_010480_1 1.98|55236|47|NC_010480|CRT 55236-55282 47 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 55236-55282 0 1.0
NC_010480_1 1.99|55314|45|NC_010480|CRT 55314-55358 45 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 55314-55358 0 1.0
NC_010480_1 1.100|55390|47|NC_010480|CRT 55390-55436 47 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 55390-55436 0 1.0
NC_010480_1 1.101|55468|45|NC_010480|CRT 55468-55512 45 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 55468-55512 0 1.0
NC_010480_1 1.102|55544|45|NC_010480|CRT 55544-55588 45 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 55544-55588 0 1.0
NC_010480_1 1.103|55620|44|NC_010480|CRT 55620-55663 44 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 55620-55663 0 1.0
NC_010480_1 1.104|55695|41|NC_010480|CRT 55695-55735 41 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 55695-55735 0 1.0
NC_010480_1 1.105|55767|51|NC_010480|CRT 55767-55817 51 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 55767-55817 0 1.0
NC_010480_1 1.106|55849|45|NC_010480|CRT 55849-55893 45 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 55849-55893 0 1.0
NC_010480_1 1.107|55925|40|NC_010480|CRT 55925-55964 40 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 55925-55964 0 1.0
NC_010480_1 1.108|55996|44|NC_010480|CRT 55996-56039 44 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 55996-56039 0 1.0
NC_010480_1 1.109|56071|45|NC_010480|CRT 56071-56115 45 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 56071-56115 0 1.0
NC_010480_1 1.110|56147|44|NC_010480|CRT 56147-56190 44 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 56147-56190 0 1.0
NC_010480_1 1.110|56147|44|NC_010480|CRT 56147-56190 44 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 56222-56265 0 1.0
NC_010480_1 1.111|56222|44|NC_010480|CRT 56222-56265 44 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 56147-56190 0 1.0
NC_010480_1 1.111|56222|44|NC_010480|CRT 56222-56265 44 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 56222-56265 0 1.0
NC_010480_1 1.112|56297|43|NC_010480|CRT 56297-56339 43 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 56297-56339 0 1.0
NC_010480_1 1.112|56297|43|NC_010480|CRT 56297-56339 43 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 56371-56413 0 1.0
NC_010480_1 1.113|56371|43|NC_010480|CRT 56371-56413 43 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 56297-56339 0 1.0
NC_010480_1 1.113|56371|43|NC_010480|CRT 56371-56413 43 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 56371-56413 0 1.0
NC_010480_1 1.114|56445|42|NC_010480|CRT 56445-56486 42 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 56445-56486 0 1.0
NC_010480_1 1.115|56518|50|NC_010480|CRT 56518-56567 50 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 56518-56567 0 1.0
NC_010480_1 1.116|56599|45|NC_010480|CRT 56599-56643 45 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 56599-56643 0 1.0
NC_010480_1 1.117|56675|47|NC_010480|CRT 56675-56721 47 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 56675-56721 0 1.0
NC_010480_1 1.118|56753|53|NC_010480|CRT 56753-56805 53 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 56753-56805 0 1.0
NC_010480_1 1.119|56837|45|NC_010480|CRT 56837-56881 45 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 56837-56881 0 1.0
NC_010480_1 1.120|56913|41|NC_010480|CRT 56913-56953 41 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 56913-56953 0 1.0
NC_010480_1 1.121|56985|45|NC_010480|CRT 56985-57029 45 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 56985-57029 0 1.0
NC_010480_1 1.122|57061|48|NC_010480|CRT 57061-57108 48 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 57061-57108 0 1.0
NC_010480_1 1.122|57061|48|NC_010480|CRT 57061-57108 48 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 57698-57745 0 1.0
NC_010480_1 1.123|57140|44|NC_010480|CRT 57140-57183 44 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 57140-57183 0 1.0
NC_010480_1 1.123|57140|44|NC_010480|CRT 57140-57183 44 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 57777-57820 0 1.0
NC_010480_1 1.124|57318|47|NC_010480|CRT 57318-57364 47 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 57318-57364 0 1.0
NC_010480_1 1.124|57318|47|NC_010480|CRT 57318-57364 47 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 57955-58001 0 1.0
NC_010480_1 1.125|57396|46|NC_010480|CRT 57396-57441 46 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 57396-57441 0 1.0
NC_010480_1 1.126|57473|40|NC_010480|CRT 57473-57512 40 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 57473-57512 0 1.0
NC_010480_1 1.126|57473|40|NC_010480|CRT 57473-57512 40 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 58109-58148 0 1.0
NC_010480_1 1.127|57544|43|NC_010480|CRT 57544-57586 43 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 57544-57586 0 1.0
NC_010480_1 1.127|57544|43|NC_010480|CRT 57544-57586 43 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 58180-58222 0 1.0
NC_010480_1 1.128|57618|44|NC_010480|CRT 57618-57661 44 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 57618-57661 0 1.0
NC_010480_1 1.129|57693|48|NC_010480|CRT 57693-57740 48 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 57056-57103 0 1.0
NC_010480_1 1.129|57693|48|NC_010480|CRT 57693-57740 48 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 57693-57740 0 1.0
NC_010480_1 1.130|57772|44|NC_010480|CRT 57772-57815 44 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 57135-57178 0 1.0
NC_010480_1 1.130|57772|44|NC_010480|CRT 57772-57815 44 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 57772-57815 0 1.0
NC_010480_1 1.131|57328|42|NC_010480|CRT 57328-57369 42 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 57328-57369 0 1.0
NC_010480_1 1.131|57328|42|NC_010480|CRT 57328-57369 42 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 57965-58006 0 1.0
NC_010480_1 1.132|57406|41|NC_010480|CRT 57406-57446 41 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 57406-57446 0 1.0
NC_010480_1 1.133|57483|35|NC_010480|CRT 57483-57517 35 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 57483-57517 0 1.0
NC_010480_1 1.133|57483|35|NC_010480|CRT 57483-57517 35 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 58119-58153 0 1.0
NC_010480_1 1.134|57554|38|NC_010480|CRT 57554-57591 38 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 57554-57591 0 1.0
NC_010480_1 1.134|57554|38|NC_010480|CRT 57554-57591 38 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 58190-58227 0 1.0
NC_010480_1 1.135|57628|39|NC_010480|CRT 57628-57666 39 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 57628-57666 0 1.0
NC_010480_1 1.136|57703|43|NC_010480|CRT 57703-57745 43 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 57066-57108 0 1.0
NC_010480_1 1.136|57703|43|NC_010480|CRT 57703-57745 43 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 57703-57745 0 1.0
NC_010480_1 1.137|57782|39|NC_010480|CRT 57782-57820 39 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 57145-57183 0 1.0
NC_010480_1 1.137|57782|39|NC_010480|CRT 57782-57820 39 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 57782-57820 0 1.0
NC_010480_1 1.38|57401|41|NC_010480|CRISPRCasFinder,PILER-CR 57401-57441 41 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 58037-58077 1 0.976
NC_010480_1 1.46|58038|40|NC_010480|CRISPRCasFinder,CRT,PILER-CR 58038-58077 40 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 57402-57441 1 0.975
NC_010480_1 1.132|57406|41|NC_010480|CRT 57406-57446 41 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 58042-58082 5 0.878
NC_010480_1 1.138|57857|67|NC_010480|CRT 57857-57923 67 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 57220-57286 7 0.896
NC_010480_1 1.138|57857|67|NC_010480|CRT 57857-57923 67 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 57857-57923 7 0.896
NC_010480_1 1.36|57215|72|NC_010480|CRISPRCasFinder,CRT 57215-57286 72 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 57215-57286 12 0.833
NC_010480_1 1.36|57215|72|NC_010480|CRISPRCasFinder,CRT 57215-57286 72 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 57852-57923 12 0.833
NC_010480_1 1.44|57852|72|NC_010480|CRISPRCasFinder 57852-57923 72 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 57215-57286 12 0.833
NC_010480_1 1.44|57852|72|NC_010480|CRISPRCasFinder 57852-57923 72 NC_010480 Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence 57852-57923 12 0.833

1. spacer 1.1|54564|44|NC_010480|CRISPRCasFinder,CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

aagcagagacagggattgagagaacaccagcaaactccttattg	CRISPR spacer
aagcagagacagggattgagagaacaccagcaaactccttattg	Protospacer
********************************************

2. spacer 1.2|54644|37|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

ttagagggcttctcttgagctttgttggcgagtaaca	CRISPR spacer
ttagagggcttctcttgagctttgttggcgagtaaca	Protospacer
*************************************

3. spacer 1.3|54717|38|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

ataaggatctattaaaagcaaatcaacatctattttaa	CRISPR spacer
ataaggatctattaaaagcaaatcaacatctattttaa	Protospacer
**************************************

4. spacer 1.4|54791|35|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

tggtttactgctgagttcttggtgacttacaccaa	CRISPR spacer
tggtttactgctgagttcttggtgacttacaccaa	Protospacer
***********************************

5. spacer 1.5|54862|43|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

atgagtgctatgggttatcgatcctatgatcagctattgaacc	CRISPR spacer
atgagtgctatgggttatcgatcctatgatcagctattgaacc	Protospacer
*******************************************

6. spacer 1.6|54941|35|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

tttattgttaaagcgttgagcttcctcaacaagtt	CRISPR spacer
tttattgttaaagcgttgagcttcctcaacaagtt	Protospacer
***********************************

7. spacer 1.7|55012|37|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

ggtgaaggagaaaaacttccctgagtttagtaaggag	CRISPR spacer
ggtgaaggagaaaaacttccctgagtttagtaaggag	Protospacer
*************************************

8. spacer 1.8|55085|41|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

tactgcagaagtccgctttggacccgatgactatcaaaaga	CRISPR spacer
tactgcagaagtccgctttggacccgatgactatcaaaaga	Protospacer
*****************************************

9. spacer 1.9|55162|38|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

cagagattgtagatcatatagactttctatggaactat	CRISPR spacer
cagagattgtagatcatatagactttctatggaactat	Protospacer
**************************************

10. spacer 1.10|55236|42|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

acaagaaatggctgaatatcttgatgaattactttctgttaa	CRISPR spacer
acaagaaatggctgaatatcttgatgaattactttctgttaa	Protospacer
******************************************

11. spacer 1.11|55314|40|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

ttgtaaagatgaccctacggttaaagaattttctagaatc	CRISPR spacer
ttgtaaagatgaccctacggttaaagaattttctagaatc	Protospacer
****************************************

12. spacer 1.12|55390|42|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

ttttttcagtcacaatcagaaaaattctataaagaattgagt	CRISPR spacer
ttttttcagtcacaatcagaaaaattctataaagaattgagt	Protospacer
******************************************

13. spacer 1.13|55468|40|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

tgagagaagagaaaaagtatgttcacgcctttgtacaagg	CRISPR spacer
tgagagaagagaaaaagtatgttcacgcctttgtacaagg	Protospacer
****************************************

14. spacer 1.14|55544|40|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

gaaacaatatcagagtcaactccaataggaccaccaaaga	CRISPR spacer
gaaacaatatcagagtcaactccaataggaccaccaaaga	Protospacer
****************************************

15. spacer 1.15|55620|39|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

ttacgggcacgcctgtggcaattcacctttgacgaagtg	CRISPR spacer
ttacgggcacgcctgtggcaattcacctttgacgaagtg	Protospacer
***************************************

16. spacer 1.16|55695|36|NC_010480|CRISPRCasFinder,CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

agattagctagaacctcacgcaagggactaaagtgg	CRISPR spacer
agattagctagaacctcacgcaagggactaaagtgg	Protospacer
************************************

17. spacer 1.17|55767|46|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

cacagttgcgtaagctcttggtgagacaactaaaggcccatgccaa	CRISPR spacer
cacagttgcgtaagctcttggtgagacaactaaaggcccatgccaa	Protospacer
**********************************************

18. spacer 1.18|55849|40|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

tttgttcaccattgacgcagtattgcgtctggtaaactta	CRISPR spacer
tttgttcaccattgacgcagtattgcgtctggtaaactta	Protospacer
****************************************

19. spacer 1.19|55925|35|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

tggaattgttggagtcccccccacttattagcggc	CRISPR spacer
tggaattgttggagtcccccccacttattagcggc	Protospacer
***********************************

20. spacer 1.20|55996|39|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

atcgtgttagtcaagtatttatatatgattacagctact	CRISPR spacer
atcgtgttagtcaagtatttatatatgattacagctact	Protospacer
***************************************

21. spacer 1.21|56071|40|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

aatagctaatgataggcagggttgcgtctgccttaccaac	CRISPR spacer
aatagctaatgataggcagggttgcgtctgccttaccaac	Protospacer
****************************************

22. spacer 1.22|56147|39|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

ttccaccctggttgttaaggtagggaatcttgtttggag	CRISPR spacer
ttccaccctggttgttaaggtagggaatcttgtttggag	Protospacer
***************************************

23. spacer 1.22|56147|39|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

ttccaccctggttgttaaggtagggaatcttgtttggag	CRISPR spacer
ttccaccctggttgttaaggtagggaatcttgtttggag	Protospacer
***************************************

24. spacer 1.23|56222|39|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

ttccaccctggttgttaaggtagggaatcttgtttggag	CRISPR spacer
ttccaccctggttgttaaggtagggaatcttgtttggag	Protospacer
***************************************

25. spacer 1.23|56222|39|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

ttccaccctggttgttaaggtagggaatcttgtttggag	CRISPR spacer
ttccaccctggttgttaaggtagggaatcttgtttggag	Protospacer
***************************************

26. spacer 1.24|56297|38|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

gtcgctgaacgggaacccgaaccagaactagaggagtt	CRISPR spacer
gtcgctgaacgggaacccgaaccagaactagaggagtt	Protospacer
**************************************

27. spacer 1.24|56297|38|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

gtcgctgaacgggaacccgaaccagaactagaggagtt	CRISPR spacer
gtcgctgaacgggaacccgaaccagaactagaggagtt	Protospacer
**************************************

28. spacer 1.25|56371|38|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

gtcgctgaacgggaacccgaaccagaactagaggagtt	CRISPR spacer
gtcgctgaacgggaacccgaaccagaactagaggagtt	Protospacer
**************************************

29. spacer 1.25|56371|38|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

gtcgctgaacgggaacccgaaccagaactagaggagtt	CRISPR spacer
gtcgctgaacgggaacccgaaccagaactagaggagtt	Protospacer
**************************************

30. spacer 1.26|56445|37|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

attggtctcaatatgagctaactgccgatcagttaga	CRISPR spacer
attggtctcaatatgagctaactgccgatcagttaga	Protospacer
*************************************

31. spacer 1.27|56518|45|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

cgcattagcattcttacgggcaatgaatagtttttcctcagggag	CRISPR spacer
cgcattagcattcttacgggcaatgaatagtttttcctcagggag	Protospacer
*********************************************

32. spacer 1.28|56599|40|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

aatgacctgtctcttcagtacgggtaggtcaattcccgta	CRISPR spacer
aatgacctgtctcttcagtacgggtaggtcaattcccgta	Protospacer
****************************************

33. spacer 1.29|56675|42|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

cgggtaaaggattggttcgatacgactatacagctcaaaagg	CRISPR spacer
cgggtaaaggattggttcgatacgactatacagctcaaaagg	Protospacer
******************************************

34. spacer 1.30|56753|48|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

ttgattacagcgcaatgacagtgcgtgaattgcgtgcgctgtgctctt	CRISPR spacer
ttgattacagcgcaatgacagtgcgtgaattgcgtgcgctgtgctctt	Protospacer
************************************************

35. spacer 1.31|56837|40|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

ttcaagtgaaacgccgtaacaagtccgtattggccaacct	CRISPR spacer
ttcaagtgaaacgccgtaacaagtccgtattggccaacct	Protospacer
****************************************

36. spacer 1.32|56913|36|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

ttatgttcggttttatctctaatttattcacttcta	CRISPR spacer
ttatgttcggttttatctctaatttattcacttcta	Protospacer
************************************

37. spacer 1.33|56985|40|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

cggttgattctttggtacagtttgaccaagtaactactgc	CRISPR spacer
cggttgattctttggtacagtttgaccaagtaactactgc	Protospacer
****************************************

38. spacer 1.34|57061|43|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

gtacatttatgtaaatagcaattacctaaatgctgagctgcgt	CRISPR spacer
gtacatttatgtaaatagcaattacctaaatgctgagctgcgt	Protospacer
*******************************************

39. spacer 1.34|57061|43|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

gtacatttatgtaaatagcaattacctaaatgctgagctgcgt	CRISPR spacer
gtacatttatgtaaatagcaattacctaaatgctgagctgcgt	Protospacer
*******************************************

40. spacer 1.35|57140|39|NC_010480|CRISPRCasFinder,CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

aggttcagccaaatcaatgggctggaggaagaatacgtt	CRISPR spacer
aggttcagccaaatcaatgggctggaggaagaatacgtt	Protospacer
***************************************

41. spacer 1.35|57140|39|NC_010480|CRISPRCasFinder,CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

aggttcagccaaatcaatgggctggaggaagaatacgtt	CRISPR spacer
aggttcagccaaatcaatgggctggaggaagaatacgtt	Protospacer
***************************************

42. spacer 1.37|57323|42|NC_010480|CRISPRCasFinder,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

aattaatggtttagttgatgtaactcttcgtcttaaggctga	CRISPR spacer
aattaatggtttagttgatgtaactcttcgtcttaaggctga	Protospacer
******************************************

43. spacer 1.37|57323|42|NC_010480|CRISPRCasFinder,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

aattaatggtttagttgatgtaactcttcgtcttaaggctga	CRISPR spacer
aattaatggtttagttgatgtaactcttcgtcttaaggctga	Protospacer
******************************************

44. spacer 1.38|57401|41|NC_010480|CRISPRCasFinder,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

ctacctcaacttttgtagacggcgacggaaaacgacctgtt	CRISPR spacer
ctacctcaacttttgtagacggcgacggaaaacgacctgtt	Protospacer
*****************************************

45. spacer 1.39|57478|35|NC_010480|CRISPRCasFinder,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

gatttttaatcctgtaatgtgtcgagggtgctgcc	CRISPR spacer
gatttttaatcctgtaatgtgtcgagggtgctgcc	Protospacer
***********************************

46. spacer 1.39|57478|35|NC_010480|CRISPRCasFinder,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

gatttttaatcctgtaatgtgtcgagggtgctgcc	CRISPR spacer
gatttttaatcctgtaatgtgtcgagggtgctgcc	Protospacer
***********************************

47. spacer 1.40|57549|38|NC_010480|CRISPRCasFinder,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

ttgatgtgtaattgggaagacgtcgcggctattgaggc	CRISPR spacer
ttgatgtgtaattgggaagacgtcgcggctattgaggc	Protospacer
**************************************

48. spacer 1.40|57549|38|NC_010480|CRISPRCasFinder,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

ttgatgtgtaattgggaagacgtcgcggctattgaggc	CRISPR spacer
ttgatgtgtaattgggaagacgtcgcggctattgaggc	Protospacer
**************************************

49. spacer 1.41|57623|39|NC_010480|CRISPRCasFinder,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

tctactatgaattaagtcatctaatgacatgtgatgact	CRISPR spacer
tctactatgaattaagtcatctaatgacatgtgatgact	Protospacer
***************************************

50. spacer 1.42|57698|43|NC_010480|CRISPRCasFinder,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

gtacatttatgtaaatagcaattacctaaatgctgagctgcgt	CRISPR spacer
gtacatttatgtaaatagcaattacctaaatgctgagctgcgt	Protospacer
*******************************************

51. spacer 1.42|57698|43|NC_010480|CRISPRCasFinder,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

gtacatttatgtaaatagcaattacctaaatgctgagctgcgt	CRISPR spacer
gtacatttatgtaaatagcaattacctaaatgctgagctgcgt	Protospacer
*******************************************

52. spacer 1.43|57777|39|NC_010480|CRISPRCasFinder matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

aggttcagccaaatcaatgggctggaggaagaatacgtt	CRISPR spacer
aggttcagccaaatcaatgggctggaggaagaatacgtt	Protospacer
***************************************

53. spacer 1.43|57777|39|NC_010480|CRISPRCasFinder matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

aggttcagccaaatcaatgggctggaggaagaatacgtt	CRISPR spacer
aggttcagccaaatcaatgggctggaggaagaatacgtt	Protospacer
***************************************

54. spacer 1.45|57960|42|NC_010480|CRISPRCasFinder,CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

aattaatggtttagttgatgtaactcttcgtcttaaggctga	CRISPR spacer
aattaatggtttagttgatgtaactcttcgtcttaaggctga	Protospacer
******************************************

55. spacer 1.45|57960|42|NC_010480|CRISPRCasFinder,CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

aattaatggtttagttgatgtaactcttcgtcttaaggctga	CRISPR spacer
aattaatggtttagttgatgtaactcttcgtcttaaggctga	Protospacer
******************************************

56. spacer 1.46|58038|40|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

ctacctcaactttgtagacggcgacggaaaacgacctgtt	CRISPR spacer
ctacctcaactttgtagacggcgacggaaaacgacctgtt	Protospacer
****************************************

57. spacer 1.47|58114|35|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

gatttttaatcctgtaatgtgtcgagggtgctgcc	CRISPR spacer
gatttttaatcctgtaatgtgtcgagggtgctgcc	Protospacer
***********************************

58. spacer 1.47|58114|35|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

gatttttaatcctgtaatgtgtcgagggtgctgcc	CRISPR spacer
gatttttaatcctgtaatgtgtcgagggtgctgcc	Protospacer
***********************************

59. spacer 1.48|58185|38|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

ttgatgtgtaattgggaagacgtcgcggctattgaggc	CRISPR spacer
ttgatgtgtaattgggaagacgtcgcggctattgaggc	Protospacer
**************************************

60. spacer 1.48|58185|38|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

ttgatgtgtaattgggaagacgtcgcggctattgaggc	CRISPR spacer
ttgatgtgtaattgggaagacgtcgcggctattgaggc	Protospacer
**************************************

61. spacer 1.49|58259|40|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

tgaccgtaagtgggatccgacgtctttggatgtcaaagtc	CRISPR spacer
tgaccgtaagtgggatccgacgtctttggatgtcaaagtc	Protospacer
****************************************

62. spacer 1.50|58335|42|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

ctcaagaaagccacccgtgttggtgaagttatcatgggtaaa	CRISPR spacer
ctcaagaaagccacccgtgttggtgaagttatcatgggtaaa	Protospacer
******************************************

63. spacer 1.51|58413|42|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

ttctcctacttcttttaagaagaaagccgcagaaatgtgtgc	CRISPR spacer
ttctcctacttcttttaagaagaaagccgcagaaatgtgtgc	Protospacer
******************************************

64. spacer 1.52|58491|43|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

tttccctctacaaagagatgacccgtaagcccatgagccgcaa	CRISPR spacer
tttccctctacaaagagatgacccgtaagcccatgagccgcaa	Protospacer
*******************************************

65. spacer 1.53|58570|41|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

aaaaaagttctaggggcttttggctttctcaagtatttgga	CRISPR spacer
aaaaaagttctaggggcttttggctttctcaagtatttgga	Protospacer
*****************************************

66. spacer 1.54|58647|36|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

agatctttattgaggaggaggtgttacaacctccaa	CRISPR spacer
agatctttattgaggaggaggtgttacaacctccaa	Protospacer
************************************

67. spacer 1.55|58719|40|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

ccccgaagacgggggtgaagtgttctacagctgccttcaa	CRISPR spacer
ccccgaagacgggggtgaagtgttctacagctgccttcaa	Protospacer
****************************************

68. spacer 1.56|58795|42|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

gactacggtagctacggttacctagtcttcgctagaggcgaa	CRISPR spacer
gactacggtagctacggttacctagtcttcgctagaggcgaa	Protospacer
******************************************

69. spacer 1.57|58873|36|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

gcctttcggcttttagacggactcatactacctcca	CRISPR spacer
gcctttcggcttttagacggactcatactacctcca	Protospacer
************************************

70. spacer 1.58|58945|42|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

ggattgaggttgacgtacaacctatagaaaaagagatagatg	CRISPR spacer
ggattgaggttgacgtacaacctatagaaaaagagatagatg	Protospacer
******************************************

71. spacer 1.59|59023|36|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

aggggaatggattctagatctgataccttgggaata	CRISPR spacer
aggggaatggattctagatctgataccttgggaata	Protospacer
************************************

72. spacer 1.60|59095|38|NC_010480|CRISPRCasFinder,CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

aaccttatagccgtaagcctatcctcaagaaaggtaag	CRISPR spacer
aaccttatagccgtaagcctatcctcaagaaaggtaag	Protospacer
**************************************

73. spacer 1.61|59169|46|NC_010480|CRISPRCasFinder,CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

tttattcaagataattgtgttgcagaagtgattgttagaatctaaa	CRISPR spacer
tttattcaagataattgtgttgcagaagtgattgttagaatctaaa	Protospacer
**********************************************

74. spacer 1.62|59251|42|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

gtccaatggggactgcattatgcaggggggtctaaagaaact	CRISPR spacer
gtccaatggggactgcattatgcaggggggtctaaagaaact	Protospacer
******************************************

75. spacer 1.63|59329|43|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

aatactccgttttaggattaaatgaagcttatttggcttcatt	CRISPR spacer
aatactccgttttaggattaaatgaagcttatttggcttcatt	Protospacer
*******************************************

76. spacer 1.64|59408|39|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

tcagcagtgaggggagcggtagcaaatagattagagata	CRISPR spacer
tcagcagtgaggggagcggtagcaaatagattagagata	Protospacer
***************************************

77. spacer 1.65|59483|41|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

cattgagtgaaagcgttgtctgtttccaagaaatctactac	CRISPR spacer
cattgagtgaaagcgttgtctgtttccaagaaatctactac	Protospacer
*****************************************

78. spacer 1.66|59560|38|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

aggcttaaaattatgtctaacgttatcactagagaaga	CRISPR spacer
aggcttaaaattatgtctaacgttatcactagagaaga	Protospacer
**************************************

79. spacer 1.67|59634|43|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

tcattgtcaccttcgttagaagcagcccacactagaggatcta	CRISPR spacer
tcattgtcaccttcgttagaagcagcccacactagaggatcta	Protospacer
*******************************************

80. spacer 1.68|59713|38|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

tatgtctaacatttgtgtcgattttgatcgtgcttggg	CRISPR spacer
tatgtctaacatttgtgtcgattttgatcgtgcttggg	Protospacer
**************************************

81. spacer 1.69|59787|38|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

ggttccattgattgttagcacaggtttatttgattatt	CRISPR spacer
ggttccattgattgttagcacaggtttatttgattatt	Protospacer
**************************************

82. spacer 1.70|59861|40|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

taacccacttttcctaatccgactctccccaccctgtcgg	CRISPR spacer
taacccacttttcctaatccgactctccccaccctgtcgg	Protospacer
****************************************

83. spacer 1.71|59937|38|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

accctcaaggagttctcaaagaaggctattctgatcat	CRISPR spacer
accctcaaggagttctcaaagaaggctattctgatcat	Protospacer
**************************************

84. spacer 1.72|60011|39|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

ttaattcaaactgaggacgtgccctcagatatgagagaa	CRISPR spacer
ttaattcaaactgaggacgtgccctcagatatgagagaa	Protospacer
***************************************

85. spacer 1.73|60086|41|NC_010480|CRISPRCasFinder,CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

cacatttacaggaaaaccaaaatgactacgaagcaacaaaa	CRISPR spacer
cacatttacaggaaaaccaaaatgactacgaagcaacaaaa	Protospacer
*****************************************

86. spacer 1.74|60163|45|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

caactgcgttaagccccgcactacagcacgctgttttgagacagc	CRISPR spacer
caactgcgttaagccccgcactacagcacgctgttttgagacagc	Protospacer
*********************************************

87. spacer 1.75|60244|39|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

ttttgaaacaatcaaaagagagcagcggcctttatattc	CRISPR spacer
ttttgaaacaatcaaaagagagcagcggcctttatattc	Protospacer
***************************************

88. spacer 1.76|60319|35|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

actctgggaagttcttctcctttaccccagggcga	CRISPR spacer
actctgggaagttcttctcctttaccccagggcga	Protospacer
***********************************

89. spacer 1.77|60390|41|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

cttcaactgttgcgcagacaattgctgctgctcctcagtat	CRISPR spacer
cttcaactgttgcgcagacaattgctgctgctcctcagtat	Protospacer
*****************************************

90. spacer 1.78|60467|38|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

aataaacccactgcaaaggaatataaatcgcttagagg	CRISPR spacer
aataaacccactgcaaaggaatataaatcgcttagagg	Protospacer
**************************************

91. spacer 1.79|60541|42|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

tcaaagcgcataccttgaatgttagcagtgcccttaagagcc	CRISPR spacer
tcaaagcgcataccttgaatgttagcagtgcccttaagagcc	Protospacer
******************************************

92. spacer 1.80|60619|41|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

atataaacaccctgtacaattacgatttaaaatcgtctcaa	CRISPR spacer
atataaacaccctgtacaattacgatttaaaatcgtctcaa	Protospacer
*****************************************

93. spacer 1.81|60696|39|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

ccgatagaacccgacaatcatttccgcgtcttgttcaat	CRISPR spacer
ccgatagaacccgacaatcatttccgcgtcttgttcaat	Protospacer
***************************************

94. spacer 1.82|60771|41|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

ttctacctgaactggagcactatctcagtgaagtcaaggca	CRISPR spacer
ttctacctgaactggagcactatctcagtgaagtcaaggca	Protospacer
*****************************************

95. spacer 1.83|60848|41|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

acatgtttgatctaactaatggtttagttgatgtcactctt	CRISPR spacer
acatgtttgatctaactaatggtttagttgatgtcactctt	Protospacer
*****************************************

96. spacer 1.84|60925|39|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

tgctaatctaaaagggctatcaattgagatagccctttt	CRISPR spacer
tgctaatctaaaagggctatcaattgagatagccctttt	Protospacer
***************************************

97. spacer 1.85|61000|40|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

tcgtcaagaagattggagactgggttattctccaaatcga	CRISPR spacer
tcgtcaagaagattggagactgggttattctccaaatcga	Protospacer
****************************************

98. spacer 1.86|61076|38|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

ttcggctaacatgtgaactggcagggcgtgagcccata	CRISPR spacer
ttcggctaacatgtgaactggcagggcgtgagcccata	Protospacer
**************************************

99. spacer 1.87|61150|39|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

gtctgagttggataaagctgattgggatatacagaatca	CRISPR spacer
gtctgagttggataaagctgattgggatatacagaatca	Protospacer
***************************************

100. spacer 1.88|61225|39|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

ttagcactcttcgtattccctctgaagttcgcaaggtgg	CRISPR spacer
ttagcactcttcgtattccctctgaagttcgcaaggtgg	Protospacer
***************************************

101. spacer 1.89|54564|49|NC_010480|CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

aagcagagacagggattgagagaacaccagcaaactccttattggtttc	CRISPR spacer
aagcagagacagggattgagagaacaccagcaaactccttattggtttc	Protospacer
*************************************************

102. spacer 1.90|54644|42|NC_010480|CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

ttagagggcttctcttgagctttgttggcgagtaacagtttc	CRISPR spacer
ttagagggcttctcttgagctttgttggcgagtaacagtttc	Protospacer
******************************************

103. spacer 1.91|54717|43|NC_010480|CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

ataaggatctattaaaagcaaatcaacatctattttaagtttc	CRISPR spacer
ataaggatctattaaaagcaaatcaacatctattttaagtttc	Protospacer
*******************************************

104. spacer 1.92|54791|40|NC_010480|CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

tggtttactgctgagttcttggtgacttacaccaagtttc	CRISPR spacer
tggtttactgctgagttcttggtgacttacaccaagtttc	Protospacer
****************************************

105. spacer 1.93|54862|48|NC_010480|CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

atgagtgctatgggttatcgatcctatgatcagctattgaaccgtttc	CRISPR spacer
atgagtgctatgggttatcgatcctatgatcagctattgaaccgtttc	Protospacer
************************************************

106. spacer 1.94|54941|40|NC_010480|CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

tttattgttaaagcgttgagcttcctcaacaagttgtttc	CRISPR spacer
tttattgttaaagcgttgagcttcctcaacaagttgtttc	Protospacer
****************************************

107. spacer 1.95|55012|42|NC_010480|CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

ggtgaaggagaaaaacttccctgagtttagtaaggaggtttc	CRISPR spacer
ggtgaaggagaaaaacttccctgagtttagtaaggaggtttc	Protospacer
******************************************

108. spacer 1.96|55085|46|NC_010480|CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

tactgcagaagtccgctttggacccgatgactatcaaaagagtttc	CRISPR spacer
tactgcagaagtccgctttggacccgatgactatcaaaagagtttc	Protospacer
**********************************************

109. spacer 1.97|55162|43|NC_010480|CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

cagagattgtagatcatatagactttctatggaactatgtttc	CRISPR spacer
cagagattgtagatcatatagactttctatggaactatgtttc	Protospacer
*******************************************

110. spacer 1.98|55236|47|NC_010480|CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

acaagaaatggctgaatatcttgatgaattactttctgttaagtttc	CRISPR spacer
acaagaaatggctgaatatcttgatgaattactttctgttaagtttc	Protospacer
***********************************************

111. spacer 1.99|55314|45|NC_010480|CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

ttgtaaagatgaccctacggttaaagaattttctagaatcgtttc	CRISPR spacer
ttgtaaagatgaccctacggttaaagaattttctagaatcgtttc	Protospacer
*********************************************

112. spacer 1.100|55390|47|NC_010480|CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

ttttttcagtcacaatcagaaaaattctataaagaattgagtgtttc	CRISPR spacer
ttttttcagtcacaatcagaaaaattctataaagaattgagtgtttc	Protospacer
***********************************************

113. spacer 1.101|55468|45|NC_010480|CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

tgagagaagagaaaaagtatgttcacgcctttgtacaagggtttc	CRISPR spacer
tgagagaagagaaaaagtatgttcacgcctttgtacaagggtttc	Protospacer
*********************************************

114. spacer 1.102|55544|45|NC_010480|CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

gaaacaatatcagagtcaactccaataggaccaccaaagagtttc	CRISPR spacer
gaaacaatatcagagtcaactccaataggaccaccaaagagtttc	Protospacer
*********************************************

115. spacer 1.103|55620|44|NC_010480|CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

ttacgggcacgcctgtggcaattcacctttgacgaagtggtttc	CRISPR spacer
ttacgggcacgcctgtggcaattcacctttgacgaagtggtttc	Protospacer
********************************************

116. spacer 1.104|55695|41|NC_010480|CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

agattagctagaacctcacgcaagggactaaagtgggtttc	CRISPR spacer
agattagctagaacctcacgcaagggactaaagtgggtttc	Protospacer
*****************************************

117. spacer 1.105|55767|51|NC_010480|CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

cacagttgcgtaagctcttggtgagacaactaaaggcccatgccaagtttc	CRISPR spacer
cacagttgcgtaagctcttggtgagacaactaaaggcccatgccaagtttc	Protospacer
***************************************************

118. spacer 1.106|55849|45|NC_010480|CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

tttgttcaccattgacgcagtattgcgtctggtaaacttagtttc	CRISPR spacer
tttgttcaccattgacgcagtattgcgtctggtaaacttagtttc	Protospacer
*********************************************

119. spacer 1.107|55925|40|NC_010480|CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

tggaattgttggagtcccccccacttattagcggcgtttc	CRISPR spacer
tggaattgttggagtcccccccacttattagcggcgtttc	Protospacer
****************************************

120. spacer 1.108|55996|44|NC_010480|CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

atcgtgttagtcaagtatttatatatgattacagctactgtttc	CRISPR spacer
atcgtgttagtcaagtatttatatatgattacagctactgtttc	Protospacer
********************************************

121. spacer 1.109|56071|45|NC_010480|CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

aatagctaatgataggcagggttgcgtctgccttaccaacgtttc	CRISPR spacer
aatagctaatgataggcagggttgcgtctgccttaccaacgtttc	Protospacer
*********************************************

122. spacer 1.110|56147|44|NC_010480|CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

ttccaccctggttgttaaggtagggaatcttgtttggaggtttc	CRISPR spacer
ttccaccctggttgttaaggtagggaatcttgtttggaggtttc	Protospacer
********************************************

123. spacer 1.110|56147|44|NC_010480|CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

ttccaccctggttgttaaggtagggaatcttgtttggaggtttc	CRISPR spacer
ttccaccctggttgttaaggtagggaatcttgtttggaggtttc	Protospacer
********************************************

124. spacer 1.111|56222|44|NC_010480|CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

ttccaccctggttgttaaggtagggaatcttgtttggaggtttc	CRISPR spacer
ttccaccctggttgttaaggtagggaatcttgtttggaggtttc	Protospacer
********************************************

125. spacer 1.111|56222|44|NC_010480|CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

ttccaccctggttgttaaggtagggaatcttgtttggaggtttc	CRISPR spacer
ttccaccctggttgttaaggtagggaatcttgtttggaggtttc	Protospacer
********************************************

126. spacer 1.112|56297|43|NC_010480|CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

gtcgctgaacgggaacccgaaccagaactagaggagttgtttc	CRISPR spacer
gtcgctgaacgggaacccgaaccagaactagaggagttgtttc	Protospacer
*******************************************

127. spacer 1.112|56297|43|NC_010480|CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

gtcgctgaacgggaacccgaaccagaactagaggagttgtttc	CRISPR spacer
gtcgctgaacgggaacccgaaccagaactagaggagttgtttc	Protospacer
*******************************************

128. spacer 1.113|56371|43|NC_010480|CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

gtcgctgaacgggaacccgaaccagaactagaggagttgtttc	CRISPR spacer
gtcgctgaacgggaacccgaaccagaactagaggagttgtttc	Protospacer
*******************************************

129. spacer 1.113|56371|43|NC_010480|CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

gtcgctgaacgggaacccgaaccagaactagaggagttgtttc	CRISPR spacer
gtcgctgaacgggaacccgaaccagaactagaggagttgtttc	Protospacer
*******************************************

130. spacer 1.114|56445|42|NC_010480|CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

attggtctcaatatgagctaactgccgatcagttagagtttc	CRISPR spacer
attggtctcaatatgagctaactgccgatcagttagagtttc	Protospacer
******************************************

131. spacer 1.115|56518|50|NC_010480|CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

cgcattagcattcttacgggcaatgaatagtttttcctcagggaggtttc	CRISPR spacer
cgcattagcattcttacgggcaatgaatagtttttcctcagggaggtttc	Protospacer
**************************************************

132. spacer 1.116|56599|45|NC_010480|CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

aatgacctgtctcttcagtacgggtaggtcaattcccgtagtttc	CRISPR spacer
aatgacctgtctcttcagtacgggtaggtcaattcccgtagtttc	Protospacer
*********************************************

133. spacer 1.117|56675|47|NC_010480|CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

cgggtaaaggattggttcgatacgactatacagctcaaaagggtttc	CRISPR spacer
cgggtaaaggattggttcgatacgactatacagctcaaaagggtttc	Protospacer
***********************************************

134. spacer 1.118|56753|53|NC_010480|CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

ttgattacagcgcaatgacagtgcgtgaattgcgtgcgctgtgctcttgtttc	CRISPR spacer
ttgattacagcgcaatgacagtgcgtgaattgcgtgcgctgtgctcttgtttc	Protospacer
*****************************************************

135. spacer 1.119|56837|45|NC_010480|CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

ttcaagtgaaacgccgtaacaagtccgtattggccaacctgtttc	CRISPR spacer
ttcaagtgaaacgccgtaacaagtccgtattggccaacctgtttc	Protospacer
*********************************************

136. spacer 1.120|56913|41|NC_010480|CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

ttatgttcggttttatctctaatttattcacttctagtttc	CRISPR spacer
ttatgttcggttttatctctaatttattcacttctagtttc	Protospacer
*****************************************

137. spacer 1.121|56985|45|NC_010480|CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

cggttgattctttggtacagtttgaccaagtaactactgcgtttc	CRISPR spacer
cggttgattctttggtacagtttgaccaagtaactactgcgtttc	Protospacer
*********************************************

138. spacer 1.122|57061|48|NC_010480|CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

gtacatttatgtaaatagcaattacctaaatgctgagctgcgtgtttc	CRISPR spacer
gtacatttatgtaaatagcaattacctaaatgctgagctgcgtgtttc	Protospacer
************************************************

139. spacer 1.122|57061|48|NC_010480|CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

gtacatttatgtaaatagcaattacctaaatgctgagctgcgtgtttc	CRISPR spacer
gtacatttatgtaaatagcaattacctaaatgctgagctgcgtgtttc	Protospacer
************************************************

140. spacer 1.123|57140|44|NC_010480|CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

aggttcagccaaatcaatgggctggaggaagaatacgttgtttc	CRISPR spacer
aggttcagccaaatcaatgggctggaggaagaatacgttgtttc	Protospacer
********************************************

141. spacer 1.123|57140|44|NC_010480|CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

aggttcagccaaatcaatgggctggaggaagaatacgttgtttc	CRISPR spacer
aggttcagccaaatcaatgggctggaggaagaatacgttgtttc	Protospacer
********************************************

142. spacer 1.124|57318|47|NC_010480|CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

gaaacaattaatggtttagttgatgtaactcttcgtcttaaggctga	CRISPR spacer
gaaacaattaatggtttagttgatgtaactcttcgtcttaaggctga	Protospacer
***********************************************

143. spacer 1.124|57318|47|NC_010480|CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

gaaacaattaatggtttagttgatgtaactcttcgtcttaaggctga	CRISPR spacer
gaaacaattaatggtttagttgatgtaactcttcgtcttaaggctga	Protospacer
***********************************************

144. spacer 1.125|57396|46|NC_010480|CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

gaaacctacctcaacttttgtagacggcgacggaaaacgacctgtt	CRISPR spacer
gaaacctacctcaacttttgtagacggcgacggaaaacgacctgtt	Protospacer
**********************************************

145. spacer 1.126|57473|40|NC_010480|CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

gaaacgatttttaatcctgtaatgtgtcgagggtgctgcc	CRISPR spacer
gaaacgatttttaatcctgtaatgtgtcgagggtgctgcc	Protospacer
****************************************

146. spacer 1.126|57473|40|NC_010480|CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

gaaacgatttttaatcctgtaatgtgtcgagggtgctgcc	CRISPR spacer
gaaacgatttttaatcctgtaatgtgtcgagggtgctgcc	Protospacer
****************************************

147. spacer 1.127|57544|43|NC_010480|CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

gaaacttgatgtgtaattgggaagacgtcgcggctattgaggc	CRISPR spacer
gaaacttgatgtgtaattgggaagacgtcgcggctattgaggc	Protospacer
*******************************************

148. spacer 1.127|57544|43|NC_010480|CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

gaaacttgatgtgtaattgggaagacgtcgcggctattgaggc	CRISPR spacer
gaaacttgatgtgtaattgggaagacgtcgcggctattgaggc	Protospacer
*******************************************

149. spacer 1.128|57618|44|NC_010480|CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

gaaactctactatgaattaagtcatctaatgacatgtgatgact	CRISPR spacer
gaaactctactatgaattaagtcatctaatgacatgtgatgact	Protospacer
********************************************

150. spacer 1.129|57693|48|NC_010480|CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

gaaacgtacatttatgtaaatagcaattacctaaatgctgagctgcgt	CRISPR spacer
gaaacgtacatttatgtaaatagcaattacctaaatgctgagctgcgt	Protospacer
************************************************

151. spacer 1.129|57693|48|NC_010480|CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

gaaacgtacatttatgtaaatagcaattacctaaatgctgagctgcgt	CRISPR spacer
gaaacgtacatttatgtaaatagcaattacctaaatgctgagctgcgt	Protospacer
************************************************

152. spacer 1.130|57772|44|NC_010480|CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

gaaacaggttcagccaaatcaatgggctggaggaagaatacgtt	CRISPR spacer
gaaacaggttcagccaaatcaatgggctggaggaagaatacgtt	Protospacer
********************************************

153. spacer 1.130|57772|44|NC_010480|CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

gaaacaggttcagccaaatcaatgggctggaggaagaatacgtt	CRISPR spacer
gaaacaggttcagccaaatcaatgggctggaggaagaatacgtt	Protospacer
********************************************

154. spacer 1.131|57328|42|NC_010480|CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

atggtttagttgatgtaactcttcgtcttaaggctgagtttc	CRISPR spacer
atggtttagttgatgtaactcttcgtcttaaggctgagtttc	Protospacer
******************************************

155. spacer 1.131|57328|42|NC_010480|CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

atggtttagttgatgtaactcttcgtcttaaggctgagtttc	CRISPR spacer
atggtttagttgatgtaactcttcgtcttaaggctgagtttc	Protospacer
******************************************

156. spacer 1.132|57406|41|NC_010480|CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

tcaacttttgtagacggcgacggaaaacgacctgttgtttc	CRISPR spacer
tcaacttttgtagacggcgacggaaaacgacctgttgtttc	Protospacer
*****************************************

157. spacer 1.133|57483|35|NC_010480|CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

ttaatcctgtaatgtgtcgagggtgctgccgtttc	CRISPR spacer
ttaatcctgtaatgtgtcgagggtgctgccgtttc	Protospacer
***********************************

158. spacer 1.133|57483|35|NC_010480|CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

ttaatcctgtaatgtgtcgagggtgctgccgtttc	CRISPR spacer
ttaatcctgtaatgtgtcgagggtgctgccgtttc	Protospacer
***********************************

159. spacer 1.134|57554|38|NC_010480|CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgtaattgggaagacgtcgcggctattgaggcgtttc	CRISPR spacer
gtgtaattgggaagacgtcgcggctattgaggcgtttc	Protospacer
**************************************

160. spacer 1.134|57554|38|NC_010480|CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgtaattgggaagacgtcgcggctattgaggcgtttc	CRISPR spacer
gtgtaattgggaagacgtcgcggctattgaggcgtttc	Protospacer
**************************************

161. spacer 1.135|57628|39|NC_010480|CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

tatgaattaagtcatctaatgacatgtgatgactgtttc	CRISPR spacer
tatgaattaagtcatctaatgacatgtgatgactgtttc	Protospacer
***************************************

162. spacer 1.136|57703|43|NC_010480|CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

tttatgtaaatagcaattacctaaatgctgagctgcgtgtttc	CRISPR spacer
tttatgtaaatagcaattacctaaatgctgagctgcgtgtttc	Protospacer
*******************************************

163. spacer 1.136|57703|43|NC_010480|CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

tttatgtaaatagcaattacctaaatgctgagctgcgtgtttc	CRISPR spacer
tttatgtaaatagcaattacctaaatgctgagctgcgtgtttc	Protospacer
*******************************************

164. spacer 1.137|57782|39|NC_010480|CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

cagccaaatcaatgggctggaggaagaatacgttgtttc	CRISPR spacer
cagccaaatcaatgggctggaggaagaatacgttgtttc	Protospacer
***************************************

165. spacer 1.137|57782|39|NC_010480|CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 0, identity: 1.0 

cagccaaatcaatgggctggaggaagaatacgttgtttc	CRISPR spacer
cagccaaatcaatgggctggaggaagaatacgttgtttc	Protospacer
***************************************

166. spacer 1.38|57401|41|NC_010480|CRISPRCasFinder,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 1, identity: 0.976 

-ctacctcaacttttgtagacggcgacggaaaacgacctgtt	CRISPR spacer
cctacctcaac-tttgtagacggcgacggaaaacgacctgtt	Protospacer
 ********** ******************************

167. spacer 1.46|58038|40|NC_010480|CRISPRCasFinder,CRT,PILER-CR matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 1, identity: 0.975 

ctacctcaac-tttgtagacggcgacggaaaacgacctgtt	CRISPR spacer
-tacctcaacttttgtagacggcgacggaaaacgacctgtt	Protospacer
 ********* ******************************

168. spacer 1.132|57406|41|NC_010480|CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 5, identity: 0.878 

tcaacttttgtagacggcgacggaaaacgacctgttgtttc	CRISPR spacer
ctcaactttgtagacggcgacggaaaacgacctgttgtttc	Protospacer
.. * .***********************************

169. spacer 1.138|57857|67|NC_010480|CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 7, identity: 0.896 

acgcgctggcgctcgacgcggcgccgtcgatctcgctgttctggctcgccacgcgccccg	CRISPR spacer
acgcgctggcgctcgacgcggcgccgtcgatctcgctgttctggctcgccacgcgccccg	Protospacer
************************************************************

170. spacer 1.138|57857|67|NC_010480|CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 7, identity: 0.896 

acgcgctggcgctcgacgcggcgccgtcgatctcgctgttctggctcgccacgcgccccg	CRISPR spacer
acgcgctggcgctcgacgcggcgccgtcgatctcgctgttctggctcgccacgcgccccg	Protospacer
************************************************************

171. spacer 1.36|57215|72|NC_010480|CRISPRCasFinder,CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 12, identity: 0.833 

cgagcacgcgctggcgctcgacgcggcgccgtcgatctcgctgttctggctcgccacgcg	CRISPR spacer
cgagcacgcgctggcgctcgacgcggcgccgtcgatctcgctgttctggctcgccacgcg	Protospacer
************************************************************

172. spacer 1.36|57215|72|NC_010480|CRISPRCasFinder,CRT matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 12, identity: 0.833 

cgagcacgcgctggcgctcgacgcggcgccgtcgatctcgctgttctggctcgccacgcg	CRISPR spacer
cgagcacgcgctggcgctcgacgcggcgccgtcgatctcgctgttctggctcgccacgcg	Protospacer
************************************************************

173. spacer 1.44|57852|72|NC_010480|CRISPRCasFinder matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 12, identity: 0.833 

cgagcacgcgctggcgctcgacgcggcgccgtcgatctcgctgttctggctcgccacgcg	CRISPR spacer
cgagcacgcgctggcgctcgacgcggcgccgtcgatctcgctgttctggctcgccacgcg	Protospacer
************************************************************

174. spacer 1.44|57852|72|NC_010480|CRISPRCasFinder matches to NC_010480 (Synechococcus sp. PCC 7002 plasmid pAQ6, complete sequence) position: , mismatch: 12, identity: 0.833 

cgagcacgcgctggcgctcgacgcggcgccgtcgatctcgctgttctggctcgccacgcg	CRISPR spacer
cgagcacgcgctggcgctcgacgcggcgccgtcgatctcgctgttctggctcgccacgcg	Protospacer
************************************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_010475
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_010475_1 1864677-1865652 Unclear I-A,I-B,II-B
13 spacers
cas2,cas1,cas5,cas7,cas8b3,cas3,cas6,WYL

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_010475_1 1.5|1865002|35|NC_010475|CRISPRCasFinder,CRT 1865002-1865036 35 NZ_CP016485 Synechococcus sp. PCC 8807 plasmid unnamed2, complete sequence 3950-3984 1 0.971
NC_010475_1 1.18|1865003|35|NC_010475|PILER-CR 1865003-1865037 35 NZ_CP016485 Synechococcus sp. PCC 8807 plasmid unnamed2, complete sequence 3950-3984 1 0.971

1. spacer 1.5|1865002|35|NC_010475|CRISPRCasFinder,CRT matches to NZ_CP016485 (Synechococcus sp. PCC 8807 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.971 

taatgggcaagctcgtgggtttcttcttgccagga	CRISPR spacer
taatgggcaagctcatgggtttcttcttgccagga	Protospacer
**************.********************

2. spacer 1.18|1865003|35|NC_010475|PILER-CR matches to NZ_CP016485 (Synechococcus sp. PCC 8807 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.971 

taatgggcaagctcgtgggtttcttcttgccagga	CRISPR spacer
taatgggcaagctcatgggtttcttcttgccagga	Protospacer
**************.********************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NC_010477
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 11073 8 Acinetobacter_phage(25.0%) NA NA
DBSCAN-SWA_2 15263 : 15941 1 uncultured_Caudovirales_phage(100.0%) NA NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NC_010478
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_010478_1 12085-15035 TypeI-D NA
40 spacers
cas2,cas1,cas4,cas6,csc1gr5,csc2gr7,cas10d,cas3,WYL

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_010478_1 1.1|12123|36|NC_010478|PILER-CR 12123-12158 36 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 12122-12157 0 1.0
NC_010478_1 1.2|12197|34|NC_010478|PILER-CR 12197-12230 34 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 12195-12228 0 1.0
NC_010478_1 1.3|12269|34|NC_010478|PILER-CR 12269-12302 34 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 12266-12299 0 1.0
NC_010478_1 1.4|12341|42|NC_010478|PILER-CR 12341-12382 42 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 12337-12378 0 1.0
NC_010478_1 1.5|12421|36|NC_010478|PILER-CR 12421-12456 36 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 12416-12451 0 1.0
NC_010478_1 1.6|12495|35|NC_010478|PILER-CR 12495-12529 35 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 12489-12523 0 1.0
NC_010478_1 1.7|12568|38|NC_010478|PILER-CR 12568-12605 38 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 12561-12598 0 1.0
NC_010478_1 1.8|12644|36|NC_010478|PILER-CR 12644-12679 36 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 12636-12671 0 1.0
NC_010478_1 1.9|12718|36|NC_010478|PILER-CR 12718-12753 36 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 12709-12744 0 1.0
NC_010478_1 1.10|12792|35|NC_010478|PILER-CR 12792-12826 35 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 12782-12816 0 1.0
NC_010478_1 1.11|12865|37|NC_010478|PILER-CR 12865-12901 37 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 12854-12890 0 1.0
NC_010478_1 1.12|12940|34|NC_010478|PILER-CR 12940-12973 34 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 12928-12961 0 1.0
NC_010478_1 1.13|13012|37|NC_010478|PILER-CR 13012-13048 37 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 12999-13035 0 1.0
NC_010478_1 1.14|13087|40|NC_010478|PILER-CR 13087-13126 40 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 13073-13112 0 1.0
NC_010478_1 1.15|13165|37|NC_010478|PILER-CR 13165-13201 37 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 13150-13186 0 1.0
NC_010478_1 1.16|13240|37|NC_010478|PILER-CR 13240-13276 37 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 13224-13260 0 1.0
NC_010478_1 1.17|13315|37|NC_010478|PILER-CR 13315-13351 37 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 13298-13334 0 1.0
NC_010478_1 1.18|13390|37|NC_010478|PILER-CR 13390-13426 37 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 13372-13408 0 1.0
NC_010478_1 1.19|13465|39|NC_010478|PILER-CR 13465-13503 39 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 13446-13484 0 1.0
NC_010478_1 1.20|13542|36|NC_010478|PILER-CR 13542-13577 36 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 13523-13558 0 1.0
NC_010478_1 1.21|13616|37|NC_010478|PILER-CR 13616-13652 37 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 13596-13632 0 1.0
NC_010478_1 1.22|13691|33|NC_010478|PILER-CR 13691-13723 33 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 13670-13702 0 1.0
NC_010478_1 1.23|13762|34|NC_010478|PILER-CR 13762-13795 34 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 13740-13773 0 1.0
NC_010478_1 1.24|13834|34|NC_010478|PILER-CR 13834-13867 34 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 13811-13844 0 1.0
NC_010478_1 1.25|13906|34|NC_010478|PILER-CR 13906-13939 34 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 13882-13915 0 1.0
NC_010478_1 1.26|13978|34|NC_010478|PILER-CR 13978-14011 34 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 13953-13986 0 1.0
NC_010478_1 1.27|14050|33|NC_010478|PILER-CR 14050-14082 33 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 14024-14056 0 1.0
NC_010478_1 1.28|14121|36|NC_010478|PILER-CR 14121-14156 36 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 14094-14129 0 1.0
NC_010478_1 1.29|14195|35|NC_010478|PILER-CR 14195-14229 35 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 14167-14201 0 1.0
NC_010478_1 1.30|14268|38|NC_010478|PILER-CR 14268-14305 38 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 14238-14275 0 1.0
NC_010478_1 1.31|14344|38|NC_010478|PILER-CR 14344-14381 38 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 14313-14350 0 1.0
NC_010478_1 1.32|14420|34|NC_010478|PILER-CR 14420-14453 34 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 14388-14421 0 1.0
NC_010478_1 1.33|14492|35|NC_010478|PILER-CR 14492-14526 35 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 14459-14493 0 1.0
NC_010478_1 1.34|14565|35|NC_010478|PILER-CR 14565-14599 35 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 14531-14565 0 1.0
NC_010478_1 1.35|14638|36|NC_010478|PILER-CR 14638-14673 36 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 14603-14638 0 1.0
NC_010478_1 1.36|14712|36|NC_010478|PILER-CR 14712-14747 36 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 14676-14711 0 1.0
NC_010478_1 1.37|14786|34|NC_010478|PILER-CR 14786-14819 34 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 14749-14782 0 1.0
NC_010478_1 1.38|14858|35|NC_010478|PILER-CR 14858-14892 35 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 14820-14854 0 1.0
NC_010478_1 1.39|14931|34|NC_010478|PILER-CR 14931-14964 34 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 14892-14925 0 1.0
NC_010478_1 1.40|15003|36|NC_010478|PILER-CR 15003-15038 36 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 14963-14998 0 1.0
NC_010478_1 1.41|12122|36|NC_010478|CRISPRCasFinder,CRT 12122-12157 36 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 12122-12157 0 1.0
NC_010478_1 1.42|12195|34|NC_010478|CRISPRCasFinder,CRT 12195-12228 34 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 12195-12228 0 1.0
NC_010478_1 1.43|12266|34|NC_010478|CRISPRCasFinder,CRT 12266-12299 34 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 12266-12299 0 1.0
NC_010478_1 1.44|12337|42|NC_010478|CRISPRCasFinder,CRT 12337-12378 42 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 12337-12378 0 1.0
NC_010478_1 1.45|12416|36|NC_010478|CRISPRCasFinder,CRT 12416-12451 36 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 12416-12451 0 1.0
NC_010478_1 1.46|12489|35|NC_010478|CRISPRCasFinder,CRT 12489-12523 35 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 12489-12523 0 1.0
NC_010478_1 1.47|12561|38|NC_010478|CRISPRCasFinder,CRT 12561-12598 38 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 12561-12598 0 1.0
NC_010478_1 1.48|12636|36|NC_010478|CRISPRCasFinder,CRT 12636-12671 36 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 12636-12671 0 1.0
NC_010478_1 1.49|12709|36|NC_010478|CRISPRCasFinder,CRT 12709-12744 36 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 12709-12744 0 1.0
NC_010478_1 1.50|12782|35|NC_010478|CRISPRCasFinder,CRT 12782-12816 35 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 12782-12816 0 1.0
NC_010478_1 1.51|12854|37|NC_010478|CRISPRCasFinder,CRT 12854-12890 37 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 12854-12890 0 1.0
NC_010478_1 1.52|12928|34|NC_010478|CRISPRCasFinder,CRT 12928-12961 34 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 12928-12961 0 1.0
NC_010478_1 1.53|12999|37|NC_010478|CRISPRCasFinder,CRT 12999-13035 37 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 12999-13035 0 1.0
NC_010478_1 1.54|13073|40|NC_010478|CRISPRCasFinder,CRT 13073-13112 40 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 13073-13112 0 1.0
NC_010478_1 1.55|13150|37|NC_010478|CRISPRCasFinder,CRT 13150-13186 37 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 13150-13186 0 1.0
NC_010478_1 1.56|13224|37|NC_010478|CRISPRCasFinder,CRT 13224-13260 37 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 13224-13260 0 1.0
NC_010478_1 1.57|13298|37|NC_010478|CRISPRCasFinder,CRT 13298-13334 37 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 13298-13334 0 1.0
NC_010478_1 1.58|13372|37|NC_010478|CRISPRCasFinder,CRT 13372-13408 37 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 13372-13408 0 1.0
NC_010478_1 1.59|13446|40|NC_010478|CRISPRCasFinder,CRT 13446-13485 40 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 13446-13485 0 1.0
NC_010478_1 1.60|13523|36|NC_010478|CRISPRCasFinder,CRT 13523-13558 36 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 13523-13558 0 1.0
NC_010478_1 1.61|13596|37|NC_010478|CRISPRCasFinder,CRT 13596-13632 37 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 13596-13632 0 1.0
NC_010478_1 1.62|13670|33|NC_010478|CRISPRCasFinder,CRT 13670-13702 33 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 13670-13702 0 1.0
NC_010478_1 1.63|13740|34|NC_010478|CRISPRCasFinder,CRT 13740-13773 34 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 13740-13773 0 1.0
NC_010478_1 1.64|13811|34|NC_010478|CRISPRCasFinder,CRT 13811-13844 34 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 13811-13844 0 1.0
NC_010478_1 1.65|13882|34|NC_010478|CRISPRCasFinder,CRT 13882-13915 34 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 13882-13915 0 1.0
NC_010478_1 1.66|13953|34|NC_010478|CRISPRCasFinder,CRT 13953-13986 34 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 13953-13986 0 1.0
NC_010478_1 1.67|14024|33|NC_010478|CRISPRCasFinder,CRT 14024-14056 33 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 14024-14056 0 1.0
NC_010478_1 1.68|14094|36|NC_010478|CRISPRCasFinder,CRT 14094-14129 36 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 14094-14129 0 1.0
NC_010478_1 1.69|14167|34|NC_010478|CRISPRCasFinder,CRT 14167-14200 34 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 14167-14200 0 1.0
NC_010478_1 1.70|14238|38|NC_010478|CRISPRCasFinder,CRT 14238-14275 38 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 14238-14275 0 1.0
NC_010478_1 1.71|14313|38|NC_010478|CRISPRCasFinder,CRT 14313-14350 38 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 14313-14350 0 1.0
NC_010478_1 1.72|14388|34|NC_010478|CRISPRCasFinder,CRT 14388-14421 34 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 14388-14421 0 1.0
NC_010478_1 1.73|14459|35|NC_010478|CRISPRCasFinder,CRT 14459-14493 35 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 14459-14493 0 1.0
NC_010478_1 1.74|14531|35|NC_010478|CRISPRCasFinder,CRT 14531-14565 35 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 14531-14565 0 1.0
NC_010478_1 1.75|14603|36|NC_010478|CRISPRCasFinder,CRT 14603-14638 36 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 14603-14638 0 1.0
NC_010478_1 1.76|14676|36|NC_010478|CRISPRCasFinder,CRT 14676-14711 36 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 14676-14711 0 1.0
NC_010478_1 1.77|14749|34|NC_010478|CRISPRCasFinder,CRT 14749-14782 34 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 14749-14782 0 1.0
NC_010478_1 1.78|14820|35|NC_010478|CRISPRCasFinder,CRT 14820-14854 35 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 14820-14854 0 1.0
NC_010478_1 1.79|14892|34|NC_010478|CRISPRCasFinder,CRT 14892-14925 34 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 14892-14925 0 1.0
NC_010478_1 1.80|14963|36|NC_010478|CRISPRCasFinder,CRT 14963-14998 36 NC_010478 Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence 14963-14998 0 1.0
NC_010478_1 1.32|14420|34|NC_010478|PILER-CR 14420-14453 34 NZ_CP024793 Nostoc flagelliforme CCNUN1 plasmid pNFSY08, complete sequence 404444-404477 5 0.853
NC_010478_1 1.72|14388|34|NC_010478|CRISPRCasFinder,CRT 14388-14421 34 NZ_CP024793 Nostoc flagelliforme CCNUN1 plasmid pNFSY08, complete sequence 404444-404477 5 0.853
NC_010478_1 1.37|14786|34|NC_010478|PILER-CR 14786-14819 34 NZ_CP044084 Pseudomonas luteola strain FDAARGOS_637 plasmid unnamed1, complete sequence 322878-322911 6 0.824
NC_010478_1 1.77|14749|34|NC_010478|CRISPRCasFinder,CRT 14749-14782 34 NZ_CP044084 Pseudomonas luteola strain FDAARGOS_637 plasmid unnamed1, complete sequence 322878-322911 6 0.824
NC_010478_1 1.37|14786|34|NC_010478|PILER-CR 14786-14819 34 NZ_KY362369 Pseudomonas syringae pv. syringae strain 6-9 plasmid pPs6-9, complete sequence 51652-51685 8 0.765
NC_010478_1 1.37|14786|34|NC_010478|PILER-CR 14786-14819 34 NZ_KY362372 Pseudomonas syringae pv. syringae strain UMAF0170 plasmid pPs0170, complete sequence 54605-54638 8 0.765
NC_010478_1 1.37|14786|34|NC_010478|PILER-CR 14786-14819 34 NZ_KY362368 Pseudomonas syringae pv. syringae strain UMAF0081 plasmid pPs0081, complete sequence 51652-51685 8 0.765
NC_010478_1 1.37|14786|34|NC_010478|PILER-CR 14786-14819 34 NZ_CP024713 Pseudomonas syringae pv. actinidiae strain MAFF212063 plasmid pMAFF212063-A, complete sequence 58362-58395 8 0.765
NC_010478_1 1.37|14786|34|NC_010478|PILER-CR 14786-14819 34 CP050261 Pseudomonas coronafaciens strain X-1 plasmid unnamed1 88572-88605 8 0.765
NC_010478_1 1.37|14786|34|NC_010478|PILER-CR 14786-14819 34 NZ_CP042805 Pseudomonas amygdali pv. tabaci str. ATCC 11528 plasmid pTab1, complete sequence 58208-58241 8 0.765
NC_010478_1 1.37|14786|34|NC_010478|PILER-CR 14786-14819 34 CP046442 Pseudomonas coronafaciens pv. coronafaciens strain B19001 plasmid unnamed1, complete sequence 102595-102628 8 0.765
NC_010478_1 1.37|14786|34|NC_010478|PILER-CR 14786-14819 34 NZ_CP046036 Pseudomonas coronafaciens pv. oryzae str. 1_6 plasmid pPor1_6, complete sequence 41603-41636 8 0.765
NC_010478_1 1.37|14786|34|NC_010478|PILER-CR 14786-14819 34 NC_019328 Pseudomonas syringae plasmid pB76-81, complete sequence 73387-73420 8 0.765
NC_010478_1 1.37|14786|34|NC_010478|PILER-CR 14786-14819 34 NC_005918 Pseudomonas syringae pv. maculicola strain ES4326 plasmid pPMA4326A, complete sequence 35958-35991 8 0.765
NC_010478_1 1.37|14786|34|NC_010478|PILER-CR 14786-14819 34 NZ_CP047262 Pseudomonas syringae pv. maculicola str. ES4326 plasmid pPma4326A, complete sequence 35807-35840 8 0.765
NC_010478_1 1.77|14749|34|NC_010478|CRISPRCasFinder,CRT 14749-14782 34 NZ_KY362369 Pseudomonas syringae pv. syringae strain 6-9 plasmid pPs6-9, complete sequence 51652-51685 8 0.765
NC_010478_1 1.77|14749|34|NC_010478|CRISPRCasFinder,CRT 14749-14782 34 NZ_KY362372 Pseudomonas syringae pv. syringae strain UMAF0170 plasmid pPs0170, complete sequence 54605-54638 8 0.765
NC_010478_1 1.77|14749|34|NC_010478|CRISPRCasFinder,CRT 14749-14782 34 NZ_KY362368 Pseudomonas syringae pv. syringae strain UMAF0081 plasmid pPs0081, complete sequence 51652-51685 8 0.765
NC_010478_1 1.77|14749|34|NC_010478|CRISPRCasFinder,CRT 14749-14782 34 NZ_CP024713 Pseudomonas syringae pv. actinidiae strain MAFF212063 plasmid pMAFF212063-A, complete sequence 58362-58395 8 0.765
NC_010478_1 1.77|14749|34|NC_010478|CRISPRCasFinder,CRT 14749-14782 34 CP050261 Pseudomonas coronafaciens strain X-1 plasmid unnamed1 88572-88605 8 0.765
NC_010478_1 1.77|14749|34|NC_010478|CRISPRCasFinder,CRT 14749-14782 34 NZ_CP042805 Pseudomonas amygdali pv. tabaci str. ATCC 11528 plasmid pTab1, complete sequence 58208-58241 8 0.765
NC_010478_1 1.77|14749|34|NC_010478|CRISPRCasFinder,CRT 14749-14782 34 CP046442 Pseudomonas coronafaciens pv. coronafaciens strain B19001 plasmid unnamed1, complete sequence 102595-102628 8 0.765
NC_010478_1 1.77|14749|34|NC_010478|CRISPRCasFinder,CRT 14749-14782 34 NZ_CP046036 Pseudomonas coronafaciens pv. oryzae str. 1_6 plasmid pPor1_6, complete sequence 41603-41636 8 0.765
NC_010478_1 1.77|14749|34|NC_010478|CRISPRCasFinder,CRT 14749-14782 34 NC_019328 Pseudomonas syringae plasmid pB76-81, complete sequence 73387-73420 8 0.765
NC_010478_1 1.77|14749|34|NC_010478|CRISPRCasFinder,CRT 14749-14782 34 NC_005918 Pseudomonas syringae pv. maculicola strain ES4326 plasmid pPMA4326A, complete sequence 35958-35991 8 0.765
NC_010478_1 1.77|14749|34|NC_010478|CRISPRCasFinder,CRT 14749-14782 34 NZ_CP047262 Pseudomonas syringae pv. maculicola str. ES4326 plasmid pPma4326A, complete sequence 35807-35840 8 0.765
NC_010478_1 1.23|13762|34|NC_010478|PILER-CR 13762-13795 34 NZ_CP011665 Streptomyces sp. Mg1 plasmid pSMg1-1, complete sequence 336206-336239 9 0.735
NC_010478_1 1.32|14420|34|NC_010478|PILER-CR 14420-14453 34 JX976549 Acinetobacter phage IME-AB2, complete genome 24670-24703 9 0.735
NC_010478_1 1.32|14420|34|NC_010478|PILER-CR 14420-14453 34 KP861229 Acinetobacter phage YMC11/12/R2315, complete genome 31872-31905 9 0.735
NC_010478_1 1.32|14420|34|NC_010478|PILER-CR 14420-14453 34 KJ817802 Acinetobacter phage YMC-13-01-C62, complete genome 8694-8727 9 0.735
NC_010478_1 1.32|14420|34|NC_010478|PILER-CR 14420-14453 34 NZ_CP050417 Acinetobacter baumannii strain PM193665 plasmid pPM193665_2, complete sequence 27769-27802 9 0.735
NC_010478_1 1.32|14420|34|NC_010478|PILER-CR 14420-14453 34 MN516422 Acinetobacter phage Bphi-R1888, complete genome 23803-23836 9 0.735
NC_010478_1 1.32|14420|34|NC_010478|PILER-CR 14420-14453 34 KP861231 Acinetobacter phage YMC11/12/R1215, complete genome 24704-24737 9 0.735
NC_010478_1 1.32|14420|34|NC_010478|PILER-CR 14420-14453 34 MN516421 Acinetobacter phage Bphi-R2919, complete genome 24732-24765 9 0.735
NC_010478_1 1.32|14420|34|NC_010478|PILER-CR 14420-14453 34 MT361972 Acinetobacter phage Ab11510-phi, complete genome 48271-48304 9 0.735
NC_010478_1 1.32|14420|34|NC_010478|PILER-CR 14420-14453 34 MT349887 Acinetobacter phage 5W, complete genome 35274-35307 9 0.735
NC_010478_1 1.37|14786|34|NC_010478|PILER-CR 14786-14819 34 NZ_CP045801 Pseudomonas syringae USA011 plasmid pUSA011-2, complete sequence 30878-30911 9 0.735
NC_010478_1 1.37|14786|34|NC_010478|PILER-CR 14786-14819 34 NZ_KY362371 Pseudomonas syringae pv. syringae strain UMAF1029 plasmid pPs1029, complete sequence 53063-53096 9 0.735
NC_010478_1 1.37|14786|34|NC_010478|PILER-CR 14786-14819 34 NZ_KY362370 Pseudomonas syringae pv. syringae strain UMAF0158 plasmid pPs0158, complete sequence 53057-53090 9 0.735
NC_010478_1 1.37|14786|34|NC_010478|PILER-CR 14786-14819 34 NZ_CP005971 Pseudomonas syringae UMAF0158 plasmid unnamed, complete sequence 17249-17282 9 0.735
NC_010478_1 1.37|14786|34|NC_010478|PILER-CR 14786-14819 34 NZ_CP041756 Pseudomonas sp. KBS0707 plasmid unnamed2, complete sequence 32089-32122 9 0.735
NC_010478_1 1.63|13740|34|NC_010478|CRISPRCasFinder,CRT 13740-13773 34 NZ_CP011665 Streptomyces sp. Mg1 plasmid pSMg1-1, complete sequence 336206-336239 9 0.735
NC_010478_1 1.72|14388|34|NC_010478|CRISPRCasFinder,CRT 14388-14421 34 JX976549 Acinetobacter phage IME-AB2, complete genome 24670-24703 9 0.735
NC_010478_1 1.72|14388|34|NC_010478|CRISPRCasFinder,CRT 14388-14421 34 KP861229 Acinetobacter phage YMC11/12/R2315, complete genome 31872-31905 9 0.735
NC_010478_1 1.72|14388|34|NC_010478|CRISPRCasFinder,CRT 14388-14421 34 KJ817802 Acinetobacter phage YMC-13-01-C62, complete genome 8694-8727 9 0.735
NC_010478_1 1.72|14388|34|NC_010478|CRISPRCasFinder,CRT 14388-14421 34 NZ_CP050417 Acinetobacter baumannii strain PM193665 plasmid pPM193665_2, complete sequence 27769-27802 9 0.735
NC_010478_1 1.72|14388|34|NC_010478|CRISPRCasFinder,CRT 14388-14421 34 MN516422 Acinetobacter phage Bphi-R1888, complete genome 23803-23836 9 0.735
NC_010478_1 1.72|14388|34|NC_010478|CRISPRCasFinder,CRT 14388-14421 34 KP861231 Acinetobacter phage YMC11/12/R1215, complete genome 24704-24737 9 0.735
NC_010478_1 1.72|14388|34|NC_010478|CRISPRCasFinder,CRT 14388-14421 34 MN516421 Acinetobacter phage Bphi-R2919, complete genome 24732-24765 9 0.735
NC_010478_1 1.72|14388|34|NC_010478|CRISPRCasFinder,CRT 14388-14421 34 MT361972 Acinetobacter phage Ab11510-phi, complete genome 48271-48304 9 0.735
NC_010478_1 1.72|14388|34|NC_010478|CRISPRCasFinder,CRT 14388-14421 34 MT349887 Acinetobacter phage 5W, complete genome 35274-35307 9 0.735
NC_010478_1 1.77|14749|34|NC_010478|CRISPRCasFinder,CRT 14749-14782 34 NZ_CP045801 Pseudomonas syringae USA011 plasmid pUSA011-2, complete sequence 30878-30911 9 0.735
NC_010478_1 1.77|14749|34|NC_010478|CRISPRCasFinder,CRT 14749-14782 34 NZ_KY362371 Pseudomonas syringae pv. syringae strain UMAF1029 plasmid pPs1029, complete sequence 53063-53096 9 0.735
NC_010478_1 1.77|14749|34|NC_010478|CRISPRCasFinder,CRT 14749-14782 34 NZ_KY362370 Pseudomonas syringae pv. syringae strain UMAF0158 plasmid pPs0158, complete sequence 53057-53090 9 0.735
NC_010478_1 1.77|14749|34|NC_010478|CRISPRCasFinder,CRT 14749-14782 34 NZ_CP005971 Pseudomonas syringae UMAF0158 plasmid unnamed, complete sequence 17249-17282 9 0.735
NC_010478_1 1.77|14749|34|NC_010478|CRISPRCasFinder,CRT 14749-14782 34 NZ_CP041756 Pseudomonas sp. KBS0707 plasmid unnamed2, complete sequence 32089-32122 9 0.735
NC_010478_1 1.24|13834|34|NC_010478|PILER-CR 13834-13867 34 NC_008760 Polaromonas naphthalenivorans CJ2 plasmid pPNAP04, complete sequence 55570-55603 10 0.706
NC_010478_1 1.27|14050|33|NC_010478|PILER-CR 14050-14082 33 NZ_CP032703 Pantoea dispersa strain DSM 32899 plasmid unnamed1, complete sequence 453375-453407 10 0.697
NC_010478_1 1.40|15003|36|NC_010478|PILER-CR 15003-15038 36 LR134122 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2 116782-116817 10 0.722
NC_010478_1 1.64|13811|34|NC_010478|CRISPRCasFinder,CRT 13811-13844 34 NC_008760 Polaromonas naphthalenivorans CJ2 plasmid pPNAP04, complete sequence 55570-55603 10 0.706
NC_010478_1 1.67|14024|33|NC_010478|CRISPRCasFinder,CRT 14024-14056 33 NZ_CP032703 Pantoea dispersa strain DSM 32899 plasmid unnamed1, complete sequence 453375-453407 10 0.697
NC_010478_1 1.80|14963|36|NC_010478|CRISPRCasFinder,CRT 14963-14998 36 LR134122 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2 116782-116817 10 0.722

1. spacer 1.1|12123|36|NC_010478|PILER-CR matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

cgccactgaagcaaacgtgagcaacgcggaagccaa	CRISPR spacer
cgccactgaagcaaacgtgagcaacgcggaagccaa	Protospacer
************************************

2. spacer 1.2|12197|34|NC_010478|PILER-CR matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

cagcccacccaagatatccccgtccgtgggtctt	CRISPR spacer
cagcccacccaagatatccccgtccgtgggtctt	Protospacer
**********************************

3. spacer 1.3|12269|34|NC_010478|PILER-CR matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

tctgccacaaaaatcaaagcccccattttttctt	CRISPR spacer
tctgccacaaaaatcaaagcccccattttttctt	Protospacer
**********************************

4. spacer 1.4|12341|42|NC_010478|PILER-CR matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

tcggcgaggtcaccaaggtcggctcctgccgccgtgattgaa	CRISPR spacer
tcggcgaggtcaccaaggtcggctcctgccgccgtgattgaa	Protospacer
******************************************

5. spacer 1.5|12421|36|NC_010478|PILER-CR matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

gcgggaacaactttgatgcgatccgaagtaccaatt	CRISPR spacer
gcgggaacaactttgatgcgatccgaagtaccaatt	Protospacer
************************************

6. spacer 1.6|12495|35|NC_010478|PILER-CR matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

tttgcctttttgttaatctccgccatcattgcagc	CRISPR spacer
tttgcctttttgttaatctccgccatcattgcagc	Protospacer
***********************************

7. spacer 1.7|12568|38|NC_010478|PILER-CR matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

ttttttattcatagtcctaatagaaaaggcgatgccct	CRISPR spacer
ttttttattcatagtcctaatagaaaaggcgatgccct	Protospacer
**************************************

8. spacer 1.8|12644|36|NC_010478|PILER-CR matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

tcgccatgggccaaattagagcgccaaggggagaaa	CRISPR spacer
tcgccatgggccaaattagagcgccaaggggagaaa	Protospacer
************************************

9. spacer 1.9|12718|36|NC_010478|PILER-CR matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

ccgtttcgattaatttcagagggtgcaatttgagtg	CRISPR spacer
ccgtttcgattaatttcagagggtgcaatttgagtg	Protospacer
************************************

10. spacer 1.10|12792|35|NC_010478|PILER-CR matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

aacgacaaggcttacaagggggtaattcgtgattt	CRISPR spacer
aacgacaaggcttacaagggggtaattcgtgattt	Protospacer
***********************************

11. spacer 1.11|12865|37|NC_010478|PILER-CR matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

taggcaggggagtgaaatggtttcatgttgggctcat	CRISPR spacer
taggcaggggagtgaaatggtttcatgttgggctcat	Protospacer
*************************************

12. spacer 1.12|12940|34|NC_010478|PILER-CR matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

cagtaagatgaaggaggtggtgcatatcacttgc	CRISPR spacer
cagtaagatgaaggaggtggtgcatatcacttgc	Protospacer
**********************************

13. spacer 1.13|13012|37|NC_010478|PILER-CR matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

ctagatttgcttatagagttgactgttatcgggactt	CRISPR spacer
ctagatttgcttatagagttgactgttatcgggactt	Protospacer
*************************************

14. spacer 1.14|13087|40|NC_010478|PILER-CR matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

atgatggcgttgccagcgttctcggattggagaatttaac	CRISPR spacer
atgatggcgttgccagcgttctcggattggagaatttaac	Protospacer
****************************************

15. spacer 1.15|13165|37|NC_010478|PILER-CR matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

ccctgagaagtttggctgttttgctgactgcgatctg	CRISPR spacer
ccctgagaagtttggctgttttgctgactgcgatctg	Protospacer
*************************************

16. spacer 1.16|13240|37|NC_010478|PILER-CR matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

catcgaggcagtagagcaaatcgcaggccacctcata	CRISPR spacer
catcgaggcagtagagcaaatcgcaggccacctcata	Protospacer
*************************************

17. spacer 1.17|13315|37|NC_010478|PILER-CR matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

tcattggggtctgcattggggccatcgctatcgtcct	CRISPR spacer
tcattggggtctgcattggggccatcgctatcgtcct	Protospacer
*************************************

18. spacer 1.18|13390|37|NC_010478|PILER-CR matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

tgggacgctccgtaaggtttggagaatagggtctagt	CRISPR spacer
tgggacgctccgtaaggtttggagaatagggtctagt	Protospacer
*************************************

19. spacer 1.19|13465|39|NC_010478|PILER-CR matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

cacttcgtcgctgattgtccaccgacttgcgagggctgc	CRISPR spacer
cacttcgtcgctgattgtccaccgacttgcgagggctgc	Protospacer
***************************************

20. spacer 1.20|13542|36|NC_010478|PILER-CR matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

atgcccttctctcatcgatgtttgattaaatcatct	CRISPR spacer
atgcccttctctcatcgatgtttgattaaatcatct	Protospacer
************************************

21. spacer 1.21|13616|37|NC_010478|PILER-CR matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

aagcattttccctggtcgccgctggtagcttgtggca	CRISPR spacer
aagcattttccctggtcgccgctggtagcttgtggca	Protospacer
*************************************

22. spacer 1.22|13691|33|NC_010478|PILER-CR matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

gcgtaactgtcctaattgtttctcaaggcttaa	CRISPR spacer
gcgtaactgtcctaattgtttctcaaggcttaa	Protospacer
*********************************

23. spacer 1.23|13762|34|NC_010478|PILER-CR matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

tggtctccgtctcgcaaacgtagtcgccgctaat	CRISPR spacer
tggtctccgtctcgcaaacgtagtcgccgctaat	Protospacer
**********************************

24. spacer 1.24|13834|34|NC_010478|PILER-CR matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

ccctagctttcgccaactgctgcggcaaatcttc	CRISPR spacer
ccctagctttcgccaactgctgcggcaaatcttc	Protospacer
**********************************

25. spacer 1.25|13906|34|NC_010478|PILER-CR matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

cagtgcgattcagcggtgggataaagaaaaattg	CRISPR spacer
cagtgcgattcagcggtgggataaagaaaaattg	Protospacer
**********************************

26. spacer 1.26|13978|34|NC_010478|PILER-CR matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

ccgattcgcaagtttcatcatcaatccccgtgat	CRISPR spacer
ccgattcgcaagtttcatcatcaatccccgtgat	Protospacer
**********************************

27. spacer 1.27|14050|33|NC_010478|PILER-CR matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

cggaacgtcgcgccgaaaccatcgccaggacgg	CRISPR spacer
cggaacgtcgcgccgaaaccatcgccaggacgg	Protospacer
*********************************

28. spacer 1.28|14121|36|NC_010478|PILER-CR matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

tgattatgttcaagaaatcacaacgcaaaagaaaaa	CRISPR spacer
tgattatgttcaagaaatcacaacgcaaaagaaaaa	Protospacer
************************************

29. spacer 1.29|14195|35|NC_010478|PILER-CR matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

tcaagcgagatacccaccagaaagcctttgacctg	CRISPR spacer
tcaagcgagatacccaccagaaagcctttgacctg	Protospacer
***********************************

30. spacer 1.30|14268|38|NC_010478|PILER-CR matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

gcggcggctgatgtcgccaatgcggttatcgatggcca	CRISPR spacer
gcggcggctgatgtcgccaatgcggttatcgatggcca	Protospacer
**************************************

31. spacer 1.31|14344|38|NC_010478|PILER-CR matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

tcccaagggggacagggcggtgatcctcgatgttgcgt	CRISPR spacer
tcccaagggggacagggcggtgatcctcgatgttgcgt	Protospacer
**************************************

32. spacer 1.32|14420|34|NC_010478|PILER-CR matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

actcgtctatatatacagagattactacagagat	CRISPR spacer
actcgtctatatatacagagattactacagagat	Protospacer
**********************************

33. spacer 1.33|14492|35|NC_010478|PILER-CR matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

cgggaaagtagcctgttttgtggagaattgcaggc	CRISPR spacer
cgggaaagtagcctgttttgtggagaattgcaggc	Protospacer
***********************************

34. spacer 1.34|14565|35|NC_010478|PILER-CR matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

tccttccaagtcgcaagccaaacttgcttatcctt	CRISPR spacer
tccttccaagtcgcaagccaaacttgcttatcctt	Protospacer
***********************************

35. spacer 1.35|14638|36|NC_010478|PILER-CR matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

cacgcagcacaatgatgtgaccactacgggtgaatt	CRISPR spacer
cacgcagcacaatgatgtgaccactacgggtgaatt	Protospacer
************************************

36. spacer 1.36|14712|36|NC_010478|PILER-CR matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

gattggtttggtcggtcatggtctgccttgatggcg	CRISPR spacer
gattggtttggtcggtcatggtctgccttgatggcg	Protospacer
************************************

37. spacer 1.37|14786|34|NC_010478|PILER-CR matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

tcaatcgtagcgattcaggcccaggcggtagcaa	CRISPR spacer
tcaatcgtagcgattcaggcccaggcggtagcaa	Protospacer
**********************************

38. spacer 1.38|14858|35|NC_010478|PILER-CR matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

ttctgttccgcctcaatcgctgcaagggcatcctg	CRISPR spacer
ttctgttccgcctcaatcgctgcaagggcatcctg	Protospacer
***********************************

39. spacer 1.39|14931|34|NC_010478|PILER-CR matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

ccaacgcgatctatcacggttgcttcgataaaaa	CRISPR spacer
ccaacgcgatctatcacggttgcttcgataaaaa	Protospacer
**********************************

40. spacer 1.40|15003|36|NC_010478|PILER-CR matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

cctctttgagacgaaaaacagcgccaacgcctgggt	CRISPR spacer
cctctttgagacgaaaaacagcgccaacgcctgggt	Protospacer
************************************

41. spacer 1.41|12122|36|NC_010478|CRISPRCasFinder,CRT matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

cgccactgaagcaaacgtgagcaacgcggaagccaa	CRISPR spacer
cgccactgaagcaaacgtgagcaacgcggaagccaa	Protospacer
************************************

42. spacer 1.42|12195|34|NC_010478|CRISPRCasFinder,CRT matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

cagcccacccaagatatccccgtccgtgggtctt	CRISPR spacer
cagcccacccaagatatccccgtccgtgggtctt	Protospacer
**********************************

43. spacer 1.43|12266|34|NC_010478|CRISPRCasFinder,CRT matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

tctgccacaaaaatcaaagcccccattttttctt	CRISPR spacer
tctgccacaaaaatcaaagcccccattttttctt	Protospacer
**********************************

44. spacer 1.44|12337|42|NC_010478|CRISPRCasFinder,CRT matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

tcggcgaggtcaccaaggtcggctcctgccgccgtgattgaa	CRISPR spacer
tcggcgaggtcaccaaggtcggctcctgccgccgtgattgaa	Protospacer
******************************************

45. spacer 1.45|12416|36|NC_010478|CRISPRCasFinder,CRT matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

gcgggaacaactttgatgcgatccgaagtaccaatt	CRISPR spacer
gcgggaacaactttgatgcgatccgaagtaccaatt	Protospacer
************************************

46. spacer 1.46|12489|35|NC_010478|CRISPRCasFinder,CRT matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

tttgcctttttgttaatctccgccatcattgcagc	CRISPR spacer
tttgcctttttgttaatctccgccatcattgcagc	Protospacer
***********************************

47. spacer 1.47|12561|38|NC_010478|CRISPRCasFinder,CRT matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

ttttttattcatagtcctaatagaaaaggcgatgccct	CRISPR spacer
ttttttattcatagtcctaatagaaaaggcgatgccct	Protospacer
**************************************

48. spacer 1.48|12636|36|NC_010478|CRISPRCasFinder,CRT matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

tcgccatgggccaaattagagcgccaaggggagaaa	CRISPR spacer
tcgccatgggccaaattagagcgccaaggggagaaa	Protospacer
************************************

49. spacer 1.49|12709|36|NC_010478|CRISPRCasFinder,CRT matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

ccgtttcgattaatttcagagggtgcaatttgagtg	CRISPR spacer
ccgtttcgattaatttcagagggtgcaatttgagtg	Protospacer
************************************

50. spacer 1.50|12782|35|NC_010478|CRISPRCasFinder,CRT matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

aacgacaaggcttacaagggggtaattcgtgattt	CRISPR spacer
aacgacaaggcttacaagggggtaattcgtgattt	Protospacer
***********************************

51. spacer 1.51|12854|37|NC_010478|CRISPRCasFinder,CRT matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

taggcaggggagtgaaatggtttcatgttgggctcat	CRISPR spacer
taggcaggggagtgaaatggtttcatgttgggctcat	Protospacer
*************************************

52. spacer 1.52|12928|34|NC_010478|CRISPRCasFinder,CRT matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

cagtaagatgaaggaggtggtgcatatcacttgc	CRISPR spacer
cagtaagatgaaggaggtggtgcatatcacttgc	Protospacer
**********************************

53. spacer 1.53|12999|37|NC_010478|CRISPRCasFinder,CRT matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

ctagatttgcttatagagttgactgttatcgggactt	CRISPR spacer
ctagatttgcttatagagttgactgttatcgggactt	Protospacer
*************************************

54. spacer 1.54|13073|40|NC_010478|CRISPRCasFinder,CRT matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

atgatggcgttgccagcgttctcggattggagaatttaac	CRISPR spacer
atgatggcgttgccagcgttctcggattggagaatttaac	Protospacer
****************************************

55. spacer 1.55|13150|37|NC_010478|CRISPRCasFinder,CRT matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

ccctgagaagtttggctgttttgctgactgcgatctg	CRISPR spacer
ccctgagaagtttggctgttttgctgactgcgatctg	Protospacer
*************************************

56. spacer 1.56|13224|37|NC_010478|CRISPRCasFinder,CRT matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

catcgaggcagtagagcaaatcgcaggccacctcata	CRISPR spacer
catcgaggcagtagagcaaatcgcaggccacctcata	Protospacer
*************************************

57. spacer 1.57|13298|37|NC_010478|CRISPRCasFinder,CRT matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

tcattggggtctgcattggggccatcgctatcgtcct	CRISPR spacer
tcattggggtctgcattggggccatcgctatcgtcct	Protospacer
*************************************

58. spacer 1.58|13372|37|NC_010478|CRISPRCasFinder,CRT matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

tgggacgctccgtaaggtttggagaatagggtctagt	CRISPR spacer
tgggacgctccgtaaggtttggagaatagggtctagt	Protospacer
*************************************

59. spacer 1.59|13446|40|NC_010478|CRISPRCasFinder,CRT matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

cacttcgtcgctgattgtccaccgacttgcgagggctgcg	CRISPR spacer
cacttcgtcgctgattgtccaccgacttgcgagggctgcg	Protospacer
****************************************

60. spacer 1.60|13523|36|NC_010478|CRISPRCasFinder,CRT matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

atgcccttctctcatcgatgtttgattaaatcatct	CRISPR spacer
atgcccttctctcatcgatgtttgattaaatcatct	Protospacer
************************************

61. spacer 1.61|13596|37|NC_010478|CRISPRCasFinder,CRT matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

aagcattttccctggtcgccgctggtagcttgtggca	CRISPR spacer
aagcattttccctggtcgccgctggtagcttgtggca	Protospacer
*************************************

62. spacer 1.62|13670|33|NC_010478|CRISPRCasFinder,CRT matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

gcgtaactgtcctaattgtttctcaaggcttaa	CRISPR spacer
gcgtaactgtcctaattgtttctcaaggcttaa	Protospacer
*********************************

63. spacer 1.63|13740|34|NC_010478|CRISPRCasFinder,CRT matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

tggtctccgtctcgcaaacgtagtcgccgctaat	CRISPR spacer
tggtctccgtctcgcaaacgtagtcgccgctaat	Protospacer
**********************************

64. spacer 1.64|13811|34|NC_010478|CRISPRCasFinder,CRT matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

ccctagctttcgccaactgctgcggcaaatcttc	CRISPR spacer
ccctagctttcgccaactgctgcggcaaatcttc	Protospacer
**********************************

65. spacer 1.65|13882|34|NC_010478|CRISPRCasFinder,CRT matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

cagtgcgattcagcggtgggataaagaaaaattg	CRISPR spacer
cagtgcgattcagcggtgggataaagaaaaattg	Protospacer
**********************************

66. spacer 1.66|13953|34|NC_010478|CRISPRCasFinder,CRT matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

ccgattcgcaagtttcatcatcaatccccgtgat	CRISPR spacer
ccgattcgcaagtttcatcatcaatccccgtgat	Protospacer
**********************************

67. spacer 1.67|14024|33|NC_010478|CRISPRCasFinder,CRT matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

cggaacgtcgcgccgaaaccatcgccaggacgg	CRISPR spacer
cggaacgtcgcgccgaaaccatcgccaggacgg	Protospacer
*********************************

68. spacer 1.68|14094|36|NC_010478|CRISPRCasFinder,CRT matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

tgattatgttcaagaaatcacaacgcaaaagaaaaa	CRISPR spacer
tgattatgttcaagaaatcacaacgcaaaagaaaaa	Protospacer
************************************

69. spacer 1.69|14167|34|NC_010478|CRISPRCasFinder,CRT matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

tcaagcgagatacccaccagaaagcctttgacct	CRISPR spacer
tcaagcgagatacccaccagaaagcctttgacct	Protospacer
**********************************

70. spacer 1.70|14238|38|NC_010478|CRISPRCasFinder,CRT matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

gcggcggctgatgtcgccaatgcggttatcgatggcca	CRISPR spacer
gcggcggctgatgtcgccaatgcggttatcgatggcca	Protospacer
**************************************

71. spacer 1.71|14313|38|NC_010478|CRISPRCasFinder,CRT matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

tcccaagggggacagggcggtgatcctcgatgttgcgt	CRISPR spacer
tcccaagggggacagggcggtgatcctcgatgttgcgt	Protospacer
**************************************

72. spacer 1.72|14388|34|NC_010478|CRISPRCasFinder,CRT matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

actcgtctatatatacagagattactacagagat	CRISPR spacer
actcgtctatatatacagagattactacagagat	Protospacer
**********************************

73. spacer 1.73|14459|35|NC_010478|CRISPRCasFinder,CRT matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

cgggaaagtagcctgttttgtggagaattgcaggc	CRISPR spacer
cgggaaagtagcctgttttgtggagaattgcaggc	Protospacer
***********************************

74. spacer 1.74|14531|35|NC_010478|CRISPRCasFinder,CRT matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

tccttccaagtcgcaagccaaacttgcttatcctt	CRISPR spacer
tccttccaagtcgcaagccaaacttgcttatcctt	Protospacer
***********************************

75. spacer 1.75|14603|36|NC_010478|CRISPRCasFinder,CRT matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

cacgcagcacaatgatgtgaccactacgggtgaatt	CRISPR spacer
cacgcagcacaatgatgtgaccactacgggtgaatt	Protospacer
************************************

76. spacer 1.76|14676|36|NC_010478|CRISPRCasFinder,CRT matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

gattggtttggtcggtcatggtctgccttgatggcg	CRISPR spacer
gattggtttggtcggtcatggtctgccttgatggcg	Protospacer
************************************

77. spacer 1.77|14749|34|NC_010478|CRISPRCasFinder,CRT matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

tcaatcgtagcgattcaggcccaggcggtagcaa	CRISPR spacer
tcaatcgtagcgattcaggcccaggcggtagcaa	Protospacer
**********************************

78. spacer 1.78|14820|35|NC_010478|CRISPRCasFinder,CRT matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

ttctgttccgcctcaatcgctgcaagggcatcctg	CRISPR spacer
ttctgttccgcctcaatcgctgcaagggcatcctg	Protospacer
***********************************

79. spacer 1.79|14892|34|NC_010478|CRISPRCasFinder,CRT matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

ccaacgcgatctatcacggttgcttcgataaaaa	CRISPR spacer
ccaacgcgatctatcacggttgcttcgataaaaa	Protospacer
**********************************

80. spacer 1.80|14963|36|NC_010478|CRISPRCasFinder,CRT matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 0, identity: 1.0 

cctctttgagacgaaaaacagcgccaacgcctgggt	CRISPR spacer
cctctttgagacgaaaaacagcgccaacgcctgggt	Protospacer
************************************

81. spacer 1.32|14420|34|NC_010478|PILER-CR matches to NZ_CP024793 (Nostoc flagelliforme CCNUN1 plasmid pNFSY08, complete sequence) position: , mismatch: 5, identity: 0.853 

actcgtctatatatacagagattactacagagat	CRISPR spacer
aaccatatatagatacagagattactacagagat	Protospacer
* .*.* **** **********************

82. spacer 1.72|14388|34|NC_010478|CRISPRCasFinder,CRT matches to NZ_CP024793 (Nostoc flagelliforme CCNUN1 plasmid pNFSY08, complete sequence) position: , mismatch: 5, identity: 0.853 

actcgtctatatatacagagattactacagagat	CRISPR spacer
aaccatatatagatacagagattactacagagat	Protospacer
* .*.* **** **********************

83. spacer 1.37|14786|34|NC_010478|PILER-CR matches to NZ_CP044084 (Pseudomonas luteola strain FDAARGOS_637 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.824 

tcaatcg--tagcgattcaggcccaggcggtagcaa	CRISPR spacer
--aagcgtttagcgattcaggccaagggggtagcac	Protospacer
  ** **  ************** *** *******

84. spacer 1.77|14749|34|NC_010478|CRISPRCasFinder,CRT matches to NZ_CP044084 (Pseudomonas luteola strain FDAARGOS_637 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.824 

tcaatcg--tagcgattcaggcccaggcggtagcaa	CRISPR spacer
--aagcgtttagcgattcaggccaagggggtagcac	Protospacer
  ** **  ************** *** *******

85. spacer 1.37|14786|34|NC_010478|PILER-CR matches to NZ_KY362369 (Pseudomonas syringae pv. syringae strain 6-9 plasmid pPs6-9, complete sequence) position: , mismatch: 8, identity: 0.765 

tcaatcgtagcgattcaggcccaggcggtagcaa	CRISPR spacer
gcccttgaagcgcttcaggcccaggctgtagcag	Protospacer
 *  *.* **** ************* ******.

86. spacer 1.37|14786|34|NC_010478|PILER-CR matches to NZ_KY362372 (Pseudomonas syringae pv. syringae strain UMAF0170 plasmid pPs0170, complete sequence) position: , mismatch: 8, identity: 0.765 

tcaatcgtagcgattcaggcccaggcggtagcaa	CRISPR spacer
gcccttgaagcgcttcaggcccaggctgtagcag	Protospacer
 *  *.* **** ************* ******.

87. spacer 1.37|14786|34|NC_010478|PILER-CR matches to NZ_KY362368 (Pseudomonas syringae pv. syringae strain UMAF0081 plasmid pPs0081, complete sequence) position: , mismatch: 8, identity: 0.765 

tcaatcgtagcgattcaggcccaggcggtagcaa	CRISPR spacer
gcccttgaagcgcttcaggcccaggctgtagcag	Protospacer
 *  *.* **** ************* ******.

88. spacer 1.37|14786|34|NC_010478|PILER-CR matches to NZ_CP024713 (Pseudomonas syringae pv. actinidiae strain MAFF212063 plasmid pMAFF212063-A, complete sequence) position: , mismatch: 8, identity: 0.765 

tcaatcgtagcgattcaggcccaggcggtagcaa	CRISPR spacer
gcccttgaagcgcttcaggcccaggctgtagcag	Protospacer
 *  *.* **** ************* ******.

89. spacer 1.37|14786|34|NC_010478|PILER-CR matches to CP050261 (Pseudomonas coronafaciens strain X-1 plasmid unnamed1) position: , mismatch: 8, identity: 0.765 

tcaatcgtagcgattcaggcccaggcggtagcaa	CRISPR spacer
gcccttgaagcgcttcaggcccaggctgtagcag	Protospacer
 *  *.* **** ************* ******.

90. spacer 1.37|14786|34|NC_010478|PILER-CR matches to NZ_CP042805 (Pseudomonas amygdali pv. tabaci str. ATCC 11528 plasmid pTab1, complete sequence) position: , mismatch: 8, identity: 0.765 

tcaatcgtagcgattcaggcccaggcggtagcaa	CRISPR spacer
gcccttgaagcgcttcaggcccaggctgtagcag	Protospacer
 *  *.* **** ************* ******.

91. spacer 1.37|14786|34|NC_010478|PILER-CR matches to CP046442 (Pseudomonas coronafaciens pv. coronafaciens strain B19001 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765 

tcaatcgtagcgattcaggcccaggcggtagcaa	CRISPR spacer
gcccttgaagcgcttcaggcccaggctgtagcag	Protospacer
 *  *.* **** ************* ******.

92. spacer 1.37|14786|34|NC_010478|PILER-CR matches to NZ_CP046036 (Pseudomonas coronafaciens pv. oryzae str. 1_6 plasmid pPor1_6, complete sequence) position: , mismatch: 8, identity: 0.765 

tcaatcgtagcgattcaggcccaggcggtagcaa	CRISPR spacer
gcccttgaagcgcttcaggcccaggctgtagcag	Protospacer
 *  *.* **** ************* ******.

93. spacer 1.37|14786|34|NC_010478|PILER-CR matches to NC_019328 (Pseudomonas syringae plasmid pB76-81, complete sequence) position: , mismatch: 8, identity: 0.765 

tcaatcgtagcgattcaggcccaggcggtagcaa	CRISPR spacer
gcccttgaagcgcttcaggcccaggctgtagcag	Protospacer
 *  *.* **** ************* ******.

94. spacer 1.37|14786|34|NC_010478|PILER-CR matches to NC_005918 (Pseudomonas syringae pv. maculicola strain ES4326 plasmid pPMA4326A, complete sequence) position: , mismatch: 8, identity: 0.765 

tcaatcgtagcgattcaggcccaggcggtagcaa	CRISPR spacer
gcccttgaagcgcttcaggcccaggctgtagcag	Protospacer
 *  *.* **** ************* ******.

95. spacer 1.37|14786|34|NC_010478|PILER-CR matches to NZ_CP047262 (Pseudomonas syringae pv. maculicola str. ES4326 plasmid pPma4326A, complete sequence) position: , mismatch: 8, identity: 0.765 

tcaatcgtagcgattcaggcccaggcggtagcaa	CRISPR spacer
gcccttgaagcgcttcaggcccaggctgtagcag	Protospacer
 *  *.* **** ************* ******.

96. spacer 1.77|14749|34|NC_010478|CRISPRCasFinder,CRT matches to NZ_KY362369 (Pseudomonas syringae pv. syringae strain 6-9 plasmid pPs6-9, complete sequence) position: , mismatch: 8, identity: 0.765 

tcaatcgtagcgattcaggcccaggcggtagcaa	CRISPR spacer
gcccttgaagcgcttcaggcccaggctgtagcag	Protospacer
 *  *.* **** ************* ******.

97. spacer 1.77|14749|34|NC_010478|CRISPRCasFinder,CRT matches to NZ_KY362372 (Pseudomonas syringae pv. syringae strain UMAF0170 plasmid pPs0170, complete sequence) position: , mismatch: 8, identity: 0.765 

tcaatcgtagcgattcaggcccaggcggtagcaa	CRISPR spacer
gcccttgaagcgcttcaggcccaggctgtagcag	Protospacer
 *  *.* **** ************* ******.

98. spacer 1.77|14749|34|NC_010478|CRISPRCasFinder,CRT matches to NZ_KY362368 (Pseudomonas syringae pv. syringae strain UMAF0081 plasmid pPs0081, complete sequence) position: , mismatch: 8, identity: 0.765 

tcaatcgtagcgattcaggcccaggcggtagcaa	CRISPR spacer
gcccttgaagcgcttcaggcccaggctgtagcag	Protospacer
 *  *.* **** ************* ******.

99. spacer 1.77|14749|34|NC_010478|CRISPRCasFinder,CRT matches to NZ_CP024713 (Pseudomonas syringae pv. actinidiae strain MAFF212063 plasmid pMAFF212063-A, complete sequence) position: , mismatch: 8, identity: 0.765 

tcaatcgtagcgattcaggcccaggcggtagcaa	CRISPR spacer
gcccttgaagcgcttcaggcccaggctgtagcag	Protospacer
 *  *.* **** ************* ******.

100. spacer 1.77|14749|34|NC_010478|CRISPRCasFinder,CRT matches to CP050261 (Pseudomonas coronafaciens strain X-1 plasmid unnamed1) position: , mismatch: 8, identity: 0.765 

tcaatcgtagcgattcaggcccaggcggtagcaa	CRISPR spacer
gcccttgaagcgcttcaggcccaggctgtagcag	Protospacer
 *  *.* **** ************* ******.

101. spacer 1.77|14749|34|NC_010478|CRISPRCasFinder,CRT matches to NZ_CP042805 (Pseudomonas amygdali pv. tabaci str. ATCC 11528 plasmid pTab1, complete sequence) position: , mismatch: 8, identity: 0.765 

tcaatcgtagcgattcaggcccaggcggtagcaa	CRISPR spacer
gcccttgaagcgcttcaggcccaggctgtagcag	Protospacer
 *  *.* **** ************* ******.

102. spacer 1.77|14749|34|NC_010478|CRISPRCasFinder,CRT matches to CP046442 (Pseudomonas coronafaciens pv. coronafaciens strain B19001 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765 

tcaatcgtagcgattcaggcccaggcggtagcaa	CRISPR spacer
gcccttgaagcgcttcaggcccaggctgtagcag	Protospacer
 *  *.* **** ************* ******.

103. spacer 1.77|14749|34|NC_010478|CRISPRCasFinder,CRT matches to NZ_CP046036 (Pseudomonas coronafaciens pv. oryzae str. 1_6 plasmid pPor1_6, complete sequence) position: , mismatch: 8, identity: 0.765 

tcaatcgtagcgattcaggcccaggcggtagcaa	CRISPR spacer
gcccttgaagcgcttcaggcccaggctgtagcag	Protospacer
 *  *.* **** ************* ******.

104. spacer 1.77|14749|34|NC_010478|CRISPRCasFinder,CRT matches to NC_019328 (Pseudomonas syringae plasmid pB76-81, complete sequence) position: , mismatch: 8, identity: 0.765 

tcaatcgtagcgattcaggcccaggcggtagcaa	CRISPR spacer
gcccttgaagcgcttcaggcccaggctgtagcag	Protospacer
 *  *.* **** ************* ******.

105. spacer 1.77|14749|34|NC_010478|CRISPRCasFinder,CRT matches to NC_005918 (Pseudomonas syringae pv. maculicola strain ES4326 plasmid pPMA4326A, complete sequence) position: , mismatch: 8, identity: 0.765 

tcaatcgtagcgattcaggcccaggcggtagcaa	CRISPR spacer
gcccttgaagcgcttcaggcccaggctgtagcag	Protospacer
 *  *.* **** ************* ******.

106. spacer 1.77|14749|34|NC_010478|CRISPRCasFinder,CRT matches to NZ_CP047262 (Pseudomonas syringae pv. maculicola str. ES4326 plasmid pPma4326A, complete sequence) position: , mismatch: 8, identity: 0.765 

tcaatcgtagcgattcaggcccaggcggtagcaa	CRISPR spacer
gcccttgaagcgcttcaggcccaggctgtagcag	Protospacer
 *  *.* **** ************* ******.

107. spacer 1.23|13762|34|NC_010478|PILER-CR matches to NZ_CP011665 (Streptomyces sp. Mg1 plasmid pSMg1-1, complete sequence) position: , mismatch: 9, identity: 0.735 

tggtctccgtctcgcaaacgtagtcgccgctaat	CRISPR spacer
tcagctccgcctcgaaaacgtagtcgccgccgtc	Protospacer
* . *****.**** ***************.. .

108. spacer 1.32|14420|34|NC_010478|PILER-CR matches to JX976549 (Acinetobacter phage IME-AB2, complete genome) position: , mismatch: 9, identity: 0.735 

actcgtctatatatacagagattactacagagat	CRISPR spacer
aacgtaatacatatacagagactactacagagaa	Protospacer
* .    **.***********.***********

109. spacer 1.32|14420|34|NC_010478|PILER-CR matches to KP861229 (Acinetobacter phage YMC11/12/R2315, complete genome) position: , mismatch: 9, identity: 0.735 

actcgtctatatatacagagattactacagagat	CRISPR spacer
aacgtaatacatatacagagactactacagagaa	Protospacer
* .    **.***********.***********

110. spacer 1.32|14420|34|NC_010478|PILER-CR matches to KJ817802 (Acinetobacter phage YMC-13-01-C62, complete genome) position: , mismatch: 9, identity: 0.735 

actcgtctatatatacagagattactacagagat	CRISPR spacer
aacgtaatacatatacagagactactacagagaa	Protospacer
* .    **.***********.***********

111. spacer 1.32|14420|34|NC_010478|PILER-CR matches to NZ_CP050417 (Acinetobacter baumannii strain PM193665 plasmid pPM193665_2, complete sequence) position: , mismatch: 9, identity: 0.735 

actcgtctatatatacagagattactacagagat	CRISPR spacer
agggtgacacatatacagagaatactacagagat	Protospacer
*      .*.*********** ************

112. spacer 1.32|14420|34|NC_010478|PILER-CR matches to MN516422 (Acinetobacter phage Bphi-R1888, complete genome) position: , mismatch: 9, identity: 0.735 

actcgtctatatatacagagattactacagagat	CRISPR spacer
aacgtaatacatatacagagactactacagagaa	Protospacer
* .    **.***********.***********

113. spacer 1.32|14420|34|NC_010478|PILER-CR matches to KP861231 (Acinetobacter phage YMC11/12/R1215, complete genome) position: , mismatch: 9, identity: 0.735 

actcgtctatatatacagagattactacagagat	CRISPR spacer
aacgtaatacatatacagagactactacagagaa	Protospacer
* .    **.***********.***********

114. spacer 1.32|14420|34|NC_010478|PILER-CR matches to MN516421 (Acinetobacter phage Bphi-R2919, complete genome) position: , mismatch: 9, identity: 0.735 

actcgtctatatatacagagattactacagagat	CRISPR spacer
aacgtaatacatatacagagactactacagagaa	Protospacer
* .    **.***********.***********

115. spacer 1.32|14420|34|NC_010478|PILER-CR matches to MT361972 (Acinetobacter phage Ab11510-phi, complete genome) position: , mismatch: 9, identity: 0.735 

actcgtctatatatacagagattactacagagat	CRISPR spacer
agggtgacacatatacagagaatactacagagat	Protospacer
*      .*.*********** ************

116. spacer 1.32|14420|34|NC_010478|PILER-CR matches to MT349887 (Acinetobacter phage 5W, complete genome) position: , mismatch: 9, identity: 0.735 

actcgtctatatatacagagattactacagagat	CRISPR spacer
agggtgacacatatacagagaatactacagagat	Protospacer
*      .*.*********** ************

117. spacer 1.37|14786|34|NC_010478|PILER-CR matches to NZ_CP045801 (Pseudomonas syringae USA011 plasmid pUSA011-2, complete sequence) position: , mismatch: 9, identity: 0.735 

tcaatcgtagcgattcaggcccaggcggtagcaa	CRISPR spacer
gcccttgaagcgcttcaggcccaggctgtagctg	Protospacer
 *  *.* **** ************* ***** .

118. spacer 1.37|14786|34|NC_010478|PILER-CR matches to NZ_KY362371 (Pseudomonas syringae pv. syringae strain UMAF1029 plasmid pPs1029, complete sequence) position: , mismatch: 9, identity: 0.735 

tcaatcgtagcgattcaggcccaggcggtagcaa	CRISPR spacer
gcccttgaagcgcttcaggcccaggctgtagccg	Protospacer
 *  *.* **** ************* ***** .

119. spacer 1.37|14786|34|NC_010478|PILER-CR matches to NZ_KY362370 (Pseudomonas syringae pv. syringae strain UMAF0158 plasmid pPs0158, complete sequence) position: , mismatch: 9, identity: 0.735 

tcaatcgtagcgattcaggcccaggcggtagcaa	CRISPR spacer
gcccttgaagcgcttcaggcccaggctgtagccg	Protospacer
 *  *.* **** ************* ***** .

120. spacer 1.37|14786|34|NC_010478|PILER-CR matches to NZ_CP005971 (Pseudomonas syringae UMAF0158 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735 

tcaatcgtagcgattcaggcccaggcggtagcaa	CRISPR spacer
gcccttgaagcgcttcaggcccaggctgtagccg	Protospacer
 *  *.* **** ************* ***** .

121. spacer 1.37|14786|34|NC_010478|PILER-CR matches to NZ_CP041756 (Pseudomonas sp. KBS0707 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735 

tcaatcgtagcgattcaggcccaggcggtagcaa	CRISPR spacer
gcccttgaagcgcttcaggcccaggctgtagccg	Protospacer
 *  *.* **** ************* ***** .

122. spacer 1.63|13740|34|NC_010478|CRISPRCasFinder,CRT matches to NZ_CP011665 (Streptomyces sp. Mg1 plasmid pSMg1-1, complete sequence) position: , mismatch: 9, identity: 0.735 

tggtctccgtctcgcaaacgtagtcgccgctaat	CRISPR spacer
tcagctccgcctcgaaaacgtagtcgccgccgtc	Protospacer
* . *****.**** ***************.. .

123. spacer 1.72|14388|34|NC_010478|CRISPRCasFinder,CRT matches to JX976549 (Acinetobacter phage IME-AB2, complete genome) position: , mismatch: 9, identity: 0.735 

actcgtctatatatacagagattactacagagat	CRISPR spacer
aacgtaatacatatacagagactactacagagaa	Protospacer
* .    **.***********.***********

124. spacer 1.72|14388|34|NC_010478|CRISPRCasFinder,CRT matches to KP861229 (Acinetobacter phage YMC11/12/R2315, complete genome) position: , mismatch: 9, identity: 0.735 

actcgtctatatatacagagattactacagagat	CRISPR spacer
aacgtaatacatatacagagactactacagagaa	Protospacer
* .    **.***********.***********

125. spacer 1.72|14388|34|NC_010478|CRISPRCasFinder,CRT matches to KJ817802 (Acinetobacter phage YMC-13-01-C62, complete genome) position: , mismatch: 9, identity: 0.735 

actcgtctatatatacagagattactacagagat	CRISPR spacer
aacgtaatacatatacagagactactacagagaa	Protospacer
* .    **.***********.***********

126. spacer 1.72|14388|34|NC_010478|CRISPRCasFinder,CRT matches to NZ_CP050417 (Acinetobacter baumannii strain PM193665 plasmid pPM193665_2, complete sequence) position: , mismatch: 9, identity: 0.735 

actcgtctatatatacagagattactacagagat	CRISPR spacer
agggtgacacatatacagagaatactacagagat	Protospacer
*      .*.*********** ************

127. spacer 1.72|14388|34|NC_010478|CRISPRCasFinder,CRT matches to MN516422 (Acinetobacter phage Bphi-R1888, complete genome) position: , mismatch: 9, identity: 0.735 

actcgtctatatatacagagattactacagagat	CRISPR spacer
aacgtaatacatatacagagactactacagagaa	Protospacer
* .    **.***********.***********

128. spacer 1.72|14388|34|NC_010478|CRISPRCasFinder,CRT matches to KP861231 (Acinetobacter phage YMC11/12/R1215, complete genome) position: , mismatch: 9, identity: 0.735 

actcgtctatatatacagagattactacagagat	CRISPR spacer
aacgtaatacatatacagagactactacagagaa	Protospacer
* .    **.***********.***********

129. spacer 1.72|14388|34|NC_010478|CRISPRCasFinder,CRT matches to MN516421 (Acinetobacter phage Bphi-R2919, complete genome) position: , mismatch: 9, identity: 0.735 

actcgtctatatatacagagattactacagagat	CRISPR spacer
aacgtaatacatatacagagactactacagagaa	Protospacer
* .    **.***********.***********

130. spacer 1.72|14388|34|NC_010478|CRISPRCasFinder,CRT matches to MT361972 (Acinetobacter phage Ab11510-phi, complete genome) position: , mismatch: 9, identity: 0.735 

actcgtctatatatacagagattactacagagat	CRISPR spacer
agggtgacacatatacagagaatactacagagat	Protospacer
*      .*.*********** ************

131. spacer 1.72|14388|34|NC_010478|CRISPRCasFinder,CRT matches to MT349887 (Acinetobacter phage 5W, complete genome) position: , mismatch: 9, identity: 0.735 

actcgtctatatatacagagattactacagagat	CRISPR spacer
agggtgacacatatacagagaatactacagagat	Protospacer
*      .*.*********** ************

132. spacer 1.77|14749|34|NC_010478|CRISPRCasFinder,CRT matches to NZ_CP045801 (Pseudomonas syringae USA011 plasmid pUSA011-2, complete sequence) position: , mismatch: 9, identity: 0.735 

tcaatcgtagcgattcaggcccaggcggtagcaa	CRISPR spacer
gcccttgaagcgcttcaggcccaggctgtagctg	Protospacer
 *  *.* **** ************* ***** .

133. spacer 1.77|14749|34|NC_010478|CRISPRCasFinder,CRT matches to NZ_KY362371 (Pseudomonas syringae pv. syringae strain UMAF1029 plasmid pPs1029, complete sequence) position: , mismatch: 9, identity: 0.735 

tcaatcgtagcgattcaggcccaggcggtagcaa	CRISPR spacer
gcccttgaagcgcttcaggcccaggctgtagccg	Protospacer
 *  *.* **** ************* ***** .

134. spacer 1.77|14749|34|NC_010478|CRISPRCasFinder,CRT matches to NZ_KY362370 (Pseudomonas syringae pv. syringae strain UMAF0158 plasmid pPs0158, complete sequence) position: , mismatch: 9, identity: 0.735 

tcaatcgtagcgattcaggcccaggcggtagcaa	CRISPR spacer
gcccttgaagcgcttcaggcccaggctgtagccg	Protospacer
 *  *.* **** ************* ***** .

135. spacer 1.77|14749|34|NC_010478|CRISPRCasFinder,CRT matches to NZ_CP005971 (Pseudomonas syringae UMAF0158 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735 

tcaatcgtagcgattcaggcccaggcggtagcaa	CRISPR spacer
gcccttgaagcgcttcaggcccaggctgtagccg	Protospacer
 *  *.* **** ************* ***** .

136. spacer 1.77|14749|34|NC_010478|CRISPRCasFinder,CRT matches to NZ_CP041756 (Pseudomonas sp. KBS0707 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735 

tcaatcgtagcgattcaggcccaggcggtagcaa	CRISPR spacer
gcccttgaagcgcttcaggcccaggctgtagccg	Protospacer
 *  *.* **** ************* ***** .

137. spacer 1.24|13834|34|NC_010478|PILER-CR matches to NC_008760 (Polaromonas naphthalenivorans CJ2 plasmid pPNAP04, complete sequence) position: , mismatch: 10, identity: 0.706 

ccctagctttcgccaactgctgcggcaaatcttc	CRISPR spacer
aaacgactttcgcgtactgctgcggcaaatcatt	Protospacer
   ...*******  **************** *.

138. spacer 1.27|14050|33|NC_010478|PILER-CR matches to NZ_CP032703 (Pantoea dispersa strain DSM 32899 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.697 

cggaacgtcgcgccgaaaccatcgccaggacgg	CRISPR spacer
gcaaacgtcgcgcagaacccatcgccagataca	Protospacer
  .********** *** **********.   .

139. spacer 1.40|15003|36|NC_010478|PILER-CR matches to LR134122 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2) position: , mismatch: 10, identity: 0.722 

cctctttgagacgaaaaacagcgccaacgcctgggt	CRISPR spacer
cgccaggccgacgataaacagcgccagcgcctggga	Protospacer
* .*     ***** ***********.********

140. spacer 1.64|13811|34|NC_010478|CRISPRCasFinder,CRT matches to NC_008760 (Polaromonas naphthalenivorans CJ2 plasmid pPNAP04, complete sequence) position: , mismatch: 10, identity: 0.706 

ccctagctttcgccaactgctgcggcaaatcttc	CRISPR spacer
aaacgactttcgcgtactgctgcggcaaatcatt	Protospacer
   ...*******  **************** *.

141. spacer 1.67|14024|33|NC_010478|CRISPRCasFinder,CRT matches to NZ_CP032703 (Pantoea dispersa strain DSM 32899 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.697 

cggaacgtcgcgccgaaaccatcgccaggacgg	CRISPR spacer
gcaaacgtcgcgcagaacccatcgccagataca	Protospacer
  .********** *** **********.   .

142. spacer 1.80|14963|36|NC_010478|CRISPRCasFinder,CRT matches to LR134122 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2) position: , mismatch: 10, identity: 0.722 

cctctttgagacgaaaaacagcgccaacgcctgggt	CRISPR spacer
cgccaggccgacgataaacagcgccagcgcctggga	Protospacer
* .*     ***** ***********.********

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage