Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_011263 Borrelia recurrentis A1 plasmid pl6, complete sequence 0 crisprs NA 0 0 0 0
NC_011258 Borrelia recurrentis A1 plasmid pl37, complete sequence 1 crisprs NA 0 1 0 0
NC_011260 Borrelia recurrentis A1 plasmid pl53, complete sequence 1 crisprs NA 0 1 0 0
NC_011253 Borrelia recurrentis A1 plasmid pl33, complete sequence 1 crisprs NA 2 2 0 0
NC_011246 Borrelia recurrentis A1 plasmid pl124, complete sequence 0 crisprs cas14j 0 0 0 0
NC_011252 Borrelia recurrentis A1 plasmid pl23, complete sequence 0 crisprs NA 0 0 0 0
NC_011244 Borrelia recurrentis A1, complete genome 0 crisprs NA 0 0 0 0
NC_011255 Borrelia recurrentis A1 plasmid pl35, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NC_011260
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_011260_1 31995-32083 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_011260_1 1.1|32018|43|NC_011260|CRISPRCasFinder 32018-32060 43 NC_011258 Borrelia recurrentis A1 plasmid pl37, complete sequence 16401-16443 0 1.0
NC_011260_1 1.1|32018|43|NC_011260|CRISPRCasFinder 32018-32060 43 NC_011260 Borrelia recurrentis A1 plasmid pl53, complete sequence 32018-32060 0 1.0
NC_011260_1 1.1|32018|43|NC_011260|CRISPRCasFinder 32018-32060 43 NC_011249 Borrelia duttonii Ly plasmid pl36, complete sequence 26666-26708 10 0.767

1. spacer 1.1|32018|43|NC_011260|CRISPRCasFinder matches to NC_011258 (Borrelia recurrentis A1 plasmid pl37, complete sequence) position: , mismatch: 0, identity: 1.0

caagatagaactcaataataaaattgataaagtagaagataag	CRISPR spacer
caagatagaactcaataataaaattgataaagtagaagataag	Protospacer
*******************************************

2. spacer 1.1|32018|43|NC_011260|CRISPRCasFinder matches to NC_011260 (Borrelia recurrentis A1 plasmid pl53, complete sequence) position: , mismatch: 0, identity: 1.0

caagatagaactcaataataaaattgataaagtagaagataag	CRISPR spacer
caagatagaactcaataataaaattgataaagtagaagataag	Protospacer
*******************************************

3. spacer 1.1|32018|43|NC_011260|CRISPRCasFinder matches to NC_011249 (Borrelia duttonii Ly plasmid pl36, complete sequence) position: , mismatch: 10, identity: 0.767

caagatagaactcaataataaaattgataaagtagaagataag	CRISPR spacer
agaaaataatttcaatagtaaaattgataaaatagaagataag	Protospacer
 .*.*  .* .******.*************.***********

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_011258
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_011258_1 16378-16466 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_011258_1 1.1|16401|43|NC_011258|CRISPRCasFinder 16401-16443 43 NC_011258 Borrelia recurrentis A1 plasmid pl37, complete sequence 16401-16443 0 1.0
NC_011258_1 1.1|16401|43|NC_011258|CRISPRCasFinder 16401-16443 43 NC_011260 Borrelia recurrentis A1 plasmid pl53, complete sequence 32018-32060 0 1.0
NC_011258_1 1.1|16401|43|NC_011258|CRISPRCasFinder 16401-16443 43 NC_011249 Borrelia duttonii Ly plasmid pl36, complete sequence 26666-26708 10 0.767

1. spacer 1.1|16401|43|NC_011258|CRISPRCasFinder matches to NC_011258 (Borrelia recurrentis A1 plasmid pl37, complete sequence) position: , mismatch: 0, identity: 1.0

caagatagaactcaataataaaattgataaagtagaagataag	CRISPR spacer
caagatagaactcaataataaaattgataaagtagaagataag	Protospacer
*******************************************

2. spacer 1.1|16401|43|NC_011258|CRISPRCasFinder matches to NC_011260 (Borrelia recurrentis A1 plasmid pl53, complete sequence) position: , mismatch: 0, identity: 1.0

caagatagaactcaataataaaattgataaagtagaagataag	CRISPR spacer
caagatagaactcaataataaaattgataaagtagaagataag	Protospacer
*******************************************

3. spacer 1.1|16401|43|NC_011258|CRISPRCasFinder matches to NC_011249 (Borrelia duttonii Ly plasmid pl36, complete sequence) position: , mismatch: 10, identity: 0.767

caagatagaactcaataataaaattgataaagtagaagataag	CRISPR spacer
agaaaataatttcaatagtaaaattgataaaatagaagataag	Protospacer
 .*.*  .* .******.*************.***********

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NC_011255
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NC_011253
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_011253_1 22762-22979 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_011253_1 1.1|22817|32|NC_011253|PILER-CR 22817-22848 32 NC_011253.1 22980-23011 1 0.969
NC_011253_1 1.1|22817|32|NC_011253|PILER-CR 22817-22848 32 NC_011253.1 23067-23098 1 0.969
NC_011253_1 1.1|22817|32|NC_011253|PILER-CR 22817-22848 32 NC_011253.1 26039-26070 2 0.938
NC_011253_1 1.1|22817|32|NC_011253|PILER-CR 22817-22848 32 NC_011255.1 6650-6681 2 0.938
NC_011253_1 1.2|22904|32|NC_011253|PILER-CR 22904-22935 32 NC_011253.1 22980-23011 2 0.938
NC_011253_1 1.2|22904|32|NC_011253|PILER-CR 22904-22935 32 NC_011253.1 23067-23098 2 0.938

1. spacer 1.1|22817|32|NC_011253|PILER-CR matches to position: 22980-23011, mismatch: 1, identity: 0.969

aataataaaatcgacagagtaagggacgaatt	CRISPR spacer
aataataaaatcgacaaagtaagggacgaatt	Protospacer
****************.***************

2. spacer 1.1|22817|32|NC_011253|PILER-CR matches to position: 23067-23098, mismatch: 1, identity: 0.969

aataataaaatcgacagagtaagggacgaatt	CRISPR spacer
aataataaaatcgacaaagtaagggacgaatt	Protospacer
****************.***************

3. spacer 1.1|22817|32|NC_011253|PILER-CR matches to position: 26039-26070, mismatch: 2, identity: 0.938

aataataaaatcgacagagtaagggacgaatt	CRISPR spacer
aataacaaaatcgacaaagtaagggacgaatt	Protospacer
*****.**********.***************

4. spacer 1.1|22817|32|NC_011253|PILER-CR matches to position: 6650-6681, mismatch: 2, identity: 0.938

aataataaaatcgacagagtaagggacgaatt	CRISPR spacer
aataacaaaatcgacaaagtaagggacgaatt	Protospacer
*****.**********.***************

5. spacer 1.2|22904|32|NC_011253|PILER-CR matches to position: 22980-23011, mismatch: 2, identity: 0.938

aataataaaatcgacagagtaaggaacgaatt	CRISPR spacer
aataataaaatcgacaaagtaagggacgaatt	Protospacer
****************.*******.*******

6. spacer 1.2|22904|32|NC_011253|PILER-CR matches to position: 23067-23098, mismatch: 2, identity: 0.938

aataataaaatcgacagagtaaggaacgaatt	CRISPR spacer
aataataaaatcgacaaagtaagggacgaatt	Protospacer
****************.*******.*******

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_011253_1 1.1|22817|32|NC_011253|PILER-CR 22817-22848 32 NC_011253 Borrelia recurrentis A1 plasmid pl33, complete sequence 22806-22837 0 1.0
NC_011253_1 1.2|22904|32|NC_011253|PILER-CR 22904-22935 32 NC_011253 Borrelia recurrentis A1 plasmid pl33, complete sequence 22893-22924 0 1.0
NC_011253_1 1.1|22817|32|NC_011253|PILER-CR 22817-22848 32 NC_011253 Borrelia recurrentis A1 plasmid pl33, complete sequence 22893-22924 1 0.969
NC_011253_1 1.1|22817|32|NC_011253|PILER-CR 22817-22848 32 NC_011253 Borrelia recurrentis A1 plasmid pl33, complete sequence 22980-23011 1 0.969
NC_011253_1 1.1|22817|32|NC_011253|PILER-CR 22817-22848 32 NC_011253 Borrelia recurrentis A1 plasmid pl33, complete sequence 23067-23098 1 0.969
NC_011253_1 1.1|22817|32|NC_011253|PILER-CR 22817-22848 32 NC_011261 Borrelia duttonii Ly plasmid pl26, complete sequence 10300-10331 1 0.969
NC_011253_1 1.2|22904|32|NC_011253|PILER-CR 22904-22935 32 NC_011253 Borrelia recurrentis A1 plasmid pl33, complete sequence 22806-22837 1 0.969
NC_011253_1 1.1|22817|32|NC_011253|PILER-CR 22817-22848 32 NC_011253 Borrelia recurrentis A1 plasmid pl33, complete sequence 26039-26070 2 0.938
NC_011253_1 1.1|22817|32|NC_011253|PILER-CR 22817-22848 32 NC_011255 Borrelia recurrentis A1 plasmid pl35, complete sequence 6650-6681 2 0.938
NC_011253_1 1.1|22817|32|NC_011253|PILER-CR 22817-22848 32 NC_011245 Borrelia duttonii Ly plasmid pl28, complete sequence 11925-11956 2 0.938
NC_011253_1 1.1|22817|32|NC_011253|PILER-CR 22817-22848 32 NC_011265 Borrelia duttonii Ly plasmid pl27, complete sequence 6696-6727 2 0.938
NC_011253_1 1.2|22904|32|NC_011253|PILER-CR 22904-22935 32 NC_011253 Borrelia recurrentis A1 plasmid pl33, complete sequence 22980-23011 2 0.938
NC_011253_1 1.2|22904|32|NC_011253|PILER-CR 22904-22935 32 NC_011253 Borrelia recurrentis A1 plasmid pl33, complete sequence 23067-23098 2 0.938
NC_011253_1 1.2|22904|32|NC_011253|PILER-CR 22904-22935 32 NC_011261 Borrelia duttonii Ly plasmid pl26, complete sequence 10300-10331 2 0.938
NC_011253_1 1.1|22817|32|NC_011253|PILER-CR 22817-22848 32 NC_011255 Borrelia recurrentis A1 plasmid pl35, complete sequence 26281-26312 3 0.906
NC_011253_1 1.1|22817|32|NC_011253|PILER-CR 22817-22848 32 NC_011245 Borrelia duttonii Ly plasmid pl28, complete sequence 11979-12010 3 0.906
NC_011253_1 1.1|22817|32|NC_011253|PILER-CR 22817-22848 32 NC_011251 Borrelia duttonii Ly plasmid pl41, complete sequence 23978-24009 3 0.906
NC_011253_1 1.1|22817|32|NC_011253|PILER-CR 22817-22848 32 NC_011251 Borrelia duttonii Ly plasmid pl41, complete sequence 31160-31191 3 0.906
NC_011253_1 1.1|22817|32|NC_011253|PILER-CR 22817-22848 32 NC_011262 Borrelia duttonii Ly plasmid pl31, complete sequence 21137-21168 3 0.906
NC_011253_1 1.1|22817|32|NC_011253|PILER-CR 22817-22848 32 NC_011262 Borrelia duttonii Ly plasmid pl31, complete sequence 28354-28385 3 0.906
NC_011253_1 1.1|22817|32|NC_011253|PILER-CR 22817-22848 32 NC_008442 Borrelia duttonii plasmid DNA, complete sequence, strain: Ly 30425-30456 3 0.906

1. spacer 1.1|22817|32|NC_011253|PILER-CR matches to NC_011253 (Borrelia recurrentis A1 plasmid pl33, complete sequence) position: , mismatch: 0, identity: 1.0

aataataaaatcgacagagtaagggacgaatt	CRISPR spacer
aataataaaatcgacagagtaagggacgaatt	Protospacer
********************************

2. spacer 1.2|22904|32|NC_011253|PILER-CR matches to NC_011253 (Borrelia recurrentis A1 plasmid pl33, complete sequence) position: , mismatch: 0, identity: 1.0

aataataaaatcgacagagtaaggaacgaatt	CRISPR spacer
aataataaaatcgacagagtaaggaacgaatt	Protospacer
********************************

3. spacer 1.1|22817|32|NC_011253|PILER-CR matches to NC_011253 (Borrelia recurrentis A1 plasmid pl33, complete sequence) position: , mismatch: 1, identity: 0.969

aataataaaatcgacagagtaagggacgaatt	CRISPR spacer
aataataaaatcgacagagtaaggaacgaatt	Protospacer
************************.*******

4. spacer 1.1|22817|32|NC_011253|PILER-CR matches to NC_011253 (Borrelia recurrentis A1 plasmid pl33, complete sequence) position: , mismatch: 1, identity: 0.969

aataataaaatcgacagagtaagggacgaatt	CRISPR spacer
aataataaaatcgacaaagtaagggacgaatt	Protospacer
****************.***************

5. spacer 1.1|22817|32|NC_011253|PILER-CR matches to NC_011253 (Borrelia recurrentis A1 plasmid pl33, complete sequence) position: , mismatch: 1, identity: 0.969

aataataaaatcgacagagtaagggacgaatt	CRISPR spacer
aataataaaatcgacaaagtaagggacgaatt	Protospacer
****************.***************

6. spacer 1.1|22817|32|NC_011253|PILER-CR matches to NC_011261 (Borrelia duttonii Ly plasmid pl26, complete sequence) position: , mismatch: 1, identity: 0.969

aataataaaatcgacagagtaagggacgaatt	CRISPR spacer
aataataaaatcgacaaagtaagggacgaatt	Protospacer
****************.***************

7. spacer 1.2|22904|32|NC_011253|PILER-CR matches to NC_011253 (Borrelia recurrentis A1 plasmid pl33, complete sequence) position: , mismatch: 1, identity: 0.969

aataataaaatcgacagagtaaggaacgaatt	CRISPR spacer
aataataaaatcgacagagtaagggacgaatt	Protospacer
************************.*******

8. spacer 1.1|22817|32|NC_011253|PILER-CR matches to NC_011253 (Borrelia recurrentis A1 plasmid pl33, complete sequence) position: , mismatch: 2, identity: 0.938

aataataaaatcgacagagtaagggacgaatt	CRISPR spacer
aataacaaaatcgacaaagtaagggacgaatt	Protospacer
*****.**********.***************

9. spacer 1.1|22817|32|NC_011253|PILER-CR matches to NC_011255 (Borrelia recurrentis A1 plasmid pl35, complete sequence) position: , mismatch: 2, identity: 0.938

aataataaaatcgacagagtaagggacgaatt	CRISPR spacer
aataacaaaatcgacaaagtaagggacgaatt	Protospacer
*****.**********.***************

10. spacer 1.1|22817|32|NC_011253|PILER-CR matches to NC_011245 (Borrelia duttonii Ly plasmid pl28, complete sequence) position: , mismatch: 2, identity: 0.938

aataataaaatcgacagagtaagggacgaatt	CRISPR spacer
aataataaaatcgacaaggtaagggacgaatt	Protospacer
****************..**************

11. spacer 1.1|22817|32|NC_011253|PILER-CR matches to NC_011265 (Borrelia duttonii Ly plasmid pl27, complete sequence) position: , mismatch: 2, identity: 0.938

aataataaaatcgacagagtaagggacgaatt	CRISPR spacer
aataacaaaatcgacaaagtaagggacgaatt	Protospacer
*****.**********.***************

12. spacer 1.2|22904|32|NC_011253|PILER-CR matches to NC_011253 (Borrelia recurrentis A1 plasmid pl33, complete sequence) position: , mismatch: 2, identity: 0.938

aataataaaatcgacagagtaaggaacgaatt	CRISPR spacer
aataataaaatcgacaaagtaagggacgaatt	Protospacer
****************.*******.*******

13. spacer 1.2|22904|32|NC_011253|PILER-CR matches to NC_011253 (Borrelia recurrentis A1 plasmid pl33, complete sequence) position: , mismatch: 2, identity: 0.938

aataataaaatcgacagagtaaggaacgaatt	CRISPR spacer
aataataaaatcgacaaagtaagggacgaatt	Protospacer
****************.*******.*******

14. spacer 1.2|22904|32|NC_011253|PILER-CR matches to NC_011261 (Borrelia duttonii Ly plasmid pl26, complete sequence) position: , mismatch: 2, identity: 0.938

aataataaaatcgacagagtaaggaacgaatt	CRISPR spacer
aataataaaatcgacaaagtaagggacgaatt	Protospacer
****************.*******.*******

15. spacer 1.1|22817|32|NC_011253|PILER-CR matches to NC_011255 (Borrelia recurrentis A1 plasmid pl35, complete sequence) position: , mismatch: 3, identity: 0.906

aataataaaatcgacagagtaagggacgaatt	CRISPR spacer
gataataaaattgacaaagtaagggacgaatt	Protospacer
.**********.****.***************

16. spacer 1.1|22817|32|NC_011253|PILER-CR matches to NC_011245 (Borrelia duttonii Ly plasmid pl28, complete sequence) position: , mismatch: 3, identity: 0.906

aataataaaatcgacagagtaagggacgaatt	CRISPR spacer
gataacaaaatcgacaaagtaagggacgaatt	Protospacer
.****.**********.***************

17. spacer 1.1|22817|32|NC_011253|PILER-CR matches to NC_011251 (Borrelia duttonii Ly plasmid pl41, complete sequence) position: , mismatch: 3, identity: 0.906

aataataaaatcgacagagtaagggacgaatt	CRISPR spacer
gataacaaaatcgacaaagtaagggacgaatt	Protospacer
.****.**********.***************

18. spacer 1.1|22817|32|NC_011253|PILER-CR matches to NC_011251 (Borrelia duttonii Ly plasmid pl41, complete sequence) position: , mismatch: 3, identity: 0.906

aataataaaatcgacagagtaagggacgaatt	CRISPR spacer
gataacaaaatcgacaaagtaagggacgaatt	Protospacer
.****.**********.***************

19. spacer 1.1|22817|32|NC_011253|PILER-CR matches to NC_011262 (Borrelia duttonii Ly plasmid pl31, complete sequence) position: , mismatch: 3, identity: 0.906

aataataaaatcgacagagtaagggacgaatt	CRISPR spacer
gataacaaaatcgacaaagtaagggacgaatt	Protospacer
.****.**********.***************

20. spacer 1.1|22817|32|NC_011253|PILER-CR matches to NC_011262 (Borrelia duttonii Ly plasmid pl31, complete sequence) position: , mismatch: 3, identity: 0.906

aataataaaatcgacagagtaagggacgaatt	CRISPR spacer
gataacaaaatcgacaaagtaagggacgaatt	Protospacer
.****.**********.***************

21. spacer 1.1|22817|32|NC_011253|PILER-CR matches to NC_008442 (Borrelia duttonii plasmid DNA, complete sequence, strain: Ly) position: , mismatch: 3, identity: 0.906

aataataaaatcgacagagtaagggacgaatt	CRISPR spacer
gataacaaaatcgacaaagtaagggacgaatt	Protospacer
.****.**********.***************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage