Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_010676 Paraburkholderia phytofirmans PsJN chromosome 2, complete sequence 1 crisprs csa3,DinG,cas3 2 0 1 0
NC_010681 Paraburkholderia phytofirmans PsJN chromosome 1, complete sequence 1 crisprs cas3,csa3,WYL,c2c9_V-U4,DinG,DEDDh 0 1 4 0
NC_010679 Paraburkholderia phytofirmans PsJN plasmid pBPHYT01, complete sequence 1 crisprs NA 0 1 1 0

Results visualization

1. NC_010681
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_010681_1 2161247-2161420 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_010681_1 1.2|2161321|27|NC_010681|CRISPRCasFinder 2161321-2161347 27 NZ_CP016080 Mesorhizobium loti NZP2037 plasmid pML2037, complete sequence 98532-98558 5 0.815

1. spacer 1.2|2161321|27|NC_010681|CRISPRCasFinder matches to NZ_CP016080 (Mesorhizobium loti NZP2037 plasmid pML2037, complete sequence) position: , mismatch: 5, identity: 0.815

ccttcctattggcgtttggcatgtcga	CRISPR spacer
gtttcgtattgccgtttggcatgtcgg	Protospacer
 .*** ***** **************.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 203897 : 261637 46 uncultured_Caudovirales_phage(28.57%) integrase,transposase attL 217545:217560|attR 272853:272868
DBSCAN-SWA_2 814839 : 824223 8 Hokovirus(16.67%) NA NA
DBSCAN-SWA_3 1293671 : 1335166 42 Burkholderia_phage(11.11%) protease,terminase,portal,transposase,integrase,head,tail attL 1293441:1293463|attR 1341148:1341170
DBSCAN-SWA_4 3561453 : 3575447 11 Salmonella_phage(12.5%) protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_010676
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_010676_1 3376477-3376705 Orphan NA
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_010676_1 1.3|3376593|20|NC_010676|CRT 3376593-3376612 20 NC_010676.1 3042085-3042104 2 0.9
NC_010676_1 1.5|3376669|19|NC_010676|CRT 3376669-3376687 19 NC_010681.1 2737867-2737885 2 0.895

1. spacer 1.3|3376593|20|NC_010676|CRT matches to position: 3042085-3042104, mismatch: 2, identity: 0.9

gttgaacgtcatgaagtgat	CRISPR spacer
gttcaacgtcttgaagtgat	Protospacer
*** ****** *********

2. spacer 1.5|3376669|19|NC_010676|CRT matches to position: 2737867-2737885, mismatch: 2, identity: 0.895

attcaccgtgcggcgctat	CRISPR spacer
attcaccgtgccgccctat	Protospacer
*********** ** ****

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2807775 : 2844182 33 Stx2-converting_phage(28.57%) integrase,transposase attL 2808012:2808026|attR 2847337:2847351
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NC_010679
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_010679_1 114435-114517 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_010679_1 1.1|114464|25|NC_010679|CRISPRCasFinder 114464-114488 25 NC_010679 Paraburkholderia phytofirmans PsJN plasmid pBPHYT01, complete sequence 114464-114488 0 1.0
NC_010679_1 1.1|114464|25|NC_010679|CRISPRCasFinder 114464-114488 25 NZ_CP013423 Burkholderia sp. MSMB0852 plasmid pMSMB0852, complete sequence 58155-58179 3 0.88

1. spacer 1.1|114464|25|NC_010679|CRISPRCasFinder matches to NC_010679 (Paraburkholderia phytofirmans PsJN plasmid pBPHYT01, complete sequence) position: , mismatch: 0, identity: 1.0

actaagaccgagggtaagccccgct	CRISPR spacer
actaagaccgagggtaagccccgct	Protospacer
*************************

2. spacer 1.1|114464|25|NC_010679|CRISPRCasFinder matches to NZ_CP013423 (Burkholderia sp. MSMB0852 plasmid pMSMB0852, complete sequence) position: , mismatch: 3, identity: 0.88

actaagaccgagggtaagccccgct	CRISPR spacer
cctaagaccgagggtaagccccggc	Protospacer
 ********************** .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 52822 : 94993 41 uncultured_Caudovirales_phage(33.33%) integrase attL 75173:75189|attR 96399:96415
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage