Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_012026 Anaplasma marginale str. Florida, complete sequence 4 crisprs NA 4 0 0 0

Results visualization

1. NC_012026
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_012026_1 809204-809637 Orphan NA
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_012026_2 811064-811225 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_012026_3 812000-812190 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_012026_4 813193-813626 Orphan NA
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_012026_3 3.1|812020|40|NC_012026|CRT 812020-812059 40 NC_012026.1 809636-809675 0 1.0
NC_012026_3 3.1|812020|40|NC_012026|CRT 812020-812059 40 NC_012026.1 810747-810786 0 1.0
NC_012026_3 3.1|812020|40|NC_012026|CRT 812020-812059 40 NC_012026.1 811350-811389 0 1.0
NC_012026_3 3.1|812020|40|NC_012026|CRT 812020-812059 40 NC_012026.1 813625-813664 0 1.0
NC_012026_1 1.4|809491|40|NC_012026|PILER-CR 809491-809530 40 NC_012026.1 810899-810938 1 0.975
NC_012026_1 1.4|809491|40|NC_012026|PILER-CR 809491-809530 40 NC_012026.1 812394-812433 1 0.975
NC_012026_3 3.3|812131|40|NC_012026|CRT 812131-812170 40 NC_012026.1 809636-809675 1 0.975
NC_012026_3 3.3|812131|40|NC_012026|CRT 812131-812170 40 NC_012026.1 810747-810786 1 0.975
NC_012026_3 3.3|812131|40|NC_012026|CRT 812131-812170 40 NC_012026.1 811350-811389 1 0.975
NC_012026_3 3.3|812131|40|NC_012026|CRT 812131-812170 40 NC_012026.1 813625-813664 1 0.975
NC_012026_4 4.4|813480|40|NC_012026|PILER-CR 813480-813519 40 NC_012026.1 810899-810938 1 0.975
NC_012026_4 4.4|813480|40|NC_012026|PILER-CR 813480-813519 40 NC_012026.1 812394-812433 1 0.975

1. spacer 3.1|812020|40|NC_012026|CRT matches to position: 809636-809675, mismatch: 0, identity: 1.0

gtcaagctccttcctgagtgattcacgggcaatcacaggc	CRISPR spacer
gtcaagctccttcctgagtgattcacgggcaatcacaggc	Protospacer
****************************************

2. spacer 3.1|812020|40|NC_012026|CRT matches to position: 810747-810786, mismatch: 0, identity: 1.0

gtcaagctccttcctgagtgattcacgggcaatcacaggc	CRISPR spacer
gtcaagctccttcctgagtgattcacgggcaatcacaggc	Protospacer
****************************************

3. spacer 3.1|812020|40|NC_012026|CRT matches to position: 811350-811389, mismatch: 0, identity: 1.0

gtcaagctccttcctgagtgattcacgggcaatcacaggc	CRISPR spacer
gtcaagctccttcctgagtgattcacgggcaatcacaggc	Protospacer
****************************************

4. spacer 3.1|812020|40|NC_012026|CRT matches to position: 813625-813664, mismatch: 0, identity: 1.0

gtcaagctccttcctgagtgattcacgggcaatcacaggc	CRISPR spacer
gtcaagctccttcctgagtgattcacgggcaatcacaggc	Protospacer
****************************************

5. spacer 1.4|809491|40|NC_012026|PILER-CR matches to position: 810899-810938, mismatch: 1, identity: 0.975

tgagctccttcctgagtgattcacggacaatcacaggcct	CRISPR spacer
tgagctccttcctgagtgattcacgggcaatcacaggcct	Protospacer
**************************.*************

6. spacer 1.4|809491|40|NC_012026|PILER-CR matches to position: 812394-812433, mismatch: 1, identity: 0.975

tgagctccttcctgagtgattcacggacaatcacaggcct	CRISPR spacer
tgagctccttcctgagtgattcacgggcaatcacaggcct	Protospacer
**************************.*************

7. spacer 3.3|812131|40|NC_012026|CRT matches to position: 809636-809675, mismatch: 1, identity: 0.975

gtcaagctccttcctgagtgattcacgggcaatcacaagc	CRISPR spacer
gtcaagctccttcctgagtgattcacgggcaatcacaggc	Protospacer
*************************************.**

8. spacer 3.3|812131|40|NC_012026|CRT matches to position: 810747-810786, mismatch: 1, identity: 0.975

gtcaagctccttcctgagtgattcacgggcaatcacaagc	CRISPR spacer
gtcaagctccttcctgagtgattcacgggcaatcacaggc	Protospacer
*************************************.**

9. spacer 3.3|812131|40|NC_012026|CRT matches to position: 811350-811389, mismatch: 1, identity: 0.975

gtcaagctccttcctgagtgattcacgggcaatcacaagc	CRISPR spacer
gtcaagctccttcctgagtgattcacgggcaatcacaggc	Protospacer
*************************************.**

10. spacer 3.3|812131|40|NC_012026|CRT matches to position: 813625-813664, mismatch: 1, identity: 0.975

gtcaagctccttcctgagtgattcacgggcaatcacaagc	CRISPR spacer
gtcaagctccttcctgagtgattcacgggcaatcacaggc	Protospacer
*************************************.**

11. spacer 4.4|813480|40|NC_012026|PILER-CR matches to position: 810899-810938, mismatch: 1, identity: 0.975

tgagctccttcctgagtgattcacggacaatcacaggcct	CRISPR spacer
tgagctccttcctgagtgattcacgggcaatcacaggcct	Protospacer
**************************.*************

12. spacer 4.4|813480|40|NC_012026|PILER-CR matches to position: 812394-812433, mismatch: 1, identity: 0.975

tgagctccttcctgagtgattcacggacaatcacaggcct	CRISPR spacer
tgagctccttcctgagtgattcacgggcaatcacaggcct	Protospacer
**************************.*************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage