1. spacer 1.30|2640185|32|NC_010814|CRISPRCasFinder,CRT matches to KY554775 (Lactococcus phage AM11, complete genome) position: , mismatch: 5, identity: 0.844
taaaggagaagaaagacatgatag--agacaagg CRISPR spacer
taaaggagaacaaaaacatgataatcagacaa-- Protospacer
********** ***.********. ******
2. spacer 1.30|2640185|32|NC_010814|CRISPRCasFinder,CRT matches to KY554773 (Lactococcus phage AM8, complete genome) position: , mismatch: 5, identity: 0.844
taaaggagaagaaagacatgatag--agacaagg CRISPR spacer
taaaggagaacaaaaacatgataatcagacaa-- Protospacer
********** ***.********. ******
3. spacer 1.30|2640185|32|NC_010814|CRISPRCasFinder,CRT matches to KY554768 (Lactococcus phage AM1, complete genome) position: , mismatch: 5, identity: 0.844
taaaggagaagaaagacatgatag--agacaagg CRISPR spacer
taaaggagaacaaaaacatgataatcagacaa-- Protospacer
********** ***.********. ******
4. spacer 1.30|2640185|32|NC_010814|CRISPRCasFinder,CRT matches to KY554769 (Lactococcus phage AM2, complete genome) position: , mismatch: 5, identity: 0.844
taaaggagaagaaagacatgatag--agacaagg CRISPR spacer
taaaggagaacaaaaacatgataatcagacaa-- Protospacer
********** ***.********. ******
5. spacer 1.30|2640185|32|NC_010814|CRISPRCasFinder,CRT matches to KY554770 (Lactococcus phage AM3, complete genome) position: , mismatch: 5, identity: 0.844
taaaggagaagaaagacatgatag--agacaagg CRISPR spacer
taaaggagaacaaaaacatgataatcagacaa-- Protospacer
********** ***.********. ******
6. spacer 1.30|2640185|32|NC_010814|CRISPRCasFinder,CRT matches to KY554776 (Lactococcus phage AM12, complete genome) position: , mismatch: 5, identity: 0.844
taaaggagaagaaagacatgatag--agacaagg CRISPR spacer
taaaggagaacaaaaacatgataatcagacaa-- Protospacer
********** ***.********. ******
7. spacer 1.30|2640185|32|NC_010814|CRISPRCasFinder,CRT matches to KY554774 (Lactococcus phage AM9, complete genome) position: , mismatch: 5, identity: 0.844
taaaggagaagaaagacatgatag--agacaagg CRISPR spacer
taaaggagaacaaaaacatgataatcagacaa-- Protospacer
********** ***.********. ******
8. spacer 1.15|2639270|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KT033469 (Aeromonas salmonicida subsp. salmonicida strain 01-B522 plasmid pAsa4b, complete sequence) position: , mismatch: 6, identity: 0.812
gcaacagcattaccggtggcctcggccagctg-- CRISPR spacer
gcatcagcattcccggtggcctcggt--gctatt Protospacer
*** ******* *************. ***.
9. spacer 1.15|2639270|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KT033470 (Aeromonas salmonicida subsp. salmonicida strain JF2267 plasmid pAsa4c, complete sequence) position: , mismatch: 6, identity: 0.812
gcaacagcattaccggtggcctcggccagctg-- CRISPR spacer
gcatcagcattcccggtggcctcggt--gctatt Protospacer
*** ******* *************. ***.
10. spacer 1.15|2639270|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NC_009349 (Aeromonas salmonicida subsp. salmonicida A449 plasmid 4, complete sequence) position: , mismatch: 6, identity: 0.812
gcaacagcattaccggtggcctcggccagctg-- CRISPR spacer
gcatcagcattcccggtggcctcggt--gctatt Protospacer
*** ******* *************. ***.
11. spacer 1.15|2639270|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022176 (Aeromonas salmonicida strain S44 plasmid pS44-1, complete sequence) position: , mismatch: 6, identity: 0.812
gcaacagcattaccggtggcctcggccagctg-- CRISPR spacer
gcatcagcattcccggtggcctcggt--gctatt Protospacer
*** ******* *************. ***.
12. spacer 1.15|2639270|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to JX173487 (Pseudomonas phage Phi-S1, complete genome) position: , mismatch: 6, identity: 0.812
gcaacagcattaccggtggcctcg-gccagctg CRISPR spacer
tcaacagccttaccggtgccctcgaaccagcc- Protospacer
******* ********* ***** .*****.
13. spacer 1.15|2639270|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to MH179478 (Pseudomonas phage 67PfluR64PP, complete genome) position: , mismatch: 6, identity: 0.812
gcaacagcattaccggtggcctcg-gccagctg CRISPR spacer
tcaacagccttaccggtgccctcgaaccagcc- Protospacer
******* ********* ***** .*****.
14. spacer 1.15|2639270|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to MT094431 (Pseudomonas phage BIM BV-46, complete genome) position: , mismatch: 6, identity: 0.812
gcaacagcattaccggtggcctcg-gccagctg CRISPR spacer
tcaacagccttaccggtgccctcgaaccagcc- Protospacer
******* ********* ***** .*****.
15. spacer 1.15|2639270|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to MH179475 (Pseudomonas phage 71PfluR64PP, complete genome) position: , mismatch: 6, identity: 0.812
gcaacagcattaccggtggcctcg-gccagctg CRISPR spacer
tcaacagccttaccggtgccctcgaaccagcc- Protospacer
******* ********* ***** .*****.
16. spacer 1.15|2639270|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to MH179472 (Pseudomonas phage 22PfluR64PP, complete genome) position: , mismatch: 6, identity: 0.812
gcaacagcattaccggtggcctcg-gccagctg CRISPR spacer
tcaacagccttaccggtgccctcgaaccagcc- Protospacer
******* ********* ***** .*****.
17. spacer 1.28|2640063|32|NC_010814|CRISPRCasFinder,CRT matches to NC_010333 (Caulobacter sp. K31 plasmid pCAUL02, complete sequence) position: , mismatch: 6, identity: 0.812
taaccg-caatactgcgccagatcggtatgtcg CRISPR spacer
-gtccgccaataccgcgccagatcgctatgtgg Protospacer
. *** ******.*********** ***** *
18. spacer 1.19|2639514|32|NC_010814|CRISPRCasFinder,CRT matches to NZ_MK757441 (Alcaligenes faecalis strain AN70 plasmid pAN70-1, complete sequence) position: , mismatch: 7, identity: 0.781
cgggctggcgggatctgttgcaaaggtggttt CRISPR spacer
cgggctggagggctctgttgcaaagattggcg Protospacer
******** *** ************.* * .
19. spacer 1.21|2639636|32|NC_010814|CRISPRCasFinder,CRT matches to MN694532 (Marine virus AFVG_250M629, complete genome) position: , mismatch: 7, identity: 0.781
tatg-tagcaaaatattattttgattttgcaga CRISPR spacer
-atacttgcaaaatattttttagattttgcatt Protospacer
**. * ********** *** *********
20. spacer 1.21|2639636|32|NC_010814|CRISPRCasFinder,CRT matches to NZ_CP039703 (Clostridium butyricum strain 29-1 plasmid p-butyl_plas_29-1, complete sequence) position: , mismatch: 7, identity: 0.781
tatgtagcaaaatattattttgattttgcaga CRISPR spacer
tttttactaaaatattatgttgattatgcagg Protospacer
* * ** .********** ****** *****.
21. spacer 1.21|2639636|32|NC_010814|CRISPRCasFinder,CRT matches to NZ_CP013238 (Clostridium butyricum strain CDC_51208 plasmid pNPD4_2, complete sequence) position: , mismatch: 7, identity: 0.781
tatgtagcaaaatattattttgattttgcaga CRISPR spacer
tttttactaaaatattatgttgattatgcagg Protospacer
* * ** .********** ****** *****.
22. spacer 1.21|2639636|32|NC_010814|CRISPRCasFinder,CRT matches to NZ_AP019717 (Clostridium butyricum strain NBRC 13949 plasmid pCBU1, complete sequence) position: , mismatch: 7, identity: 0.781
tatgtagcaaaatattattttgattttgcaga CRISPR spacer
tttttactaaaatattatgttgattatgcagg Protospacer
* * ** .********** ****** *****.
23. spacer 1.26|2639941|32|NC_010814|CRISPRCasFinder,CRT matches to NZ_CP020716 (Cnuibacter physcomitrellae strain XA(T) plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
cccaacagtgactggggcaacgtctacaatcg CRISPR spacer
caccacagtgtctggggcatcgtctacgcccg Protospacer
* * ****** ******** *******. .**
24. spacer 1.38|2640673|32|NC_010814|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010325 (Pantoea sp. PSNIH1 plasmid pPSP-057, complete sequence) position: , mismatch: 7, identity: 0.781
gtattgattgccctgttgacggacagggcttt CRISPR spacer
ggacaaattgccctgatgacggacagcgctgt Protospacer
* *. .********* ********** *** *
25. spacer 1.8|2638842|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NC_014389 (Butyrivibrio proteoclasticus B316 plasmid pCY360, complete sequence) position: , mismatch: 8, identity: 0.75
gtatcatcgctctcatgttattctccttttgt CRISPR spacer
tttctatcgcgttcatgttattctccttatct Protospacer
* ..***** .**************** * *
26. spacer 1.15|2639270|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 8, identity: 0.75
gcaacagcattaccggtggcctcggccagctg CRISPR spacer
aacccggctttaccggtggccttggccagctc Protospacer
. *.** *************.********
27. spacer 1.15|2639270|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045368 (Marinobacter sp. THAF39 plasmid phiTHAF39, complete sequence) position: , mismatch: 8, identity: 0.75
gcaacagcattaccggtggcctcggccagctg CRISPR spacer
aagtcggcgttaccggtggcctcggccagatt Protospacer
. . *.**.******************** *
28. spacer 1.17|2639392|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029177 (Acidibrevibacterium fodinaquatile strain G45-3 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
gcgccggatccggagcgtagccgct----tgacccg CRISPR spacer
gcgccgcctccggagcgtagccgtcgccgtga---- Protospacer
****** ***************.. ***
29. spacer 1.21|2639636|32|NC_010814|CRISPRCasFinder,CRT matches to NC_019526 (Enterobacteria phage vB_KleM-RaK2, complete genome) position: , mismatch: 8, identity: 0.75
tatgtagcaaaatattattttgattttgcaga CRISPR spacer
tttgtagtaaaatattatttttattttctctt Protospacer
* *****.************* ***** .
30. spacer 1.21|2639636|32|NC_010814|CRISPRCasFinder,CRT matches to MT708547 (Klebsiella phage Muenster, complete genome) position: , mismatch: 8, identity: 0.75
tatgtagcaaaatattattttgattttgcaga CRISPR spacer
tttgtagtaaaatattatttttattttctctt Protospacer
* *****.************* ***** .
31. spacer 1.21|2639636|32|NC_010814|CRISPRCasFinder,CRT matches to AB897757 (Klebsiella phage K64-1 DNA, complete genome) position: , mismatch: 8, identity: 0.75
tatgtagcaaaatattattttgattttgcaga CRISPR spacer
tttgtagtaaaatattatttttattttctctt Protospacer
* *****.************* ***** .
32. spacer 1.21|2639636|32|NC_010814|CRISPRCasFinder,CRT matches to MK448733 (Streptococcus phage Javan345, complete genome) position: , mismatch: 8, identity: 0.75
tatgtagcaaaatattattttgattttgcaga CRISPR spacer
cgagcaacaaaatattattttgaaattgcaaa Protospacer
.. *.*.**************** *****.*
33. spacer 1.35|2640490|32|NC_010814|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014127 (Pantoea vagans strain FDAARGOS_160 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
gcggcgagactgacgcaaaggccagtttcgac CRISPR spacer
ccggtatccctgatgcacaggccagtttcgac Protospacer
***.. ****.*** **************
34. spacer 1.35|2640490|32|NC_010814|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028350 (Pantoea vagans strain PV989 plasmid pPV989-508, complete sequence) position: , mismatch: 8, identity: 0.75
gcggcgagactgacgcaaaggccagtttcgac CRISPR spacer
ccggtatccctgatgcacaggccagtttcgac Protospacer
***.. ****.*** **************
35. spacer 1.35|2640490|32|NC_010814|CRISPRCasFinder,CRT,PILER-CR matches to NC_014258 (Pantoea vagans C9-1 plasmid pPag3, complete sequence) position: , mismatch: 8, identity: 0.75
gcggcgagactgacgcaaaggccagtttcgac CRISPR spacer
ccggtatccctgatgcacaggccagtttcgac Protospacer
***.. ****.*** **************
36. spacer 1.3|2638537|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to MF063068 (Pseudomonas phage Noxifer, complete genome) position: , mismatch: 9, identity: 0.719
cagaactctgaccatgttttggggttcttgtc CRISPR spacer
cgcagtggcgaccatgttttgaggtttttgtc Protospacer
*. *.. .************.****.*****
37. spacer 1.4|2638598|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KT307967 (Yersinia pseudotuberculosis strain IP2666 plasmid pYV2666, complete sequence) position: , mismatch: 9, identity: 0.719
ttgctctggaaggtgtcgcgtttcagctcaaa CRISPR spacer
tcgtgacataaggtttcgcggttcagctcaaa Protospacer
*.*. .. ***** ***** ***********
38. spacer 1.4|2638598|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NC_010157 (Yersinia pestis Angola plasmid new_pCD, complete sequence) position: , mismatch: 9, identity: 0.719
ttgctctggaaggtgtcgcgtttcagctcaaa CRISPR spacer
tcgtgacataaggtttcgcggttcagctcaaa Protospacer
*.*. .. ***** ***** ***********
39. spacer 1.4|2638598|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NC_006153 (Yersinia pseudotuberculosis IP 32953 plasmid pYV, complete sequence) position: , mismatch: 9, identity: 0.719
ttgctctggaaggtgtcgcgtttcagctcaaa CRISPR spacer
tcgtgacataaggtttcgcggttcagctcaaa Protospacer
*.*. .. ***** ***** ***********
40. spacer 1.4|2638598|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030981 (Yersinia enterocolitica subsp. palearctica strain Y1 plasmid pYV, complete sequence) position: , mismatch: 9, identity: 0.719
ttgctctggaaggtgtcgcgtttcagctcaaa CRISPR spacer
tcgtgacataaggtttcgcggttcagctcaaa Protospacer
*.*. .. ***** ***** ***********
41. spacer 1.4|2638598|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NC_005813 (Yersinia pestis biovar Microtus str. 91001 plasmid pCD1, complete sequence) position: , mismatch: 9, identity: 0.719
ttgctctggaaggtgtcgcgtttcagctcaaa CRISPR spacer
tcgtgacataaggtttcgcggttcagctcaaa Protospacer
*.*. .. ***** ***** ***********
42. spacer 1.4|2638598|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to CP016946 (Yersinia enterocolitica strain YE1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
ttgctctggaaggtgtcgcgtttcagctcaaa CRISPR spacer
tcgtgacataaggtttcgcggttcagctcaaa Protospacer
*.*. .. ***** ***** ***********
43. spacer 1.4|2638598|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009491 (Yersinia pestis strain PBM19 plasmid pCD1, complete sequence) position: , mismatch: 9, identity: 0.719
ttgctctggaaggtgtcgcgtttcagctcaaa CRISPR spacer
tcgtgacataaggtttcgcggttcagctcaaa Protospacer
*.*. .. ***** ***** ***********
44. spacer 1.4|2638598|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NC_010635 (Yersinia pseudotuberculosis PB1/+ plasmid pYPTS01, complete sequence) position: , mismatch: 9, identity: 0.719
ttgctctggaaggtgtcgcgtttcagctcaaa CRISPR spacer
tcgtgacataaggtttcgcggttcagctcaaa Protospacer
*.*. .. ***** ***** ***********
45. spacer 1.4|2638598|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009779 (Yersinia pseudotuberculosis PB1/+ plasmid pYAB, complete sequence) position: , mismatch: 9, identity: 0.719
ttgctctggaaggtgtcgcgtttcagctcaaa CRISPR spacer
tcgtgacataaggtttcgcggttcagctcaaa Protospacer
*.*. .. ***** ***** ***********
46. spacer 1.4|2638598|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009711 (Yersinia pseudotuberculosis IP 32953 strain IP32953 plasmid pYAC_1, complete sequence) position: , mismatch: 9, identity: 0.719
ttgctctggaaggtgtcgcgtttcagctcaaa CRISPR spacer
tcgtgacataaggtttcgcggttcagctcaaa Protospacer
*.*. .. ***** ***** ***********
47. spacer 1.4|2638598|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009366 (Yersinia enterocolitica strain WA plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
ttgctctggaaggtgtcgcgtttcagctcaaa CRISPR spacer
tcgtgacataaggtttcgcggttcagctcaaa Protospacer
*.*. .. ***** ***** ***********
48. spacer 1.4|2638598|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009713 (Yersinia pestis Pestoides F plasmid pCD, complete sequence) position: , mismatch: 9, identity: 0.719
ttgctctggaaggtgtcgcgtttcagctcaaa CRISPR spacer
tcgtgacataaggtttcgcggttcagctcaaa Protospacer
*.*. .. ***** ***** ***********
49. spacer 1.4|2638598|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009703 (Yersinia pestis strain Harbin35 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
ttgctctggaaggtgtcgcgtttcagctcaaa CRISPR spacer
tcgtgacataaggtttcgcggttcagctcaaa Protospacer
*.*. .. ***** ***** ***********
50. spacer 1.4|2638598|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009783 (Yersinia pestis strain El Dorado plasmid pCD, complete sequence) position: , mismatch: 9, identity: 0.719
ttgctctggaaggtgtcgcgtttcagctcaaa CRISPR spacer
tcgtgacataaggtttcgcggttcagctcaaa Protospacer
*.*. .. ***** ***** ***********
51. spacer 1.4|2638598|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009721 (Yersinia pestis strain Shasta plasmid pCD, complete sequence) position: , mismatch: 9, identity: 0.719
ttgctctggaaggtgtcgcgtttcagctcaaa CRISPR spacer
tcgtgacataaggtttcgcggttcagctcaaa Protospacer
*.*. .. ***** ***** ***********
52. spacer 1.4|2638598|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045260 (Yersinia pestis strain SCPM-O-B-5942 (I-2638) plasmid pCD, complete sequence) position: , mismatch: 9, identity: 0.719
ttgctctggaaggtgtcgcgtttcagctcaaa CRISPR spacer
tcgtgacataaggtttcgcggttcagctcaaa Protospacer
*.*. .. ***** ***** ***********
53. spacer 1.4|2638598|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033695 (Yersinia pestis strain FDAARGOS_602 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
ttgctctggaaggtgtcgcgtttcagctcaaa CRISPR spacer
tcgtgacataaggtttcgcggttcagctcaaa Protospacer
*.*. .. ***** ***** ***********
54. spacer 1.4|2638598|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NC_009377 (Yersinia pestis Pestoides F plasmid CD, complete sequence) position: , mismatch: 9, identity: 0.719
ttgctctggaaggtgtcgcgtttcagctcaaa CRISPR spacer
tcgtgacataaggtttcgcggttcagctcaaa Protospacer
*.*. .. ***** ***** ***********
55. spacer 1.4|2638598|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NC_014017 (Yersinia pestis Z176003 plasmid pCD1, complete sequence) position: , mismatch: 9, identity: 0.719
ttgctctggaaggtgtcgcgtttcagctcaaa CRISPR spacer
tcgtgacataaggtttcgcggttcagctcaaa Protospacer
*.*. .. ***** ***** ***********
56. spacer 1.4|2638598|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NC_017263 (Yersinia pestis biovar Medievalis str. Harbin 35 plasmid pCD, complete sequence) position: , mismatch: 9, identity: 0.719
ttgctctggaaggtgtcgcgtttcagctcaaa CRISPR spacer
tcgtgacataaggtttcgcggttcagctcaaa Protospacer
*.*. .. ***** ***** ***********
57. spacer 1.4|2638598|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033697 (Yersinia pestis strain FDAARGOS_601 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
ttgctctggaaggtgtcgcgtttcagctcaaa CRISPR spacer
tcgtgacataaggtttcgcggttcagctcaaa Protospacer
*.*. .. ***** ***** ***********
58. spacer 1.4|2638598|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033712 (Yersinia pseudotuberculosis strain FDAARGOS_581 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
ttgctctggaaggtgtcgcgtttcagctcaaa CRISPR spacer
tcgtgacataaggtttcgcggttcagctcaaa Protospacer
*.*. .. ***** ***** ***********
59. spacer 1.4|2638598|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033714 (Yersinia pseudotuberculosis strain FDAARGOS_580 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
ttgctctggaaggtgtcgcgtttcagctcaaa CRISPR spacer
tcgtgacataaggtttcgcggttcagctcaaa Protospacer
*.*. .. ***** ***** ***********
60. spacer 1.4|2638598|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016936 (Yersinia enterocolitica strain YE7 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
ttgctctggaaggtgtcgcgtttcagctcaaa CRISPR spacer
tcgtgacataaggtttcgcggttcagctcaaa Protospacer
*.*. .. ***** ***** ***********
61. spacer 1.4|2638598|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032567 (Yersinia pseudotuberculosis strain IP2666pIB1 plasmid pIB1, complete sequence) position: , mismatch: 9, identity: 0.719
ttgctctggaaggtgtcgcgtttcagctcaaa CRISPR spacer
tcgtgacataaggtttcgcggttcagctcaaa Protospacer
*.*. .. ***** ***** ***********
62. spacer 1.4|2638598|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NC_005017 (Yersinia enterocolitica 8081 plasmid pYVe8081, complete sequence) position: , mismatch: 9, identity: 0.719
ttgctctggaaggtgtcgcgtttcagctcaaa CRISPR spacer
tcgtgacataaggtttcgcggttcagctcaaa Protospacer
*.*. .. ***** ***** ***********
63. spacer 1.4|2638598|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033708 (Yersinia pseudotuberculosis strain FDAARGOS_583 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
ttgctctggaaggtgtcgcgtttcagctcaaa CRISPR spacer
tcgtgacataaggtttcgcggttcagctcaaa Protospacer
*.*. .. ***** ***** ***********
64. spacer 1.4|2638598|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045147 (Yersinia pestis strain SCPM-O-B-6899 (231) plasmid pCD, complete sequence) position: , mismatch: 9, identity: 0.719
ttgctctggaaggtgtcgcgtttcagctcaaa CRISPR spacer
tcgtgacataaggtttcgcggttcagctcaaa Protospacer
*.*. .. ***** ***** ***********
65. spacer 1.4|2638598|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045156 (Yersinia pestis strain SCPM-O-B-5935 (I-1996) plasmid pCD, complete sequence) position: , mismatch: 9, identity: 0.719
ttgctctggaaggtgtcgcgtttcagctcaaa CRISPR spacer
tcgtgacataaggtttcgcggttcagctcaaa Protospacer
*.*. .. ***** ***** ***********
66. spacer 1.4|2638598|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045160 (Yersinia pestis subsp. pestis bv. Medievalis strain SCPM-O-B-6530 plasmid pCD, complete sequence) position: , mismatch: 9, identity: 0.719
ttgctctggaaggtgtcgcgtttcagctcaaa CRISPR spacer
tcgtgacataaggtttcgcggttcagctcaaa Protospacer
*.*. .. ***** ***** ***********
67. spacer 1.4|2638598|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP006747 (Yersinia pestis 8787 plasmid pCD1, complete sequence) position: , mismatch: 9, identity: 0.719
ttgctctggaaggtgtcgcgtttcagctcaaa CRISPR spacer
tcgtgacataaggtttcgcggttcagctcaaa Protospacer
*.*. .. ***** ***** ***********
68. spacer 1.4|2638598|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009972 (Yersinia pestis CO92 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
ttgctctggaaggtgtcgcgtttcagctcaaa CRISPR spacer
tcgtgacataaggtttcgcggttcagctcaaa Protospacer
*.*. .. ***** ***** ***********
69. spacer 1.4|2638598|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NC_003131 (Yersinia pestis CO92 plasmid pCD1, complete sequence) position: , mismatch: 9, identity: 0.719
ttgctctggaaggtgtcgcgtttcagctcaaa CRISPR spacer
tcgtgacataaggtttcgcggttcagctcaaa Protospacer
*.*. .. ***** ***** ***********
70. spacer 1.4|2638598|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045151 (Yersinia pestis strain SCPM-O-DNA-18 (I-3113) plasmid pCD, complete sequence) position: , mismatch: 9, identity: 0.719
ttgctctggaaggtgtcgcgtttcagctcaaa CRISPR spacer
tcgtgacataaggtttcgcggttcagctcaaa Protospacer
*.*. .. ***** ***** ***********
71. spacer 1.4|2638598|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP006791 (Yersinia pestis 2944 plasmid pCD, complete sequence) position: , mismatch: 9, identity: 0.719
ttgctctggaaggtgtcgcgtttcagctcaaa CRISPR spacer
tcgtgacataaggtttcgcggttcagctcaaa Protospacer
*.*. .. ***** ***** ***********
72. spacer 1.4|2638598|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP006750 (Yersinia pestis 3770 plasmid pCD1, complete sequence) position: , mismatch: 9, identity: 0.719
ttgctctggaaggtgtcgcgtttcagctcaaa CRISPR spacer
tcgtgacataaggtttcgcggttcagctcaaa Protospacer
*.*. .. ***** ***** ***********
73. spacer 1.4|2638598|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP006757 (Yersinia pestis 1522 plasmid pCD, complete sequence) position: , mismatch: 9, identity: 0.719
ttgctctggaaggtgtcgcgtttcagctcaaa CRISPR spacer
tcgtgacataaggtttcgcggttcagctcaaa Protospacer
*.*. .. ***** ***** ***********
74. spacer 1.4|2638598|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LT596222 (Yersinia pseudotuberculosis isolate NZYP4713 plasmid 2) position: , mismatch: 9, identity: 0.719
ttgctctggaaggtgtcgcgtttcagctcaaa CRISPR spacer
tcgtgacataaggtttcgcggttcagctcaaa Protospacer
*.*. .. ***** ***** ***********
75. spacer 1.4|2638598|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033710 (Yersinia pseudotuberculosis strain FDAARGOS_582 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
ttgctctggaaggtgtcgcgtttcagctcaaa CRISPR spacer
tcgtgacataaggtttcgcggttcagctcaaa Protospacer
*.*. .. ***** ***** ***********
76. spacer 1.4|2638598|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NC_017157 (Yersinia pestis D182038 plasmid pCD1, complete sequence) position: , mismatch: 9, identity: 0.719
ttgctctggaaggtgtcgcgtttcagctcaaa CRISPR spacer
tcgtgacataaggtttcgcggttcagctcaaa Protospacer
*.*. .. ***** ***** ***********
77. spacer 1.4|2638598|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NC_017153 (Yersinia pestis D106004 plasmid pCD1, complete sequence) position: , mismatch: 9, identity: 0.719
ttgctctggaaggtgtcgcgtttcagctcaaa CRISPR spacer
tcgtgacataaggtttcgcggttcagctcaaa Protospacer
*.*. .. ***** ***** ***********
78. spacer 1.4|2638598|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016943 (Yersinia enterocolitica strain YE3 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
ttgctctggaaggtgtcgcgtttcagctcaaa CRISPR spacer
tcgtgacataaggtttcgcggttcagctcaaa Protospacer
*.*. .. ***** ***** ***********
79. spacer 1.4|2638598|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033716 (Yersinia pseudotuberculosis strain FDAARGOS_579 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
ttgctctggaaggtgtcgcgtttcagctcaaa CRISPR spacer
tcgtgacataaggtttcgcggttcagctcaaa Protospacer
*.*. .. ***** ***** ***********
80. spacer 1.4|2638598|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NC_002120 (Yersinia enterocolitica W22703 plasmid pYVe227, complete sequence) position: , mismatch: 9, identity: 0.719
ttgctctggaaggtgtcgcgtttcagctcaaa CRISPR spacer
tcgtgacataaggtttcgcggttcagctcaaa Protospacer
*.*. .. ***** ***** ***********
81. spacer 1.4|2638598|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NC_004839 (Yersinia pestis strain KIM5 plasmid pCD1, complete sequence) position: , mismatch: 9, identity: 0.719
ttgctctggaaggtgtcgcgtttcagctcaaa CRISPR spacer
tcgtgacataaggtttcgcggttcagctcaaa Protospacer
*.*. .. ***** ***** ***********
82. spacer 1.4|2638598|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016939 (Yersinia enterocolitica strain YE5 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
ttgctctggaaggtgtcgcgtttcagctcaaa CRISPR spacer
tcgtgacataaggtttcgcggttcagctcaaa Protospacer
*.*. .. ***** ***** ***********
83. spacer 1.4|2638598|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016933 (Yersinia enterocolitica strain YE165 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
ttgctctggaaggtgtcgcgtttcagctcaaa CRISPR spacer
tcgtgacataaggtttcgcggttcagctcaaa Protospacer
*.*. .. ***** ***** ***********
84. spacer 1.4|2638598|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033689 (Yersinia pestis strain FDAARGOS_603 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
ttgctctggaaggtgtcgcgtttcagctcaaa CRISPR spacer
tcgtgacataaggtttcgcggttcagctcaaa Protospacer
*.*. .. ***** ***** ***********
85. spacer 1.4|2638598|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP006761 (Yersinia pestis 1413 plasmid pCD, complete sequence) position: , mismatch: 9, identity: 0.719
ttgctctggaaggtgtcgcgtttcagctcaaa CRISPR spacer
tcgtgacataaggtttcgcggttcagctcaaa Protospacer
*.*. .. ***** ***** ***********
86. spacer 1.4|2638598|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NC_004564 (Yersinia enterocolitica plasmid pYVa127/90, complete sequence) position: , mismatch: 9, identity: 0.719
ttgctctggaaggtgtcgcgtttcagctcaaa CRISPR spacer
tcgtgacataaggtttcgcggttcagctcaaa Protospacer
*.*. .. ***** ***** ***********
87. spacer 1.4|2638598|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP006780 (Yersinia pestis 1412 plasmid pCD, complete sequence) position: , mismatch: 9, identity: 0.719
ttgctctggaaggtgtcgcgtttcagctcaaa CRISPR spacer
tcgtgacataaggtttcgcggttcagctcaaa Protospacer
*.*. .. ***** ***** ***********
88. spacer 1.4|2638598|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP006753 (Yersinia pestis 3067 plasmid pCD1, complete sequence) position: , mismatch: 9, identity: 0.719
ttgctctggaaggtgtcgcgtttcagctcaaa CRISPR spacer
tcgtgacataaggtttcgcggttcagctcaaa Protospacer
*.*. .. ***** ***** ***********
89. spacer 1.4|2638598|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016274 (Yersinia pestis strain Cadman plasmid pCD1, complete sequence) position: , mismatch: 9, identity: 0.719
ttgctctggaaggtgtcgcgtttcagctcaaa CRISPR spacer
tcgtgacataaggtttcgcggttcagctcaaa Protospacer
*.*. .. ***** ***** ***********
90. spacer 1.4|2638598|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019710 (Yersinia pestis strain 195/P plasmid pCD1, complete sequence) position: , mismatch: 9, identity: 0.719
ttgctctggaaggtgtcgcgtttcagctcaaa CRISPR spacer
tcgtgacataaggtttcgcggttcagctcaaa Protospacer
*.*. .. ***** ***** ***********
91. spacer 1.4|2638598|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NC_019234 (Yersinia enterocolitica (type O:8) plasmid pYV-WA314, complete sequence) position: , mismatch: 9, identity: 0.719
ttgctctggaaggtgtcgcgtttcagctcaaa CRISPR spacer
tcgtgacataaggtttcgcggttcagctcaaa Protospacer
*.*. .. ***** ***** ***********
92. spacer 1.4|2638598|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009905 (Yersinia pestis Antiqua plasmid pCD, complete sequence) position: , mismatch: 9, identity: 0.719
ttgctctggaaggtgtcgcgtttcagctcaaa CRISPR spacer
tcgtgacataaggtttcgcggttcagctcaaa Protospacer
*.*. .. ***** ***** ***********
93. spacer 1.4|2638598|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP011287 (Yersinia enterocolitica strain KNG22703 plasmid, complete sequence) position: , mismatch: 9, identity: 0.719
ttgctctggaaggtgtcgcgtttcagctcaaa CRISPR spacer
tcgtgacataaggtttcgcggttcagctcaaa Protospacer
*.*. .. ***** ***** ***********
94. spacer 1.4|2638598|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009990 (Yersinia pestis strain Nicholisk 41 plasmid 2, complete sequence) position: , mismatch: 9, identity: 0.719
ttgctctggaaggtgtcgcgtttcagctcaaa CRISPR spacer
tcgtgacataaggtttcgcggttcagctcaaa Protospacer
*.*. .. ***** ***** ***********
95. spacer 1.4|2638598|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009937 (Yersinia pestis Angola plasmid pCD, complete sequence) position: , mismatch: 9, identity: 0.719
ttgctctggaaggtgtcgcgtttcagctcaaa CRISPR spacer
tcgtgacataaggtttcgcggttcagctcaaa Protospacer
*.*. .. ***** ***** ***********
96. spacer 1.4|2638598|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NC_017565 (Yersinia enterocolitica subsp. palearctica Y11 plasmid pYV03, complete sequence) position: , mismatch: 9, identity: 0.719
ttgctctggaaggtgtcgcgtttcagctcaaa CRISPR spacer
tcgtgacataaggtttcgcggttcagctcaaa Protospacer
*.*. .. ***** ***** ***********
97. spacer 1.4|2638598|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009842 (Yersinia pestis strain Dodson plasmid pCD, complete sequence) position: , mismatch: 9, identity: 0.719
ttgctctggaaggtgtcgcgtttcagctcaaa CRISPR spacer
tcgtgacataaggtttcgcggttcagctcaaa Protospacer
*.*. .. ***** ***** ***********
98. spacer 1.4|2638598|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009837 (Yersinia enterocolitica strain 2516-87 plasmid pCD, complete sequence) position: , mismatch: 9, identity: 0.719
ttgctctggaaggtgtcgcgtttcagctcaaa CRISPR spacer
tcgtgacataaggtttcgcggttcagctcaaa Protospacer
*.*. .. ***** ***** ***********
99. spacer 1.4|2638598|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010069 (Yersinia pseudotuberculosis str. PA3606 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
ttgctctggaaggtgtcgcgtttcagctcaaa CRISPR spacer
tcgtgacataaggtttcgcggttcagctcaaa Protospacer
*.*. .. ***** ***** ***********
100. spacer 1.4|2638598|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010246 (Yersinia pestis Pestoides G plasmid pCD, complete sequence) position: , mismatch: 9, identity: 0.719
ttgctctggaaggtgtcgcgtttcagctcaaa CRISPR spacer
tcgtgacataaggtttcgcggttcagctcaaa Protospacer
*.*. .. ***** ***** ***********
101. spacer 1.4|2638598|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010022 (Yersinia pestis str. Pestoides B plasmid pCD, complete sequence) position: , mismatch: 9, identity: 0.719
ttgctctggaaggtgtcgcgtttcagctcaaa CRISPR spacer
tcgtgacataaggtttcgcggttcagctcaaa Protospacer
*.*. .. ***** ***** ***********
102. spacer 1.4|2638598|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NC_015056 (Yersinia pestis Java 9 plasmid pCD, complete sequence) position: , mismatch: 9, identity: 0.719
ttgctctggaaggtgtcgcgtttcagctcaaa CRISPR spacer
tcgtgacataaggtttcgcggttcagctcaaa Protospacer
*.*. .. ***** ***** ***********
103. spacer 1.4|2638598|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NC_015475 (Yersinia enterocolitica subsp. palearctica 105.5R(r) plasmid 105.5R(r)p, complete sequence) position: , mismatch: 9, identity: 0.719
ttgctctggaaggtgtcgcgtttcagctcaaa CRISPR spacer
tcgtgacataaggtttcgcggttcagctcaaa Protospacer
*.*. .. ***** ***** ***********
104. spacer 1.4|2638598|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NC_008791 (Yersinia enterocolitica subsp. enterocolitica 8081 plasmid pYVe8081, complete sequence) position: , mismatch: 9, identity: 0.719
ttgctctggaaggtgtcgcgtttcagctcaaa CRISPR spacer
tcgtgacataaggtttcgcggttcagctcaaa Protospacer
*.*. .. ***** ***** ***********
105. spacer 1.9|2638903|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NC_018696 (Paraburkholderia phenoliruptrix BR3459a plasmid pSYMBR3459, complete sequence) position: , mismatch: 9, identity: 0.719
tttgccgtcaaaagccatttgctcgatcaggg CRISPR spacer
caagccggaaaaagccatttgctcgacccacg Protospacer
. **** *****************.* . *
106. spacer 1.11|2639026|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to CP001770 (Spirosoma linguale DSM 74 plasmid pSLIN01, complete sequence) position: , mismatch: 9, identity: 0.719
atcacctgctggcacctggccaaaaactacgg CRISPR spacer
ctggcgggctggcaactggccgaaaactacca Protospacer
* .* ******* ******.******** .
107. spacer 1.17|2639392|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044283 (Rhodococcus erythropolis strain X5 plasmid pRhX5, complete sequence) position: , mismatch: 9, identity: 0.719
gcgccggatccggagcgtagccgcttgacccg CRISPR spacer
gcgcccgatccggatcgtagccgtatcgatca Protospacer
***** ******** ********. * . .*.
108. spacer 1.21|2639636|32|NC_010814|CRISPRCasFinder,CRT matches to AP014106 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C34-MedDCM-OCT-S43-C23, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 9, identity: 0.719
tatgtagcaaaatattattttgattttgcaga CRISPR spacer
caaaatggaaaatattatattaattttgcagt Protospacer
.* . * ********** **.*********
109. spacer 1.22|2639697|32|NC_010814|CRISPRCasFinder,CRT matches to HQ316603 (Cyanophage S-SSM6b genomic sequence) position: , mismatch: 9, identity: 0.719
aagctggatgtaataaaagaaatgttcggaac CRISPR spacer
atcagtgatgtaattaaagaaaagttcggtat Protospacer
* ******** ******* ****** *.
110. spacer 1.22|2639697|32|NC_010814|CRISPRCasFinder,CRT matches to NC_020875 (Cyanophage S-SSM4 genomic sequence) position: , mismatch: 9, identity: 0.719
aagctggatgtaataaaagaaatgttcggaac CRISPR spacer
atcagtgatgtaattaaagaaaagttcggtat Protospacer
* ******** ******* ****** *.
111. spacer 1.25|2639880|32|NC_010814|CRISPRCasFinder,CRT matches to JF937098 (Mycobacterium virus Ibhubesi, complete genome) position: , mismatch: 9, identity: 0.719
ggcccatagcctttttccatgctgccggacgt CRISPR spacer
cggccatagcctttttccaggctgtcgacaaa Protospacer
* **************** ****.**. .
112. spacer 1.30|2640185|32|NC_010814|CRISPRCasFinder,CRT matches to KY744229 (Sulfolobus islandicus rod-shaped virus 8, partial genome) position: , mismatch: 9, identity: 0.719
taaaggagaagaaagacatgatagagacaagg CRISPR spacer
taaaggaggagaaagatatgatataatggtga Protospacer
********.*******.****** *. . *.
113. spacer 1.30|2640185|32|NC_010814|CRISPRCasFinder,CRT matches to KY744228 (Sulfolobus islandicus rod-shaped virus 9, partial genome) position: , mismatch: 9, identity: 0.719
taaaggagaagaaagacatgatagagacaagg CRISPR spacer
taaaggaggagaaagatatgatataatggtga Protospacer
********.*******.****** *. . *.
114. spacer 1.32|2640307|32|NC_010814|CRISPRCasFinder,CRT matches to NC_008271 (Rhodococcus jostii RHA1 plasmid pRHL3, complete sequence) position: , mismatch: 9, identity: 0.719
ttttcgtccgtggtcggatttccgatgccggt CRISPR spacer
atttcgtccgtggtcggatacccgaggggacc Protospacer
****************** .**** * . .
115. spacer 1.33|2640368|32|NC_010814|CRISPRCasFinder,CRT matches to NZ_CP045385 (Ruegeria sp. THAF33 plasmid pTHAF33_a, complete sequence) position: , mismatch: 9, identity: 0.719
ctgtcggcaaaccgtccggcaatgtcagcggc CRISPR spacer
aacgccgcaaacggtccggcaatgtctgctgt Protospacer
* ****** ************* ** *.
116. spacer 1.35|2640490|32|NC_010814|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP038854 (Pantoea vagans strain LMG 24199 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
gcggcgagactgacgcaaaggccagtttcgac CRISPR spacer
cctgtatccctgatgcacaggccagtttcgac Protospacer
* *.. ****.*** **************
117. spacer 1.35|2640490|32|NC_010814|CRISPRCasFinder,CRT,PILER-CR matches to KY087993 (Mycobacterium phage Hammy, complete genome) position: , mismatch: 9, identity: 0.719
gcggcgagactgacgcaaaggccagtttcgac CRISPR spacer
gcggcgagactgacgcaagcgccccggctggc Protospacer
******************. *** ..*.*
118. spacer 1.36|2640551|32|NC_010814|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026278 (Klebsiella oxytoca strain KONIH2 plasmid pKOR-0e8e, complete sequence) position: , mismatch: 9, identity: 0.719
atcatggtatatgctccttttgctttgaagtt CRISPR spacer
tttatcgtatatgctcattttgcttttatccc Protospacer
*.** ********** ********* * ..
119. spacer 1.36|2640551|32|NC_010814|CRISPRCasFinder,CRT,PILER-CR matches to MK448228 (Klebsiella phage ST15-VIM1phi2.1, complete genome) position: , mismatch: 9, identity: 0.719
atcatggtatatgctccttttgctttgaagtt CRISPR spacer
tttatcgtatatgctcattttgcttttatccc Protospacer
*.** ********** ********* * ..
120. spacer 1.36|2640551|32|NC_010814|CRISPRCasFinder,CRT,PILER-CR matches to MN098327 (Klebsiella phage Mulock, complete genome) position: , mismatch: 9, identity: 0.719
atcatggtatatgctccttttgctttgaagtt CRISPR spacer
tttatcgtatatgctcattttgcttttatccc Protospacer
*.** ********** ********* * ..
121. spacer 1.36|2640551|32|NC_010814|CRISPRCasFinder,CRT,PILER-CR matches to MK448233 (Klebsiella phage ST11-VIM1phi8.1, complete genome) position: , mismatch: 9, identity: 0.719
atcatggtatatgctccttttgctttgaagtt CRISPR spacer
tttatcgtatatgctcattttgcttttatccc Protospacer
*.** ********** ********* * ..
122. spacer 1.36|2640551|32|NC_010814|CRISPRCasFinder,CRT,PILER-CR matches to MK448235 (Klebsiella phage ST512-KPC3phi13.1, complete genome) position: , mismatch: 9, identity: 0.719
atcatggtatatgctccttttgctttgaagtt CRISPR spacer
tttatcgtatatgctcattttgcttttatccc Protospacer
*.** ********** ********* * ..
123. spacer 1.41|2640856|32|NC_010814|CRISPRCasFinder,CRT,PILER-CR matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.719
cccgtggcgtggttcgatccgctttccacgta CRISPR spacer
atggtggcgtggttcgtgccgctttctgagca Protospacer
. ************* ********.. *.*
124. spacer 1.41|2640856|32|NC_010814|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 9, identity: 0.719
cccgtggcgtggttcgatccgctttccacgta CRISPR spacer
atggtggcgtggttcgtgccgctttctgagca Protospacer
. ************* ********.. *.*
125. spacer 1.9|2638903|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to MN945901 (Mycobacterium phage Ximenita, complete genome) position: , mismatch: 10, identity: 0.688
tttgccgtcaaaagccatttgctcgatcaggg CRISPR spacer
gaggccgtcgaaagccatctgctcgactgcgt Protospacer
******.********.*******... *
126. spacer 1.9|2638903|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to MF324914 (Mycobacterium phage Krueger, complete genome) position: , mismatch: 10, identity: 0.688
tttgccgtcaaaagccatttgctcgatcaggg CRISPR spacer
gaggccgtcgaaagccatctgctcgactgcgt Protospacer
******.********.*******... *
127. spacer 1.9|2638903|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to MN234199 (Mycobacterium phage Ekdilam, complete genome) position: , mismatch: 10, identity: 0.688
tttgccgtcaaaagccatttgctcgatcaggg CRISPR spacer
gaggccgtcgaaagccatctgctcgactgcgt Protospacer
******.********.*******... *
128. spacer 1.9|2638903|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to JX042579 (Mycobacterium virus MacnCheese, complete genome) position: , mismatch: 10, identity: 0.688
tttgccgtcaaaagccatttgctcgatcaggg CRISPR spacer
gaggccgtcgaaagccatctgctcgactgcgt Protospacer
******.********.*******... *
129. spacer 1.13|2639148|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 10, identity: 0.688
ctccagaggcggcagcaatgtttgtgtcgcct CRISPR spacer
cgatccaggcggcagcaatcttcgtgtcgttc Protospacer
* . ************* **.******...
130. spacer 1.15|2639270|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NC_015264 (Pseudomonas phage phiIBB-PF7A, complete genome) position: , mismatch: 10, identity: 0.688
gcaacagcattaccggtggcctcggccagctg CRISPR spacer
tcaacagccttaccggtgccctcgaaccatcc Protospacer
******* ********* *****. * ...
131. spacer 1.17|2639392|32|NC_010814|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688
gcgccggatccggagcgtagccgcttgacccg CRISPR spacer
cggccggacccggagcgcagccgctccgtcac Protospacer
******.********.*******. ..*
132. spacer 1.19|2639514|32|NC_010814|CRISPRCasFinder,CRT matches to NZ_CP033227 (Sphingobium yanoikuyae strain SJTF8 plasmid pF1, complete sequence) position: , mismatch: 10, identity: 0.688
cgggctggcgggatctgttgcaaaggtggttt CRISPR spacer
cggtctggcgggacctgttgcaacacctttcg Protospacer
*** *********.********* . . *.
133. spacer 1.19|2639514|32|NC_010814|CRISPRCasFinder,CRT matches to NZ_CP015989 (Sphingobium sp. EP60837 plasmid pEP2, complete sequence) position: , mismatch: 10, identity: 0.688
cgggctggcgggatctgttgcaaaggtggttt CRISPR spacer
cggtctggcgggacctgttgcaacacctttcg Protospacer
*** *********.********* . . *.
134. spacer 1.19|2639514|32|NC_010814|CRISPRCasFinder,CRT matches to KY653119 (Morganella phage IME1369_02, complete genome) position: , mismatch: 10, identity: 0.688
cgggctggcgggatctgttgcaaaggtggttt CRISPR spacer
gtggctggcgggatctatttcaaagtcacgct Protospacer
**************.** ***** .. .*
135. spacer 1.28|2640063|32|NC_010814|CRISPRCasFinder,CRT matches to NC_015727 (Cupriavidus necator N-1 plasmid pBB1, complete sequence) position: , mismatch: 10, identity: 0.688
taaccgcaatactgcgccagatcggtatgtcg CRISPR spacer
gaaccgcattgctgcgccagatcgccaccaat Protospacer
******* *.************* .*.
136. spacer 1.36|2640551|32|NC_010814|CRISPRCasFinder,CRT,PILER-CR matches to MK448236 (Klebsiella phage ST899-OXA48phi17.1, complete genome) position: , mismatch: 10, identity: 0.688
atcatggtatatgctccttttgctttgaagtt CRISPR spacer
tttatcgtatatgctcattttgcttttctccc Protospacer
*.** ********** ********* ..
137. spacer 1.21|2639636|32|NC_010814|CRISPRCasFinder,CRT matches to NZ_LN906635 (Lactobacillus reuteri plasmid p53608_1, complete genome, strain ATCC 53608) position: , mismatch: 11, identity: 0.656
tatgtagcaaaatattattttgattttgcaga CRISPR spacer
agcaacacaaattattattttgattatgcaat Protospacer
... .**** ************* ****.
