Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_012526 Deinococcus deserti VCD115, complete sequence 1 crisprs cas3,csa3,DEDDh,DinG 0 0 2 0
NC_012528 Deinococcus deserti VCD115 plasmid 3, complete sequence 0 crisprs csa3 0 0 0 0
NC_012529 Deinococcus deserti VCD115 plasmid 2, complete sequence 0 crisprs csa3 0 0 0 0
NC_012527 Deinococcus deserti VCD115 plasmid 1, complete sequence 2 crisprs cas3 0 7 0 0

Results visualization

1. NC_012526
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_012526_1 2805977-2806083 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 256930 : 263409 7 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_2 756756 : 843518 56 Tupanvirus(16.67%) tail,plate,tRNA,integrase,transposase attL 761158:761217|attR 795732:795824
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_012527
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_012527_1 306582-306801 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_012527_2 306979-307233 Orphan NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_012527_1 1.1|306605|40|NC_012527|CRISPRCasFinder 306605-306644 40 NC_012527 Deinococcus deserti VCD115 plasmid 1, complete sequence 306605-306644 0 1.0
NC_012527_1 1.2|306668|43|NC_012527|CRISPRCasFinder 306668-306710 43 NC_012527 Deinococcus deserti VCD115 plasmid 1, complete sequence 306668-306710 0 1.0
NC_012527_1 1.3|306734|44|NC_012527|CRISPRCasFinder 306734-306777 44 NC_012527 Deinococcus deserti VCD115 plasmid 1, complete sequence 306734-306777 0 1.0
NC_012527_2 2.1|307002|32|NC_012527|CRISPRCasFinder 307002-307033 32 NC_012527 Deinococcus deserti VCD115 plasmid 1, complete sequence 307002-307033 0 1.0
NC_012527_2 2.2|307057|43|NC_012527|CRISPRCasFinder 307057-307099 43 NC_012527 Deinococcus deserti VCD115 plasmid 1, complete sequence 307057-307099 0 1.0
NC_012527_2 2.3|307123|23|NC_012527|CRISPRCasFinder 307123-307145 23 NC_012527 Deinococcus deserti VCD115 plasmid 1, complete sequence 307123-307145 0 1.0
NC_012527_2 2.4|307169|42|NC_012527|CRISPRCasFinder 307169-307210 42 NC_012527 Deinococcus deserti VCD115 plasmid 1, complete sequence 307169-307210 0 1.0
NC_012527_2 2.1|307002|32|NC_012527|CRISPRCasFinder 307002-307033 32 NC_012527 Deinococcus deserti VCD115 plasmid 1, complete sequence 307202-307233 7 0.781

1. spacer 1.1|306605|40|NC_012527|CRISPRCasFinder matches to NC_012527 (Deinococcus deserti VCD115 plasmid 1, complete sequence) position: , mismatch: 0, identity: 1.0

tcttctcataggtcgctgtgaatccttcccaacatgactc	CRISPR spacer
tcttctcataggtcgctgtgaatccttcccaacatgactc	Protospacer
****************************************

2. spacer 1.2|306668|43|NC_012527|CRISPRCasFinder matches to NC_012527 (Deinococcus deserti VCD115 plasmid 1, complete sequence) position: , mismatch: 0, identity: 1.0

cagtgtaaagacaccctcctgatgaggtgagttctcggctttg	CRISPR spacer
cagtgtaaagacaccctcctgatgaggtgagttctcggctttg	Protospacer
*******************************************

3. spacer 1.3|306734|44|NC_012527|CRISPRCasFinder matches to NC_012527 (Deinococcus deserti VCD115 plasmid 1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtacgaaacggttctgttggacggatacaaaccacacgggcat	CRISPR spacer
tgtacgaaacggttctgttggacggatacaaaccacacgggcat	Protospacer
********************************************

4. spacer 2.1|307002|32|NC_012527|CRISPRCasFinder matches to NC_012527 (Deinococcus deserti VCD115 plasmid 1, complete sequence) position: , mismatch: 0, identity: 1.0

accattccagacgacgacatacctgagcgatt	CRISPR spacer
accattccagacgacgacatacctgagcgatt	Protospacer
********************************

5. spacer 2.2|307057|43|NC_012527|CRISPRCasFinder matches to NC_012527 (Deinococcus deserti VCD115 plasmid 1, complete sequence) position: , mismatch: 0, identity: 1.0

gccctggctgcgtcggcgacacacttgagtaatgttggaaagc	CRISPR spacer
gccctggctgcgtcggcgacacacttgagtaatgttggaaagc	Protospacer
*******************************************

6. spacer 2.3|307123|23|NC_012527|CRISPRCasFinder matches to NC_012527 (Deinococcus deserti VCD115 plasmid 1, complete sequence) position: , mismatch: 0, identity: 1.0

aatggcgacatacctgagcggtt	CRISPR spacer
aatggcgacatacctgagcggtt	Protospacer
***********************

7. spacer 2.4|307169|42|NC_012527|CRISPRCasFinder matches to NC_012527 (Deinococcus deserti VCD115 plasmid 1, complete sequence) position: , mismatch: 0, identity: 1.0

cgccagcggtcctgcgacacacctgagcgatttgtgcgtcaa	CRISPR spacer
cgccagcggtcctgcgacacacctgagcgatttgtgcgtcaa	Protospacer
******************************************

8. spacer 2.1|307002|32|NC_012527|CRISPRCasFinder matches to NC_012527 (Deinococcus deserti VCD115 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.781

accattccagacgacgacatacctgagcgatt	CRISPR spacer
gtgcgtcaagacgacgacatacttgagcgatt	Protospacer
..   ** **************.*********

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage