Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_011204 Salmonella enterica subsp. enterica serovar Dublin str. CT_02021853 plasmid pCT02021853_74, complete sequence 0 crisprs cas14j 0 0 0 0
NC_011205 Salmonella enterica subsp. enterica serovar Dublin str. CT_02021853, complete sequence 2 crisprs WYL,DinG,DEDDh,cas3,csa3,cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,PD-DExK 0 4 9 0

Results visualization

1. NC_011205
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_011205_1 3121103-3121251 TypeI-E I-E
2 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_011205_2 3137409-3137742 TypeI-E I-E
5 spacers
cas8e,cse2gr11,cas7,cas5

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_011205_1 1.2|3121194|31|NC_011205|PILER-CR 3121194-3121224 31 KM507819 Escherichia phage 121Q, complete genome 157385-157415 8 0.742
NC_011205_2 2.3|3137560|32|NC_011205|CRISPRCasFinder 3137560-3137591 32 MG592432 Vibrio phage 1.050.O._10N.286.48.A6, partial genome 21687-21718 8 0.75
NC_011205_2 2.3|3137560|32|NC_011205|CRISPRCasFinder 3137560-3137591 32 MG592431 Vibrio phage 1.049.O._10N.286.54.B5, partial genome 21426-21457 8 0.75
NC_011205_2 2.4|3137621|32|NC_011205|CRISPRCasFinder 3137621-3137652 32 MG592432 Vibrio phage 1.050.O._10N.286.48.A6, partial genome 21687-21718 8 0.75
NC_011205_2 2.4|3137621|32|NC_011205|CRISPRCasFinder 3137621-3137652 32 MG592431 Vibrio phage 1.049.O._10N.286.54.B5, partial genome 21426-21457 8 0.75
NC_011205_1 1.1|3121133|31|NC_011205|PILER-CR 3121133-3121163 31 NZ_MG266000 Clostridioides difficile strain 7032985 plasmid pCD-ISS1, complete sequence 5501-5531 9 0.71
NC_011205_1 1.2|3121194|31|NC_011205|PILER-CR 3121194-3121224 31 NC_028822 Escherichia phage P483, complete genome 30080-30110 9 0.71
NC_011205_2 2.3|3137560|32|NC_011205|CRISPRCasFinder 3137560-3137591 32 NC_047790 Pseudoalteromonas phage C5a, complete genome 34441-34472 9 0.719
NC_011205_2 2.4|3137621|32|NC_011205|CRISPRCasFinder 3137621-3137652 32 NC_047790 Pseudoalteromonas phage C5a, complete genome 34441-34472 9 0.719

1. spacer 1.2|3121194|31|NC_011205|PILER-CR matches to KM507819 (Escherichia phage 121Q, complete genome) position: , mismatch: 8, identity: 0.742

ggatttttcttgaacgtgatttcgggatacg	CRISPR spacer
ggttttttcttgaacttgatttctcagtgca	Protospacer
** ************ *******  ..*.*.

2. spacer 2.3|3137560|32|NC_011205|CRISPRCasFinder matches to MG592432 (Vibrio phage 1.050.O._10N.286.48.A6, partial genome) position: , mismatch: 8, identity: 0.75

tgattattgacgacaacagcacagaccggcag	CRISPR spacer
ttataattgactacaacagcacagagcagatt	Protospacer
* ** ****** ************* *.*   

3. spacer 2.3|3137560|32|NC_011205|CRISPRCasFinder matches to MG592431 (Vibrio phage 1.049.O._10N.286.54.B5, partial genome) position: , mismatch: 8, identity: 0.75

tgattattgacgacaacagcacagaccggcag	CRISPR spacer
ttataattgactacaacagcacagagcagatt	Protospacer
* ** ****** ************* *.*   

4. spacer 2.4|3137621|32|NC_011205|CRISPRCasFinder matches to MG592432 (Vibrio phage 1.050.O._10N.286.48.A6, partial genome) position: , mismatch: 8, identity: 0.75

tgattattgacgacaacagcacagaccggcag	CRISPR spacer
ttataattgactacaacagcacagagcagatt	Protospacer
* ** ****** ************* *.*   

5. spacer 2.4|3137621|32|NC_011205|CRISPRCasFinder matches to MG592431 (Vibrio phage 1.049.O._10N.286.54.B5, partial genome) position: , mismatch: 8, identity: 0.75

tgattattgacgacaacagcacagaccggcag	CRISPR spacer
ttataattgactacaacagcacagagcagatt	Protospacer
* ** ****** ************* *.*   

6. spacer 1.1|3121133|31|NC_011205|PILER-CR matches to NZ_MG266000 (Clostridioides difficile strain 7032985 plasmid pCD-ISS1, complete sequence) position: , mismatch: 9, identity: 0.71

tatttataagcgtgtcatctatgcaacccaa	CRISPR spacer
aatttataatcatgtcatctatgccataatt	Protospacer
 ******** *.************ *.    

7. spacer 1.2|3121194|31|NC_011205|PILER-CR matches to NC_028822 (Escherichia phage P483, complete genome) position: , mismatch: 9, identity: 0.71

ggatttttcttgaacgtgatttcgggatacg	CRISPR spacer
ggatttgtcttgaatgtgatttccatgatgg	Protospacer
****** *******.******** . .   *

8. spacer 2.3|3137560|32|NC_011205|CRISPRCasFinder matches to NC_047790 (Pseudoalteromonas phage C5a, complete genome) position: , mismatch: 9, identity: 0.719

tgattattgacgacaacagcacagaccggcag	CRISPR spacer
agcttattgacgaaaacggcacagacaccaaa	Protospacer
 * ********** ***.********    *.

9. spacer 2.4|3137621|32|NC_011205|CRISPRCasFinder matches to NC_047790 (Pseudoalteromonas phage C5a, complete genome) position: , mismatch: 9, identity: 0.719

tgattattgacgacaacagcacagaccggcag	CRISPR spacer
agcttattgacgaaaacggcacagacaccaaa	Protospacer
 * ********** ***.********    *.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 602552 : 662714 78 Salmonella_phage(66.15%) holin,integrase,coat,terminase,tRNA,portal,protease,lysis attL 617006:617046|attR 663008:663048
DBSCAN-SWA_2 1000021 : 1007334 7 Dickeya_phage(16.67%) protease,integrase attL 1001272:1001286|attR 1012265:1012279
DBSCAN-SWA_3 1078186 : 1138734 63 Salmonella_phage(48.78%) plate,holin,tail,terminase,protease NA
DBSCAN-SWA_4 1351455 : 1427644 82 Enterobacteria_phage(25.0%) holin,integrase,tail,terminase,portal,protease,lysis attL 1352536:1352565|attR 1400267:1400296
DBSCAN-SWA_5 2143448 : 2195582 64 Salmonella_phage(83.64%) plate,capsid,holin,integrase,head,tail,terminase,transposase,portal attL 2171349:2171363|attR 2191669:2191683
DBSCAN-SWA_6 2302577 : 2313084 10 Enterobacteria_phage(37.5%) NA NA
DBSCAN-SWA_7 2380282 : 2389453 10 Enterobacteria_phage(66.67%) tRNA NA
DBSCAN-SWA_8 2625971 : 2632010 6 Salmonella_virus(50.0%) NA NA
DBSCAN-SWA_9 2861084 : 2959989 92 Salmonella_phage(70.0%) plate,capsid,integrase,head,tail,terminase,transposase,tRNA,portal,lysis attL 2931269:2931287|attR 2975596:2975614
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage