Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_011370 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG203, complete sequence 0 crisprs NA 0 0 0 0
NC_011371 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG204, complete sequence 0 crisprs NA 0 0 0 0
NC_011369 Rhizobium leguminosarum bv. trifolii WSM2304, complete sequence 3 crisprs cas3,csa3,WYL,DEDDh 0 1 6 0
NC_011368 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence 0 crisprs csa3 0 0 0 0
NC_011366 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG202, complete sequence 0 crisprs DEDDh,csa3,WYL 0 0 0 0

Results visualization

1. NC_011369
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_011369_1 562025-562107 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_011369_2 1525879-1525984 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_011369_3 1538408-1538493 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_011369_2 2.1|1525903|58|NC_011369|CRISPRCasFinder 1525903-1525960 58 NZ_CP020951 Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence 215728-215785 6 0.897

1. spacer 2.1|1525903|58|NC_011369|CRISPRCasFinder matches to NZ_CP020951 (Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence) position: , mismatch: 6, identity: 0.897

cgcggttttcccaggcaaagcgcgaagcgcttttgccgcaacgacatgcgcaaaaacc	CRISPR spacer
agcggttttgccaggcaaagcgcgaagcgcttttgccgcaacgacatgcgtaaaacaa	Protospacer
 ******** ****************************************.****   

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1188556 : 1197620 9 Aeromonas_phage(14.29%) NA NA
DBSCAN-SWA_2 1260383 : 1271164 7 Bacillus_phage(16.67%) protease NA
DBSCAN-SWA_3 1517833 : 1530032 12 uncultured_Mediterranean_phage(90.0%) tRNA NA
DBSCAN-SWA_4 1781606 : 1791862 9 uncultured_Mediterranean_phage(66.67%) NA NA
DBSCAN-SWA_5 2462233 : 2490871 36 Sinorhizobium_phage(61.54%) terminase,tail NA
DBSCAN-SWA_6 3611112 : 3621154 9 Mycobacterium_phage(25.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage