Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_011884 Cyanothece sp. PCC 7425, complete genome 11 crisprs csa3,DinG,PD-DExK,RT,DEDDh,WYL,cas3,cas10d,csc2gr7,csc1gr5,cas6,cas4,cas1,cas2,c2c9_V-U4,c2c5_V-U5,cas14j,Cas14c_CAS-V-F,cas6e,cas5,cas7,cse2gr11,cas8e,2OG_CAS 3 33 8 0
NC_011885 Cyanothece sp. PCC 7425 plasmid pP742502, complete sequence 0 crisprs cas2,cas1,csx18,csx21,csm3gr7,csx19,WYL,cas6 0 0 2 0
NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 3 crisprs cas10,cmr3gr5,cmr4gr7,cmr5gr11,csx1,cas1,cas2,DEDDh,WYL,PD-DExK 0 137 2 0
NC_011882 Cyanothece sp. PCC 7425 plasmid pP742503, complete sequence 0 crisprs PD-DExK 0 0 0 0

Results visualization

1. NC_011884
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_011884_1 8938-9047 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_011884_2 687489-687603 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_011884_3 1168028-1168129 Orphan NA
1 spacers
PD-DExK

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_011884_4 1262835-1263015 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_011884_5 1397040-1397187 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_011884_6 1585061-1585254 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_011884_7 1954316-1954545 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_011884_8 2040733-2040899 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_011884_9 2421822-2425592 TypeI-D NA
51 spacers
cas2,cas1,cas4,cas6,csc1gr5,csc2gr7,cas10d,cas3,WYL

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_011884_10 4118395-4123555 TypeI-E NA
83 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3,WYL

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_011884_11 4142726-4143823 TypeI-E NA
13 spacers
WYL

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_011884_10 10.64|4122322|33|NC_011884|CRISPRCasFinder,CRT 4122322-4122354 33 NC_011884.1 2831355-2831387 0 1.0
NC_011884_10 10.69|4122632|32|NC_011884|CRISPRCasFinder,CRT 4122632-4122663 32 NC_011884.1 2180013-2180044 0 1.0
NC_011884_10 10.115|4122632|33|NC_011884|PILER-CR 4122632-4122664 33 NC_011884.1 2180012-2180044 0 1.0

1. spacer 10.64|4122322|33|NC_011884|CRISPRCasFinder,CRT matches to position: 2831355-2831387, mismatch: 0, identity: 1.0

gtctaatccagcgggttgtaatccgtagacagc	CRISPR spacer
gtctaatccagcgggttgtaatccgtagacagc	Protospacer
*********************************

2. spacer 10.69|4122632|32|NC_011884|CRISPRCasFinder,CRT matches to position: 2180013-2180044, mismatch: 0, identity: 1.0

gggtgattattggtccgaatggcgcaggtaag	CRISPR spacer
gggtgattattggtccgaatggcgcaggtaag	Protospacer
********************************

3. spacer 10.115|4122632|33|NC_011884|PILER-CR matches to position: 2180012-2180044, mismatch: 0, identity: 1.0

gggtgattattggtccgaatggcgcaggtaaga	CRISPR spacer
gggtgattattggtccgaatggcgcaggtaaga	Protospacer
*********************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_011884_8 8.3|2040852|31|NC_011884|PILER-CR 2040852-2040882 31 NZ_CP014598 Yangia sp. CCB-MM3 plasmid unnamed2, complete sequence 196286-196316 5 0.839
NC_011884_10 10.13|4119169|32|NC_011884|CRISPRCasFinder,CRT 4119169-4119200 32 NC_015465 Synechococcus phage S-CBS3, complete genome 26975-27006 5 0.844
NC_011884_10 10.21|4119666|32|NC_011884|CRISPRCasFinder,CRT 4119666-4119697 32 KU052037 Escherichia phage Rac-SA53, complete genome 38706-38737 6 0.812
NC_011884_10 10.69|4122632|32|NC_011884|CRISPRCasFinder,CRT 4122632-4122663 32 NZ_CP039925 Agrobacterium tumefaciens strain CFBP7129 plasmid pAtCFBP7129b, complete sequence 81319-81350 6 0.812
NC_011884_8 8.3|2040852|31|NC_011884|PILER-CR 2040852-2040882 31 NZ_AP022602 Mycobacterium gallinarum strain JCM 6399 plasmid pJCM6399 36247-36277 7 0.774
NC_011884_8 8.3|2040852|31|NC_011884|PILER-CR 2040852-2040882 31 NZ_CP035513 Haematobacter massiliensis strain OT1 plasmid pOT1-3, complete sequence 263171-263201 7 0.774
NC_011884_8 8.3|2040852|31|NC_011884|PILER-CR 2040852-2040882 31 NZ_CP017244 Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence 218300-218330 7 0.774
NC_011884_8 8.3|2040852|31|NC_011884|PILER-CR 2040852-2040882 31 NZ_CP020440 Paracoccus yeei strain FDAARGOS_252 plasmid unnamed2, complete sequence 42085-42115 7 0.774
NC_011884_8 8.3|2040852|31|NC_011884|PILER-CR 2040852-2040882 31 NZ_CP042333 Bosea sp. F3-2 plasmid pB32-2, complete sequence 122323-122353 7 0.774
NC_011884_8 8.3|2040852|31|NC_011884|PILER-CR 2040852-2040882 31 NC_023136 Leisingera methylohalidivorans DSM 14336 plasmid unnamed, complete sequence 160257-160287 7 0.774
NC_011884_8 8.3|2040852|31|NC_011884|PILER-CR 2040852-2040882 31 MH622912 Phage sp. isolate ctch905, complete genome 5156-5186 7 0.774
NC_011884_10 10.32|4120340|33|NC_011884|CRISPRCasFinder,CRT 4120340-4120372 33 MN855723 Bacteriophage sp. isolate 72, complete genome 8634-8666 7 0.788
NC_011884_10 10.69|4122632|32|NC_011884|CRISPRCasFinder,CRT 4122632-4122663 32 NZ_CP022220 Bradyrhizobium guangxiense strain CCBAU 53363 plasmid p53363, complete sequence 800952-800983 7 0.781
NC_011884_10 10.69|4122632|32|NC_011884|CRISPRCasFinder,CRT 4122632-4122663 32 NZ_CP030052 Bradyrhizobium guangdongense strain CCBAU 51649 plasmid unnamed, complete sequence 413792-413823 7 0.781
NC_011884_10 10.69|4122632|32|NC_011884|CRISPRCasFinder,CRT 4122632-4122663 32 NZ_CP030054 Bradyrhizobium guangzhouense strain CCBAU 51670 plasmid unnamed1, complete sequence 593385-593416 7 0.781
NC_011884_10 10.69|4122632|32|NC_011884|CRISPRCasFinder,CRT 4122632-4122663 32 NC_014838 Pantoea sp. At-9b plasmid pPAT9B01, complete sequence 316214-316245 7 0.781
NC_011884_10 10.69|4122632|32|NC_011884|CRISPRCasFinder,CRT 4122632-4122663 32 NZ_CP049319 Caballeronia sp. SBC2 plasmid pSBC2-3, complete sequence 568191-568222 7 0.781
NC_011884_10 10.115|4122632|33|NC_011884|PILER-CR 4122632-4122664 33 NZ_CP022220 Bradyrhizobium guangxiense strain CCBAU 53363 plasmid p53363, complete sequence 800952-800984 7 0.788
NC_011884_10 10.115|4122632|33|NC_011884|PILER-CR 4122632-4122664 33 NZ_CP039925 Agrobacterium tumefaciens strain CFBP7129 plasmid pAtCFBP7129b, complete sequence 81319-81351 7 0.788
NC_011884_10 10.115|4122632|33|NC_011884|PILER-CR 4122632-4122664 33 NZ_CP030052 Bradyrhizobium guangdongense strain CCBAU 51649 plasmid unnamed, complete sequence 413792-413824 7 0.788
NC_011884_10 10.115|4122632|33|NC_011884|PILER-CR 4122632-4122664 33 NZ_CP030054 Bradyrhizobium guangzhouense strain CCBAU 51670 plasmid unnamed1, complete sequence 593385-593417 7 0.788
NC_011884_11 11.14|4143401|32|NC_011884|PILER-CR 4143401-4143432 32 NZ_CP041288 Acinetobacter indicus strain 94-2 plasmid p94-2-p2, complete sequence 1521-1552 7 0.781
NC_011884_10 10.16|4119356|32|NC_011884|CRISPRCasFinder,CRT 4119356-4119387 32 NZ_CP014284 Bacillus thuringiensis strain Bt185 plasmid pBT1850294, complete sequence 171581-171612 8 0.75
NC_011884_10 10.16|4119356|32|NC_011884|CRISPRCasFinder,CRT 4119356-4119387 32 NZ_CP032609 Bacillus thuringiensis strain QZL38 plasmid p.2, complete sequence 263482-263513 8 0.75
NC_011884_10 10.16|4119356|32|NC_011884|CRISPRCasFinder,CRT 4119356-4119387 32 NZ_CP053953 Bacillus cereus strain FDAARGOS_798 plasmid unnamed2, complete sequence 291859-291890 8 0.75
NC_011884_10 10.16|4119356|32|NC_011884|CRISPRCasFinder,CRT 4119356-4119387 32 NZ_CP011154 Bacillus cereus strain CMCC P0011 plasmid pRML05, complete sequence 523101-523132 8 0.75
NC_011884_10 10.16|4119356|32|NC_011884|CRISPRCasFinder,CRT 4119356-4119387 32 NZ_CP011152 Bacillus cereus strain CMCC P0021 plasmid pRML04, complete sequence 23785-23816 8 0.75
NC_011884_10 10.16|4119356|32|NC_011884|CRISPRCasFinder,CRT 4119356-4119387 32 NZ_CP050184 Bacillus thuringiensis strain HER1410 plasmid pLUSID1, complete sequence 200554-200585 8 0.75
NC_011884_10 10.16|4119356|32|NC_011884|CRISPRCasFinder,CRT 4119356-4119387 32 NZ_CP016589 Bacillus thuringiensis strain KNU-07 plasmid pBTKNU07-01, complete sequence 393929-393960 8 0.75
NC_011884_10 10.16|4119356|32|NC_011884|CRISPRCasFinder,CRT 4119356-4119387 32 NZ_CP053950 Bacillus cereus strain FDAARGOS_799 plasmid unnamed2, complete sequence 186106-186137 8 0.75
NC_011884_10 10.22|4119727|32|NC_011884|CRISPRCasFinder,CRT 4119727-4119758 32 KX957972 Vibrio parahaemolyticus plasmid pVPS91, complete sequence 117921-117952 8 0.75
NC_011884_10 10.22|4119727|32|NC_011884|CRISPRCasFinder,CRT 4119727-4119758 32 MG189906 Stenotrophomonas phage vB_SmaS_DLP_5, complete genome 37736-37767 8 0.75
NC_011884_10 10.22|4119727|32|NC_011884|CRISPRCasFinder,CRT 4119727-4119758 32 MN096362 Arthrobacter phage Vibaki, complete genome 19071-19102 8 0.75
NC_011884_10 10.22|4119727|32|NC_011884|CRISPRCasFinder,CRT 4119727-4119758 32 MT110073 Stenotrophomonas phage vB_SmaS_DLP_3, complete genome 36808-36839 8 0.75
NC_011884_10 10.24|4119849|32|NC_011884|CRISPRCasFinder,CRT 4119849-4119880 32 NC_003078 Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence 883248-883279 8 0.75
NC_011884_10 10.24|4119849|32|NC_011884|CRISPRCasFinder,CRT 4119849-4119880 32 NC_017326 Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence 839938-839969 8 0.75
NC_011884_10 10.24|4119849|32|NC_011884|CRISPRCasFinder,CRT 4119849-4119880 32 NZ_CP021799 Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence 949468-949499 8 0.75
NC_011884_10 10.24|4119849|32|NC_011884|CRISPRCasFinder,CRT 4119849-4119880 32 NZ_CP021802 Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence 1506939-1506970 8 0.75
NC_011884_10 10.24|4119849|32|NC_011884|CRISPRCasFinder,CRT 4119849-4119880 32 NZ_CP021820 Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence 1193070-1193101 8 0.75
NC_011884_10 10.24|4119849|32|NC_011884|CRISPRCasFinder,CRT 4119849-4119880 32 NZ_CP021823 Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence 569575-569606 8 0.75
NC_011884_10 10.24|4119849|32|NC_011884|CRISPRCasFinder,CRT 4119849-4119880 32 NZ_CP021814 Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence 762447-762478 8 0.75
NC_011884_10 10.24|4119849|32|NC_011884|CRISPRCasFinder,CRT 4119849-4119880 32 NZ_CP021795 Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence 88458-88489 8 0.75
NC_011884_10 10.24|4119849|32|NC_011884|CRISPRCasFinder,CRT 4119849-4119880 32 NZ_CP021218 Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence 1000723-1000754 8 0.75
NC_011884_10 10.24|4119849|32|NC_011884|CRISPRCasFinder,CRT 4119849-4119880 32 NZ_CP019484 Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence 1022361-1022392 8 0.75
NC_011884_10 10.24|4119849|32|NC_011884|CRISPRCasFinder,CRT 4119849-4119880 32 NZ_CP019487 Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence 796834-796865 8 0.75
NC_011884_10 10.24|4119849|32|NC_011884|CRISPRCasFinder,CRT 4119849-4119880 32 NC_020560 Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence 883251-883282 8 0.75
NC_011884_10 10.32|4120340|33|NC_011884|CRISPRCasFinder,CRT 4120340-4120372 33 AP014045 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C12-MedDCM-OCT-S26-C148, *** SEQUENCING IN PROGRESS *** 4715-4747 8 0.758
NC_011884_10 10.32|4120340|33|NC_011884|CRISPRCasFinder,CRT 4120340-4120372 33 AP014054 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C12B-MedDCM-OCT-S33-C14, *** SEQUENCING IN PROGRESS *** 31161-31193 8 0.758
NC_011884_10 10.32|4120340|33|NC_011884|CRISPRCasFinder,CRT 4120340-4120372 33 AP014053 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C12B-MedDCM-OCT-S29-C16, *** SEQUENCING IN PROGRESS *** 31174-31206 8 0.758
NC_011884_10 10.32|4120340|33|NC_011884|CRISPRCasFinder,CRT 4120340-4120372 33 AP014060 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C12B-MedDCM-OCT-S45-C20, *** SEQUENCING IN PROGRESS *** 31161-31193 8 0.758
NC_011884_10 10.32|4120340|33|NC_011884|CRISPRCasFinder,CRT 4120340-4120372 33 AP014480 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C12-MedDCM-OCT-S39-C236, *** SEQUENCING IN PROGRESS ***, 3 ordered pieces 2138-2170 8 0.758
NC_011884_10 10.32|4120340|33|NC_011884|CRISPRCasFinder,CRT 4120340-4120372 33 AP014052 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C12B-MedDCM-OCT-S27-C13, *** SEQUENCING IN PROGRESS *** 8498-8530 8 0.758
NC_011884_10 10.32|4120340|33|NC_011884|CRISPRCasFinder,CRT 4120340-4120372 33 AP014058 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C12B-MedDCM-OCT-S42-C22, *** SEQUENCING IN PROGRESS *** 8503-8535 8 0.758
NC_011884_10 10.45|4121146|32|NC_011884|CRISPRCasFinder,CRT 4121146-4121177 32 MN694219 Marine virus AFVG_250M758, complete genome 29343-29374 8 0.75
NC_011884_10 10.48|4121331|32|NC_011884|CRISPRCasFinder,CRT 4121331-4121362 32 MT074441 Salmonella phage brunost, complete genome 20635-20666 8 0.75
NC_011884_10 10.48|4121331|32|NC_011884|CRISPRCasFinder,CRT 4121331-4121362 32 MF740800 Salmonella phage vB_SenM_PA13076, complete genome 35737-35768 8 0.75
NC_011884_10 10.48|4121331|32|NC_011884|CRISPRCasFinder,CRT 4121331-4121362 32 MT012730 Salmonella phage vB_SenM-1, complete genome 6024-6055 8 0.75
NC_011884_10 10.48|4121331|32|NC_011884|CRISPRCasFinder,CRT 4121331-4121362 32 MK568062 Salmonella phage LSE7621, complete genome 13633-13664 8 0.75
NC_011884_10 10.48|4121331|32|NC_011884|CRISPRCasFinder,CRT 4121331-4121362 32 NC_048763 Salmonella phage SE13, complete genome 46263-46294 8 0.75
NC_011884_10 10.48|4121331|32|NC_011884|CRISPRCasFinder,CRT 4121331-4121362 32 MH181876 Salmonella phage vB_SalM-LPSEYT, complete genome 14710-14741 8 0.75
NC_011884_10 10.48|4121331|32|NC_011884|CRISPRCasFinder,CRT 4121331-4121362 32 MT074435 Salmonella phage brorfarstad, complete genome 20747-20778 8 0.75
NC_011884_10 10.48|4121331|32|NC_011884|CRISPRCasFinder,CRT 4121331-4121362 32 MT074442 Salmonella phage ciri, complete genome 21009-21040 8 0.75
NC_011884_10 10.48|4121331|32|NC_011884|CRISPRCasFinder,CRT 4121331-4121362 32 MN379740 Salmonella phage 8-19, complete genome 45559-45590 8 0.75
NC_011884_10 10.48|4121331|32|NC_011884|CRISPRCasFinder,CRT 4121331-4121362 32 MT074438 Salmonella phage rivia, complete genome 20432-20463 8 0.75
NC_011884_10 10.48|4121331|32|NC_011884|CRISPRCasFinder,CRT 4121331-4121362 32 KX826077 Salmonella phage UPF_BP2, complete genome 12529-12560 8 0.75
NC_011884_10 10.48|4121331|32|NC_011884|CRISPRCasFinder,CRT 4121331-4121362 32 KX826077 Salmonella phage UPF_BP2, complete genome 12950-12981 8 0.75
NC_011884_10 10.48|4121331|32|NC_011884|CRISPRCasFinder,CRT 4121331-4121362 32 MT764207 Escherichia phage JEP7, complete genome 34870-34901 8 0.75
NC_011884_10 10.48|4121331|32|NC_011884|CRISPRCasFinder,CRT 4121331-4121362 32 NC_048863 Salmonella phage yarpen, complete genome 21361-21392 8 0.75
NC_011884_10 10.48|4121331|32|NC_011884|CRISPRCasFinder,CRT 4121331-4121362 32 KY608966 UNVERIFIED: Escherichia phage phiEC1, complete genome 42963-42994 8 0.75
NC_011884_10 10.51|4121518|33|NC_011884|CRISPRCasFinder,CRT 4121518-4121550 33 NC_049380 Vibrio phage JSF3, complete genome 62164-62196 8 0.758
NC_011884_10 10.51|4121518|33|NC_011884|CRISPRCasFinder,CRT 4121518-4121550 33 NC_049350 Vibrio phage VCO139, complete genome 6133-6165 8 0.758
NC_011884_10 10.51|4121518|33|NC_011884|CRISPRCasFinder,CRT 4121518-4121550 33 NC_021540 Vibrio phage JA-1, complete genome 6438-6470 8 0.758
NC_011884_10 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT 4121764-4121795 32 MT723933 Streptomyces phage Keanu, complete genome 27667-27698 8 0.75
NC_011884_10 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT 4121764-4121795 32 CP058906 Micromonospora phage pMLP1, complete sequence 3673-3704 8 0.75
NC_011884_10 10.69|4122632|32|NC_011884|CRISPRCasFinder,CRT 4122632-4122663 32 NZ_CP054613 Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence 1101245-1101276 8 0.75
NC_011884_10 10.69|4122632|32|NC_011884|CRISPRCasFinder,CRT 4122632-4122663 32 NZ_CP024200 Thalassospira marina strain CSC3H3 plasmid pCSC3H3, complete sequence 850256-850287 8 0.75
NC_011884_10 10.101|4121764|33|NC_011884|PILER-CR 4121764-4121796 33 CP058906 Micromonospora phage pMLP1, complete sequence 3672-3704 8 0.758
NC_011884_8 8.1|2040750|34|NC_011884|PILER-CR 2040750-2040783 34 NZ_CP025810 Sulfitobacter sp. SK025 plasmid unnamed2, complete sequence 28569-28602 9 0.735
NC_011884_8 8.2|2040801|34|NC_011884|PILER-CR 2040801-2040834 34 MT740244 Proteus phage 3H10_20, partial genome 20699-20732 9 0.735
NC_011884_8 8.3|2040852|31|NC_011884|PILER-CR 2040852-2040882 31 NC_011143 Phenylobacterium zucineum HLK1 plasmid, complete sequence 87980-88010 9 0.71
NC_011884_8 8.3|2040852|31|NC_011884|PILER-CR 2040852-2040882 31 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 89006-89036 9 0.71
NC_011884_8 8.3|2040852|31|NC_011884|PILER-CR 2040852-2040882 31 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 1107977-1108007 9 0.71
NC_011884_8 8.3|2040852|31|NC_011884|PILER-CR 2040852-2040882 31 NZ_CP022363 Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence 616924-616954 9 0.71
NC_011884_8 8.3|2040852|31|NC_011884|PILER-CR 2040852-2040882 31 NZ_CP007795 Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence 75675-75705 9 0.71
NC_011884_8 8.3|2040852|31|NC_011884|PILER-CR 2040852-2040882 31 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 1167701-1167731 9 0.71
NC_011884_8 8.3|2040852|31|NC_011884|PILER-CR 2040852-2040882 31 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 1107074-1107104 9 0.71
NC_011884_8 8.3|2040852|31|NC_011884|PILER-CR 2040852-2040882 31 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 1107969-1107999 9 0.71
NC_011884_8 8.3|2040852|31|NC_011884|PILER-CR 2040852-2040882 31 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 1107325-1107355 9 0.71
NC_011884_8 8.3|2040852|31|NC_011884|PILER-CR 2040852-2040882 31 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 1107960-1107990 9 0.71
NC_011884_8 8.3|2040852|31|NC_011884|PILER-CR 2040852-2040882 31 NZ_CP032347 Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence 82107-82137 9 0.71
NC_011884_10 10.12|4119107|33|NC_011884|CRISPRCasFinder,CRT 4119107-4119139 33 NZ_LR723678 Arsenite-oxidising bacterium NT-25 plasmid 2 113035-113067 9 0.727
NC_011884_10 10.12|4119107|33|NC_011884|CRISPRCasFinder,CRT 4119107-4119139 33 NZ_FO082821 Rhizobium sp. NT-26 plasmid NT26_p1, complete sequence 194256-194288 9 0.727
NC_011884_10 10.16|4119356|32|NC_011884|CRISPRCasFinder,CRT 4119356-4119387 32 NZ_CP043831 Bacillus sp. BS98 plasmid unnamed1 243953-243984 9 0.719
NC_011884_10 10.16|4119356|32|NC_011884|CRISPRCasFinder,CRT 4119356-4119387 32 CP046512 Bacillus cereus strain JHU plasmid p1, complete sequence 33238-33269 9 0.719
NC_011884_10 10.32|4120340|33|NC_011884|CRISPRCasFinder,CRT 4120340-4120372 33 MT080583 UNVERIFIED: Staphylococcus phage vB_SauM_EW13, complete genome 112915-112947 9 0.727
NC_011884_10 10.34|4120463|32|NC_011884|CRISPRCasFinder,CRT 4120463-4120494 32 NC_014534 Gloeothece verrucosa PCC 7822 plasmid Cy782202, complete sequence 25729-25760 9 0.719
NC_011884_10 10.35|4120524|33|NC_011884|CRISPRCasFinder,CRT 4120524-4120556 33 NC_014825 Ruminococcus albus 7 = DSM 20455 plasmid pRUMAL02, complete sequence 275686-275718 9 0.727
NC_011884_10 10.37|4120648|33|NC_011884|CRISPRCasFinder,CRT 4120648-4120680 33 NC_014825 Ruminococcus albus 7 = DSM 20455 plasmid pRUMAL02, complete sequence 275686-275718 9 0.727
NC_011884_10 10.45|4121146|32|NC_011884|CRISPRCasFinder,CRT 4121146-4121177 32 HG796416 Uncultured bacterium plasmid pRGI01031 1-31 9 0.719
NC_011884_10 10.48|4121331|32|NC_011884|CRISPRCasFinder,CRT 4121331-4121362 32 NC_048864 Salmonella phage birk, complete genome 21142-21173 9 0.719
NC_011884_10 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT 4121764-4121795 32 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 63701-63732 9 0.719
NC_011884_10 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT 4121764-4121795 32 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 545198-545229 9 0.719
NC_011884_10 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT 4121764-4121795 32 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 558222-558253 9 0.719
NC_011884_10 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT 4121764-4121795 32 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 1517095-1517126 9 0.719
NC_011884_10 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT 4121764-4121795 32 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 1154752-1154783 9 0.719
NC_011884_10 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT 4121764-4121795 32 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 1358714-1358745 9 0.719
NC_011884_10 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT 4121764-4121795 32 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 561335-561366 9 0.719
NC_011884_10 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT 4121764-4121795 32 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 384069-384100 9 0.719
NC_011884_10 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT 4121764-4121795 32 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 660511-660542 9 0.719
NC_011884_10 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT 4121764-4121795 32 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 720596-720627 9 0.719
NC_011884_10 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT 4121764-4121795 32 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 217712-217743 9 0.719
NC_011884_10 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT 4121764-4121795 32 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 936228-936259 9 0.719
NC_011884_10 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT 4121764-4121795 32 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 566327-566358 9 0.719
NC_011884_10 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT 4121764-4121795 32 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 90276-90307 9 0.719
NC_011884_10 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT 4121764-4121795 32 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 801892-801923 9 0.719
NC_011884_10 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT 4121764-4121795 32 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 563788-563819 9 0.719
NC_011884_10 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT 4121764-4121795 32 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 1616703-1616734 9 0.719
NC_011884_10 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT 4121764-4121795 32 NZ_CP022773 Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence 574057-574088 9 0.719
NC_011884_10 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT 4121764-4121795 32 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 559736-559767 9 0.719
NC_011884_10 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT 4121764-4121795 32 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 558819-558850 9 0.719
NC_011884_10 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT 4121764-4121795 32 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 579603-579634 9 0.719
NC_011884_10 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT 4121764-4121795 32 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 508969-509000 9 0.719
NC_011884_10 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT 4121764-4121795 32 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 562665-562696 9 0.719
NC_011884_10 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT 4121764-4121795 32 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 1429704-1429735 9 0.719
NC_011884_10 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT 4121764-4121795 32 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 563793-563824 9 0.719
NC_011884_10 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT 4121764-4121795 32 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 579603-579634 9 0.719
NC_011884_10 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT 4121764-4121795 32 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 622786-622817 9 0.719
NC_011884_10 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT 4121764-4121795 32 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 567231-567262 9 0.719
NC_011884_10 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT 4121764-4121795 32 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 579601-579632 9 0.719
NC_011884_10 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT 4121764-4121795 32 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 556737-556768 9 0.719
NC_011884_10 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT 4121764-4121795 32 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 622786-622817 9 0.719
NC_011884_10 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT 4121764-4121795 32 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 567231-567262 9 0.719
NC_011884_10 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT 4121764-4121795 32 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 579603-579634 9 0.719
NC_011884_10 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT 4121764-4121795 32 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 622786-622817 9 0.719
NC_011884_10 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT 4121764-4121795 32 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 556765-556796 9 0.719
NC_011884_10 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT 4121764-4121795 32 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 622790-622821 9 0.719
NC_011884_10 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT 4121764-4121795 32 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 567231-567262 9 0.719
NC_011884_10 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT 4121764-4121795 32 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 567231-567262 9 0.719
NC_011884_10 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT 4121764-4121795 32 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 567231-567262 9 0.719
NC_011884_10 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT 4121764-4121795 32 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 579603-579634 9 0.719
NC_011884_10 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT 4121764-4121795 32 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 1535244-1535275 9 0.719
NC_011884_10 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT 4121764-4121795 32 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 579603-579634 9 0.719
NC_011884_10 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT 4121764-4121795 32 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 556765-556796 9 0.719
NC_011884_10 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT 4121764-4121795 32 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 574040-574071 9 0.719
NC_011884_10 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT 4121764-4121795 32 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 573992-574023 9 0.719
NC_011884_10 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT 4121764-4121795 32 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 608446-608477 9 0.719
NC_011884_10 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT 4121764-4121795 32 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 565805-565836 9 0.719
NC_011884_10 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT 4121764-4121795 32 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 565742-565773 9 0.719
NC_011884_10 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT 4121764-4121795 32 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 579603-579634 9 0.719
NC_011884_10 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT 4121764-4121795 32 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 556765-556796 9 0.719
NC_011884_10 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT 4121764-4121795 32 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 622786-622817 9 0.719
NC_011884_10 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT 4121764-4121795 32 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 656003-656034 9 0.719
NC_011884_10 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT 4121764-4121795 32 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 579600-579631 9 0.719
NC_011884_10 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT 4121764-4121795 32 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 556765-556796 9 0.719
NC_011884_10 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT 4121764-4121795 32 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 556765-556796 9 0.719
NC_011884_10 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT 4121764-4121795 32 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 579603-579634 9 0.719
NC_011884_10 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT 4121764-4121795 32 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 567233-567264 9 0.719
NC_011884_10 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT 4121764-4121795 32 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 1506993-1507024 9 0.719
NC_011884_10 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT 4121764-4121795 32 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 579603-579634 9 0.719
NC_011884_10 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT 4121764-4121795 32 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 579603-579634 9 0.719
NC_011884_10 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT 4121764-4121795 32 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 1506993-1507024 9 0.719
NC_011884_10 10.63|4122261|32|NC_011884|CRISPRCasFinder,CRT 4122261-4122292 32 NZ_AP022607 Mycobacterium branderi strain JCM 12687 plasmid pJCM12687 211851-211882 9 0.719
NC_011884_10 10.69|4122632|32|NC_011884|CRISPRCasFinder,CRT 4122632-4122663 32 NC_008270 Rhodococcus jostii RHA1 plasmid pRHL2, complete sequence 314055-314086 9 0.719
NC_011884_10 10.69|4122632|32|NC_011884|CRISPRCasFinder,CRT 4122632-4122663 32 NZ_CP028385 Providencia heimbachae strain 99101 plasmid unnamed, complete sequence 8364-8395 9 0.719
NC_011884_10 10.91|4121146|33|NC_011884|PILER-CR 4121146-4121178 33 MN694219 Marine virus AFVG_250M758, complete genome 29342-29374 9 0.727
NC_011884_10 10.97|4121518|34|NC_011884|PILER-CR 4121518-4121551 34 NC_049350 Vibrio phage VCO139, complete genome 6132-6165 9 0.735
NC_011884_10 10.97|4121518|34|NC_011884|PILER-CR 4121518-4121551 34 NC_021540 Vibrio phage JA-1, complete genome 6437-6470 9 0.735
NC_011884_10 10.97|4121518|34|NC_011884|PILER-CR 4121518-4121551 34 NC_049380 Vibrio phage JSF3, complete genome 62164-62197 9 0.735
NC_011884_10 10.115|4122632|33|NC_011884|PILER-CR 4122632-4122664 33 NZ_CP054613 Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence 1101244-1101276 9 0.727
NC_011884_8 8.1|2040750|34|NC_011884|PILER-CR 2040750-2040783 34 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 9225-9258 10 0.706
NC_011884_8 8.3|2040852|31|NC_011884|PILER-CR 2040852-2040882 31 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 1189604-1189634 10 0.677
NC_011884_8 8.3|2040852|31|NC_011884|PILER-CR 2040852-2040882 31 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 1238532-1238562 10 0.677
NC_011884_8 8.3|2040852|31|NC_011884|PILER-CR 2040852-2040882 31 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 1189717-1189747 10 0.677
NC_011884_8 8.3|2040852|31|NC_011884|PILER-CR 2040852-2040882 31 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 1189701-1189731 10 0.677
NC_011884_8 8.3|2040852|31|NC_011884|PILER-CR 2040852-2040882 31 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 1189695-1189725 10 0.677
NC_011884_8 8.3|2040852|31|NC_011884|PILER-CR 2040852-2040882 31 NZ_CP016891 Pantoea agglomerans strain C410P1 plasmid unnamed2, complete sequence 77354-77384 10 0.677
NC_011884_9 9.3|2422003|35|NC_011884|PILER-CR,CRISPRCasFinder,CRT 2422003-2422037 35 NZ_CP029986 Sphingomonas sp. FARSPH plasmid p01, complete sequence 13374-13408 10 0.714
NC_011884_9 9.35|2424350|35|NC_011884|PILER-CR,CRISPRCasFinder,CRT 2424350-2424384 35 CP003955 Rhodococcus opacus PD630 plasmid 6, complete sequence 32376-32410 10 0.714
NC_011884_9 9.35|2424350|35|NC_011884|PILER-CR,CRISPRCasFinder,CRT 2424350-2424384 35 NC_011887 Methylobacterium nodulans ORS 2060 plasmid pMNOD02, complete sequence 178395-178429 10 0.714
NC_011884_10 10.7|4118797|33|NC_011884|CRISPRCasFinder,CRT 4118797-4118829 33 NZ_CP049735 Rhizobium leguminosarum strain A1 plasmid unnamed2, complete sequence 32277-32309 10 0.697
NC_011884_10 10.7|4118797|33|NC_011884|CRISPRCasFinder,CRT 4118797-4118829 33 CP049735 Rhizobium leguminosarum strain A1 plasmid pRLa12, complete sequence 571-603 10 0.697
NC_011884_10 10.22|4119727|32|NC_011884|CRISPRCasFinder,CRT 4119727-4119758 32 JQ680355 Unidentified phage clone 1013_scaffold7838 genomic sequence 5886-5917 10 0.688
NC_011884_10 10.32|4120340|33|NC_011884|CRISPRCasFinder,CRT 4120340-4120372 33 NZ_CP018877 Bacillus megaterium strain JX285 plasmid 4, complete sequence 87902-87934 10 0.697
NC_011884_10 10.39|4120772|34|NC_011884|CRISPRCasFinder,CRT 4120772-4120805 34 MH825713 Mycobacterium phage Zalkecks, complete genome 112045-112078 10 0.706
NC_011884_10 10.45|4121146|32|NC_011884|CRISPRCasFinder,CRT 4121146-4121177 32 NZ_CP016462 Blastomonas sp. RAC04 plasmid pBSY18_1, complete sequence 6875-6906 10 0.688
NC_011884_10 10.45|4121146|32|NC_011884|CRISPRCasFinder,CRT 4121146-4121177 32 MG592506 Vibrio phage 1.135.O._10N.222.54.B6, partial genome 30664-30695 10 0.688
NC_011884_10 10.45|4121146|32|NC_011884|CRISPRCasFinder,CRT 4121146-4121177 32 MG592583 Vibrio phage 1.213.O._10N.222.54.F10, partial genome 30676-30707 10 0.688
NC_011884_10 10.47|4121270|32|NC_011884|CRISPRCasFinder,CRT 4121270-4121301 32 NZ_CP014284 Bacillus thuringiensis strain Bt185 plasmid pBT1850294, complete sequence 157296-157327 10 0.688
NC_011884_10 10.47|4121270|32|NC_011884|CRISPRCasFinder,CRT 4121270-4121301 32 NZ_CP032609 Bacillus thuringiensis strain QZL38 plasmid p.2, complete sequence 249197-249228 10 0.688
NC_011884_10 10.47|4121270|32|NC_011884|CRISPRCasFinder,CRT 4121270-4121301 32 NZ_AP018284 Chondrocystis sp. NIES-4102 plasmid plasmid3 DNA, complete genome 98631-98662 10 0.688
NC_011884_10 10.54|4121703|32|NC_011884|CRISPRCasFinder,CRT 4121703-4121734 32 MT024862 Microbacterium phage Alakazam, complete genome 12589-12620 10 0.688
NC_011884_10 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT 4121764-4121795 32 NZ_CP017105 Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence 501336-501367 10 0.688
NC_011884_10 10.66|4122446|32|NC_011884|CRISPRCasFinder,CRT 4122446-4122477 32 NZ_CP012641 Massilia sp. WG5 plasmid unnamed 1, complete sequence 185733-185764 10 0.688
NC_011884_10 10.72|4122817|32|NC_011884|CRISPRCasFinder,CRT 4122817-4122848 32 KP313531 Citrobacter phage phiCFP-1, complete genome 33940-33971 10 0.688
NC_011884_10 10.72|4122817|32|NC_011884|CRISPRCasFinder,CRT 4122817-4122848 32 NC_028655 Yersinia phage vB_YenP_AP10, complete genome 34702-34733 10 0.688
NC_011884_11 11.14|4143401|32|NC_011884|PILER-CR 4143401-4143432 32 MK250029 Prevotella phage Lak-C1, complete genome 177058-177089 10 0.688
NC_011884_8 8.2|2040801|34|NC_011884|PILER-CR 2040801-2040834 34 MF189170 Arthrobacter phage Arcadia, complete genome 14837-14870 11 0.676
NC_011884_8 8.2|2040801|34|NC_011884|PILER-CR 2040801-2040834 34 MF189172 Arthrobacter phage Elsa, complete genome 14837-14870 11 0.676
NC_011884_8 8.2|2040801|34|NC_011884|PILER-CR 2040801-2040834 34 MF189174 Arthrobacter phage Nason, complete genome 14837-14870 11 0.676
NC_011884_9 9.44|2425011|35|NC_011884|PILER-CR,CRISPRCasFinder,CRT 2425011-2425045 35 NZ_CP015595 Acinetobacter sp. NCu2D-2 plasmid unnamed, complete sequence 172116-172150 11 0.686
NC_011884_10 10.32|4120340|33|NC_011884|CRISPRCasFinder,CRT 4120340-4120372 33 KU160494 Vibrio phage vB_VmeM-32, complete genome 181225-181257 11 0.667

1. spacer 8.3|2040852|31|NC_011884|PILER-CR matches to NZ_CP014598 (Yangia sp. CCB-MM3 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.839

cccgccgccgccagacgctgtgccgcgaaat	CRISPR spacer
cccgcctccgccagccgctgtgccgcgagcc	Protospacer
****** ******* *************. .

2. spacer 10.13|4119169|32|NC_011884|CRISPRCasFinder,CRT matches to NC_015465 (Synechococcus phage S-CBS3, complete genome) position: , mismatch: 5, identity: 0.844

tcaggtaggctgatcagcttccactgtatgaa	CRISPR spacer
cctggccggctgatcagcttccactgcatgaa	Protospacer
.* **. *******************.*****

3. spacer 10.21|4119666|32|NC_011884|CRISPRCasFinder,CRT matches to KU052037 (Escherichia phage Rac-SA53, complete genome) position: , mismatch: 6, identity: 0.812

tttaatggcgatgtgccaaaaatgccataacg--	CRISPR spacer
tataaaggcgatgtggcaaaaatgc--ttacggc	Protospacer
* *** ********* *********  * ***  

4. spacer 10.69|4122632|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP039925 (Agrobacterium tumefaciens strain CFBP7129 plasmid pAtCFBP7129b, complete sequence) position: , mismatch: 6, identity: 0.812

gggtgattattggtccgaatggcgcaggtaag	CRISPR spacer
tgtgcattatcggtccgaatggcgccggtaag	Protospacer
 *   *****.************** ******

5. spacer 8.3|2040852|31|NC_011884|PILER-CR matches to NZ_AP022602 (Mycobacterium gallinarum strain JCM 6399 plasmid pJCM6399) position: , mismatch: 7, identity: 0.774

cccgccgccgccagacgctgtgccgcgaaat	CRISPR spacer
gcgaccgccgccaggcgctgcgccgcgagct	Protospacer
 * .**********.*****.*******. *

6. spacer 8.3|2040852|31|NC_011884|PILER-CR matches to NZ_CP035513 (Haematobacter massiliensis strain OT1 plasmid pOT1-3, complete sequence) position: , mismatch: 7, identity: 0.774

cccgccgccgccagacgctgtgccgcgaaat	CRISPR spacer
gccagcgccgccagaagcagtgccgcgaaga	Protospacer
 **. ********** ** **********. 

7. spacer 8.3|2040852|31|NC_011884|PILER-CR matches to NZ_CP017244 (Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence) position: , mismatch: 7, identity: 0.774

cccgccgccgccagacgctgtgccgcgaaat	CRISPR spacer
gccgccgccgccagacgctttgacgataacg	Protospacer
 ****************** ** **  **  

8. spacer 8.3|2040852|31|NC_011884|PILER-CR matches to NZ_CP020440 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.774

----cccgccgccgccagacgctgtgccgcgaaat	CRISPR spacer
aatttccg----cgccagacgctatgtcgcgaaat	Protospacer
    .***    ***********.**.********

9. spacer 8.3|2040852|31|NC_011884|PILER-CR matches to NZ_CP042333 (Bosea sp. F3-2 plasmid pB32-2, complete sequence) position: , mismatch: 7, identity: 0.774

cccgccgccgccagacgctgtgccgcgaaat	CRISPR spacer
cgcgccgccgccggaccctgtgccggaaacc	Protospacer
* **********.*** ******** .** .

10. spacer 8.3|2040852|31|NC_011884|PILER-CR matches to NC_023136 (Leisingera methylohalidivorans DSM 14336 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774

cccgccgccgccagacgctgtgccgcgaaat	CRISPR spacer
cccgccgcagccagacgccgtgctggcagaa	Protospacer
******** *********.****.*  *.* 

11. spacer 8.3|2040852|31|NC_011884|PILER-CR matches to MH622912 (Phage sp. isolate ctch905, complete genome) position: , mismatch: 7, identity: 0.774

cccgccgccgccagacgctgtg----ccgcgaaat	CRISPR spacer
cccgccgccgccggacgccgtgcattctgcg----	Protospacer
************.*****.***    *.***    

12. spacer 10.32|4120340|33|NC_011884|CRISPRCasFinder,CRT matches to MN855723 (Bacteriophage sp. isolate 72, complete genome) position: , mismatch: 7, identity: 0.788

ggtcgggtggtttttttattgataataaattca	CRISPR spacer
agtgctgtggttttgttattgataataaaatct	Protospacer
.**   ******** ************** ** 

13. spacer 10.69|4122632|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP022220 (Bradyrhizobium guangxiense strain CCBAU 53363 plasmid p53363, complete sequence) position: , mismatch: 7, identity: 0.781

gggtgattattggtccgaatggcgcaggtaag	CRISPR spacer
acgctctgattggtccgaatggcgcaggaaag	Protospacer
. *.  * ******************** ***

14. spacer 10.69|4122632|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP030052 (Bradyrhizobium guangdongense strain CCBAU 51649 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

gggtgattattggtccgaatggcgcaggtaag	CRISPR spacer
acgctctgattggtccgaatggcgcaggaaag	Protospacer
. *.  * ******************** ***

15. spacer 10.69|4122632|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP030054 (Bradyrhizobium guangzhouense strain CCBAU 51670 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

gggtgattattggtccgaatggcgcaggtaag	CRISPR spacer
acgctctgattggtccgaatggcgcaggaaag	Protospacer
. *.  * ******************** ***

16. spacer 10.69|4122632|32|NC_011884|CRISPRCasFinder,CRT matches to NC_014838 (Pantoea sp. At-9b plasmid pPAT9B01, complete sequence) position: , mismatch: 7, identity: 0.781

gggtgatt-attggtccgaatggcgcaggtaag	CRISPR spacer
-gttgcctgattggcccgaatggcgcagggaaa	Protospacer
 * ** .* *****.************** **.

17. spacer 10.69|4122632|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP049319 (Caballeronia sp. SBC2 plasmid pSBC2-3, complete sequence) position: , mismatch: 7, identity: 0.781

gggtgattattggtccgaatggcgcaggtaag	CRISPR spacer
gagttgtgatcggaccgaatggcgcaggtaaa	Protospacer
*.** .* **.** *****************.

18. spacer 10.115|4122632|33|NC_011884|PILER-CR matches to NZ_CP022220 (Bradyrhizobium guangxiense strain CCBAU 53363 plasmid p53363, complete sequence) position: , mismatch: 7, identity: 0.788

gggtgattattggtccgaatggcgcaggtaaga	CRISPR spacer
acgctctgattggtccgaatggcgcaggaaaga	Protospacer
. *.  * ******************** ****

19. spacer 10.115|4122632|33|NC_011884|PILER-CR matches to NZ_CP039925 (Agrobacterium tumefaciens strain CFBP7129 plasmid pAtCFBP7129b, complete sequence) position: , mismatch: 7, identity: 0.788

gggtgattattggtccgaatggcgcaggtaaga	CRISPR spacer
tgtgcattatcggtccgaatggcgccggtaagt	Protospacer
 *   *****.************** ****** 

20. spacer 10.115|4122632|33|NC_011884|PILER-CR matches to NZ_CP030052 (Bradyrhizobium guangdongense strain CCBAU 51649 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788

gggtgattattggtccgaatggcgcaggtaaga	CRISPR spacer
acgctctgattggtccgaatggcgcaggaaaga	Protospacer
. *.  * ******************** ****

21. spacer 10.115|4122632|33|NC_011884|PILER-CR matches to NZ_CP030054 (Bradyrhizobium guangzhouense strain CCBAU 51670 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.788

gggtgattattggtccgaatggcgcaggtaaga	CRISPR spacer
acgctctgattggtccgaatggcgcaggaaaga	Protospacer
. *.  * ******************** ****

22. spacer 11.14|4143401|32|NC_011884|PILER-CR matches to NZ_CP041288 (Acinetobacter indicus strain 94-2 plasmid p94-2-p2, complete sequence) position: , mismatch: 7, identity: 0.781

tcataatttacatctctataa-tttacatcttt	CRISPR spacer
acattatttacatctctctaattttacattga-	Protospacer
 *** ************ *** *******.   

23. spacer 10.16|4119356|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP014284 (Bacillus thuringiensis strain Bt185 plasmid pBT1850294, complete sequence) position: , mismatch: 8, identity: 0.75

gaatataaaataaatagcttgatcaagggtga	CRISPR spacer
gaacttaaaataaatagcttgataacaagggg	Protospacer
***. ****************** * ..* *.

24. spacer 10.16|4119356|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP032609 (Bacillus thuringiensis strain QZL38 plasmid p.2, complete sequence) position: , mismatch: 8, identity: 0.75

gaatataaaataaatagcttgatcaagggtga	CRISPR spacer
gaacttaaaataaatagcttgataacaagggg	Protospacer
***. ****************** * ..* *.

25. spacer 10.16|4119356|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP053953 (Bacillus cereus strain FDAARGOS_798 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

gaatataaaataaatagcttgatcaagggtga	CRISPR spacer
gaacttaaaataaatagcttgataacaagggg	Protospacer
***. ****************** * ..* *.

26. spacer 10.16|4119356|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP011154 (Bacillus cereus strain CMCC P0011 plasmid pRML05, complete sequence) position: , mismatch: 8, identity: 0.75

gaatataaaataaatagcttgatcaagggtga	CRISPR spacer
gaacttaaaataaatagcttgataacaagggg	Protospacer
***. ****************** * ..* *.

27. spacer 10.16|4119356|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP011152 (Bacillus cereus strain CMCC P0021 plasmid pRML04, complete sequence) position: , mismatch: 8, identity: 0.75

gaatataaaataaatagcttgatcaagggtga	CRISPR spacer
gaacttaaaataaatagcttgataacaagggg	Protospacer
***. ****************** * ..* *.

28. spacer 10.16|4119356|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP050184 (Bacillus thuringiensis strain HER1410 plasmid pLUSID1, complete sequence) position: , mismatch: 8, identity: 0.75

gaatataaaataaatagcttgatcaagggtga	CRISPR spacer
gaacttaaaataaatagcttgataacaagggg	Protospacer
***. ****************** * ..* *.

29. spacer 10.16|4119356|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP016589 (Bacillus thuringiensis strain KNU-07 plasmid pBTKNU07-01, complete sequence) position: , mismatch: 8, identity: 0.75

gaatataaaataaatagcttgatcaagggtga	CRISPR spacer
gaacttaaaataaatagcttgataacaagggg	Protospacer
***. ****************** * ..* *.

30. spacer 10.16|4119356|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP053950 (Bacillus cereus strain FDAARGOS_799 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

gaatataaaataaatagcttgatcaagggtga	CRISPR spacer
gaacttaaaataaatagcttgataacaagggg	Protospacer
***. ****************** * ..* *.

31. spacer 10.22|4119727|32|NC_011884|CRISPRCasFinder,CRT matches to KX957972 (Vibrio parahaemolyticus plasmid pVPS91, complete sequence) position: , mismatch: 8, identity: 0.75

gctaacctgacggcggcgttcttccgcaacat	CRISPR spacer
cttaacctgctggcggcgttcttcctctctat	Protospacer
 .******* .************** *  .**

32. spacer 10.22|4119727|32|NC_011884|CRISPRCasFinder,CRT matches to MG189906 (Stenotrophomonas phage vB_SmaS_DLP_5, complete genome) position: , mismatch: 8, identity: 0.75

gctaacctgacggcggcgttcttccgcaacat	CRISPR spacer
cagagcatgacggcggcgttcctgcgcaactt	Protospacer
   *.* **************.* ****** *

33. spacer 10.22|4119727|32|NC_011884|CRISPRCasFinder,CRT matches to MN096362 (Arthrobacter phage Vibaki, complete genome) position: , mismatch: 8, identity: 0.75

gctaacctgacggcggcgttcttccgcaacat-	CRISPR spacer
tcaaacctgacggcggcgtgcgtccg-ggcgtc	Protospacer
 * **************** * **** ..*.* 

34. spacer 10.22|4119727|32|NC_011884|CRISPRCasFinder,CRT matches to MT110073 (Stenotrophomonas phage vB_SmaS_DLP_3, complete genome) position: , mismatch: 8, identity: 0.75

gctaacctgacggcggcgttcttccgcaacat	CRISPR spacer
cagagcatgacggcggcgttcctgcgcaactt	Protospacer
   *.* **************.* ****** *

35. spacer 10.24|4119849|32|NC_011884|CRISPRCasFinder,CRT matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.75

gaagtcggacgactcatcagcgaaagaatggt	CRISPR spacer
gaagtcggacgcctcatccgcgagaagacagc	Protospacer
*********** ****** ****.*..*..*.

36. spacer 10.24|4119849|32|NC_011884|CRISPRCasFinder,CRT matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 8, identity: 0.75

gaagtcggacgactcatcagcgaaagaatggt	CRISPR spacer
gaagtcggacgcctcatccgcgagaagacagc	Protospacer
*********** ****** ****.*..*..*.

37. spacer 10.24|4119849|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75

gaagtcggacgactcatcagcgaaagaatggt	CRISPR spacer
gaagtcggacgcctcatccgcgagaagacagc	Protospacer
*********** ****** ****.*..*..*.

38. spacer 10.24|4119849|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75

gaagtcggacgactcatcagcgaaagaatggt	CRISPR spacer
gaagtcggacgcctcatccgcgagaagacagc	Protospacer
*********** ****** ****.*..*..*.

39. spacer 10.24|4119849|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP021820 (Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75

gaagtcggacgactcatcagcgaaagaatggt	CRISPR spacer
gaagtcggacgcctcatccgcgagaagacagc	Protospacer
*********** ****** ****.*..*..*.

40. spacer 10.24|4119849|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75

gaagtcggacgactcatcagcgaaagaatggt	CRISPR spacer
gaagtcggacgcctcatccgcgagaagacagc	Protospacer
*********** ****** ****.*..*..*.

41. spacer 10.24|4119849|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75

gaagtcggacgactcatcagcgaaagaatggt	CRISPR spacer
gaagtcggacgcctcatccgcgagaagacagc	Protospacer
*********** ****** ****.*..*..*.

42. spacer 10.24|4119849|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75

gaagtcggacgactcatcagcgaaagaatggt	CRISPR spacer
gaagtcggacgcctcatccgcgagaagacagc	Protospacer
*********** ****** ****.*..*..*.

43. spacer 10.24|4119849|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.75

gaagtcggacgactcatcagcgaaagaatggt	CRISPR spacer
gaagtcggacgcctcatccgcgagaagacagc	Protospacer
*********** ****** ****.*..*..*.

44. spacer 10.24|4119849|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.75

gaagtcggacgactcatcagcgaaagaatggt	CRISPR spacer
gaagtcggacgcctcatccgcgagaagacagc	Protospacer
*********** ****** ****.*..*..*.

45. spacer 10.24|4119849|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 8, identity: 0.75

gaagtcggacgactcatcagcgaaagaatggt	CRISPR spacer
gaagtcggacgcctcatccgcgagaagacagc	Protospacer
*********** ****** ****.*..*..*.

46. spacer 10.24|4119849|32|NC_011884|CRISPRCasFinder,CRT matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.75

gaagtcggacgactcatcagcgaaagaatggt	CRISPR spacer
gaagtcggacgcctcatccgcgagaagacagc	Protospacer
*********** ****** ****.*..*..*.

47. spacer 10.32|4120340|33|NC_011884|CRISPRCasFinder,CRT matches to AP014045 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C12-MedDCM-OCT-S26-C148, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.758

--ggtcgggtggtttttttattgataataaattca	CRISPR spacer
gtggtt--ttgctttttttattggtaataaattag	Protospacer
  ***.   ** ***********.********* .

48. spacer 10.32|4120340|33|NC_011884|CRISPRCasFinder,CRT matches to AP014054 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C12B-MedDCM-OCT-S33-C14, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.758

--ggtcgggtggtttttttattgataataaattca	CRISPR spacer
gtggtt--ttgctttttttattggtaataaattag	Protospacer
  ***.   ** ***********.********* .

49. spacer 10.32|4120340|33|NC_011884|CRISPRCasFinder,CRT matches to AP014053 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C12B-MedDCM-OCT-S29-C16, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.758

--ggtcgggtggtttttttattgataataaattca	CRISPR spacer
gtggtt--ttgctttttttattggtaataaattag	Protospacer
  ***.   ** ***********.********* .

50. spacer 10.32|4120340|33|NC_011884|CRISPRCasFinder,CRT matches to AP014060 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C12B-MedDCM-OCT-S45-C20, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.758

--ggtcgggtggtttttttattgataataaattca	CRISPR spacer
gtggtt--ttgctttttttattggtaataaattag	Protospacer
  ***.   ** ***********.********* .

51. spacer 10.32|4120340|33|NC_011884|CRISPRCasFinder,CRT matches to AP014480 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C12-MedDCM-OCT-S39-C236, *** SEQUENCING IN PROGRESS ***, 3 ordered pieces) position: , mismatch: 8, identity: 0.758

--ggtcgggtggtttttttattgataataaattca	CRISPR spacer
gtggtt--ttgctttttttattggtaataaattag	Protospacer
  ***.   ** ***********.********* .

52. spacer 10.32|4120340|33|NC_011884|CRISPRCasFinder,CRT matches to AP014052 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C12B-MedDCM-OCT-S27-C13, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.758

--ggtcgggtggtttttttattgataataaattca	CRISPR spacer
gtggtt--ttgctttttttattggtaataaattag	Protospacer
  ***.   ** ***********.********* .

53. spacer 10.32|4120340|33|NC_011884|CRISPRCasFinder,CRT matches to AP014058 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C12B-MedDCM-OCT-S42-C22, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.758

--ggtcgggtggtttttttattgataataaattca	CRISPR spacer
gtggtt--ttgctttttttattggtaataaattag	Protospacer
  ***.   ** ***********.********* .

54. spacer 10.45|4121146|32|NC_011884|CRISPRCasFinder,CRT matches to MN694219 (Marine virus AFVG_250M758, complete genome) position: , mismatch: 8, identity: 0.75

gctgctgctgcccttgctgaggttgcgaggaa	CRISPR spacer
actgctgctgcccttactgagggtgtaactat	Protospacer
.**************.****** **..*  * 

55. spacer 10.48|4121331|32|NC_011884|CRISPRCasFinder,CRT matches to MT074441 (Salmonella phage brunost, complete genome) position: , mismatch: 8, identity: 0.75

gttgtttgttgctttccagtaagctaaaggtg	CRISPR spacer
gttgtatgtcgctttccagtaagtcaatatcg	Protospacer
***** ***.*************..** . .*

56. spacer 10.48|4121331|32|NC_011884|CRISPRCasFinder,CRT matches to MF740800 (Salmonella phage vB_SenM_PA13076, complete genome) position: , mismatch: 8, identity: 0.75

gttgtttgttgctttccagtaagctaaaggtg	CRISPR spacer
gttgtatgtcgctttccagtaagtcaatctcg	Protospacer
***** ***.*************..**   .*

57. spacer 10.48|4121331|32|NC_011884|CRISPRCasFinder,CRT matches to MT012730 (Salmonella phage vB_SenM-1, complete genome) position: , mismatch: 8, identity: 0.75

gttgtttgttgctttccagtaagctaaaggtg	CRISPR spacer
gttgtatgtcgctttccagtaagtcaatctcg	Protospacer
***** ***.*************..**   .*

58. spacer 10.48|4121331|32|NC_011884|CRISPRCasFinder,CRT matches to MK568062 (Salmonella phage LSE7621, complete genome) position: , mismatch: 8, identity: 0.75

gttgtttgttgctttccagtaagctaaaggtg	CRISPR spacer
gttgtatgtcgctttccagtaagtcaatctcg	Protospacer
***** ***.*************..**   .*

59. spacer 10.48|4121331|32|NC_011884|CRISPRCasFinder,CRT matches to NC_048763 (Salmonella phage SE13, complete genome) position: , mismatch: 8, identity: 0.75

gttgtttgttgctttccagtaagctaaaggtg	CRISPR spacer
gttgtatgtcgctttccagtaagtcaatctcg	Protospacer
***** ***.*************..**   .*

60. spacer 10.48|4121331|32|NC_011884|CRISPRCasFinder,CRT matches to MH181876 (Salmonella phage vB_SalM-LPSEYT, complete genome) position: , mismatch: 8, identity: 0.75

gttgtttgttgctttccagtaagctaaaggtg	CRISPR spacer
gttgtatgtcgctttccagtaagtcaatctcg	Protospacer
***** ***.*************..**   .*

61. spacer 10.48|4121331|32|NC_011884|CRISPRCasFinder,CRT matches to MT074435 (Salmonella phage brorfarstad, complete genome) position: , mismatch: 8, identity: 0.75

gttgtttgttgctttccagtaagctaaaggtg	CRISPR spacer
gttgtatgtcgctttccagtaagtcaatctcg	Protospacer
***** ***.*************..**   .*

62. spacer 10.48|4121331|32|NC_011884|CRISPRCasFinder,CRT matches to MT074442 (Salmonella phage ciri, complete genome) position: , mismatch: 8, identity: 0.75

gttgtttgttgctttccagtaagctaaaggtg	CRISPR spacer
gttgtatgtcgctttccagtaagtcaatctcg	Protospacer
***** ***.*************..**   .*

63. spacer 10.48|4121331|32|NC_011884|CRISPRCasFinder,CRT matches to MN379740 (Salmonella phage 8-19, complete genome) position: , mismatch: 8, identity: 0.75

gttgtttgttgctttccagtaagctaaaggtg	CRISPR spacer
gttgtatgtcgctttccagtaagtcaatctcg	Protospacer
***** ***.*************..**   .*

64. spacer 10.48|4121331|32|NC_011884|CRISPRCasFinder,CRT matches to MT074438 (Salmonella phage rivia, complete genome) position: , mismatch: 8, identity: 0.75

gttgtttgttgctttccagtaagctaaaggtg	CRISPR spacer
gttgtatgtcgctttccagtaagtcaatctcg	Protospacer
***** ***.*************..**   .*

65. spacer 10.48|4121331|32|NC_011884|CRISPRCasFinder,CRT matches to KX826077 (Salmonella phage UPF_BP2, complete genome) position: , mismatch: 8, identity: 0.75

gttgtttgttgctttccagtaagctaaaggtg	CRISPR spacer
gttgtatgtcgctttccagtaagtcaatctcg	Protospacer
***** ***.*************..**   .*

66. spacer 10.48|4121331|32|NC_011884|CRISPRCasFinder,CRT matches to KX826077 (Salmonella phage UPF_BP2, complete genome) position: , mismatch: 8, identity: 0.75

gttgtttgttgctttccagtaagctaaaggtg	CRISPR spacer
gttgtatgtcgctttccagtaagtcaatctcg	Protospacer
***** ***.*************..**   .*

67. spacer 10.48|4121331|32|NC_011884|CRISPRCasFinder,CRT matches to MT764207 (Escherichia phage JEP7, complete genome) position: , mismatch: 8, identity: 0.75

gttgtttgttgctttccagtaagctaaaggtg	CRISPR spacer
gttgtatgtcgctttccagtaagtcaatctcg	Protospacer
***** ***.*************..**   .*

68. spacer 10.48|4121331|32|NC_011884|CRISPRCasFinder,CRT matches to NC_048863 (Salmonella phage yarpen, complete genome) position: , mismatch: 8, identity: 0.75

gttgtttgttgctttccagtaagctaaaggtg	CRISPR spacer
gttgtatgtcgctttccagtaagtcaatctcg	Protospacer
***** ***.*************..**   .*

69. spacer 10.48|4121331|32|NC_011884|CRISPRCasFinder,CRT matches to KY608966 (UNVERIFIED: Escherichia phage phiEC1, complete genome) position: , mismatch: 8, identity: 0.75

gttgtttgttgctttccagtaagctaaaggtg	CRISPR spacer
gttgtatgtcgctttccagtaagtcaatctcg	Protospacer
***** ***.*************..**   .*

70. spacer 10.51|4121518|33|NC_011884|CRISPRCasFinder,CRT matches to NC_049380 (Vibrio phage JSF3, complete genome) position: , mismatch: 8, identity: 0.758

gtcccgttgccatttgttccacagcatccaata	CRISPR spacer
ctcccggtgccatttgttctacagctttataga	Protospacer
 ***** ************.***** *.  * *

71. spacer 10.51|4121518|33|NC_011884|CRISPRCasFinder,CRT matches to NC_049350 (Vibrio phage VCO139, complete genome) position: , mismatch: 8, identity: 0.758

gtcccgttgccatttgttccacagcatccaata	CRISPR spacer
ctcccggtgccatttgttctacagctttataga	Protospacer
 ***** ************.***** *.  * *

72. spacer 10.51|4121518|33|NC_011884|CRISPRCasFinder,CRT matches to NC_021540 (Vibrio phage JA-1, complete genome) position: , mismatch: 8, identity: 0.758

gtcccgttgccatttgttccacagcatccaata	CRISPR spacer
ctcccggtgccatttgttctacagctttataga	Protospacer
 ***** ************.***** *.  * *

73. spacer 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT matches to MT723933 (Streptomyces phage Keanu, complete genome) position: , mismatch: 8, identity: 0.75

tcggtcaccccggccgtggtccgcgaagaaga-------	CRISPR spacer
tcggtcaccccgcccgtggtccg-------gacctggcc	Protospacer
************ **********       **       

74. spacer 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT matches to CP058906 (Micromonospora phage pMLP1, complete sequence) position: , mismatch: 8, identity: 0.75

tcggt--caccccggccgtggtccgcgaagaaga	CRISPR spacer
--ggctacaccccggccgaggtccgcgaggacat	Protospacer
  **.  *********** *********.** . 

75. spacer 10.69|4122632|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP054613 (Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.75

gggtgattattggtccgaatggcgcaggtaag	CRISPR spacer
acggcttgatcggtgcgaatggcgcaggtaag	Protospacer
. *   * **.*** *****************

76. spacer 10.69|4122632|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP024200 (Thalassospira marina strain CSC3H3 plasmid pCSC3H3, complete sequence) position: , mismatch: 8, identity: 0.75

gggtgattattggtccgaatggcgcaggtaag	CRISPR spacer
acgcggtcattggcccgaatggcgcgggtaaa	Protospacer
. *.*.*.*****.***********.*****.

77. spacer 10.101|4121764|33|NC_011884|PILER-CR matches to CP058906 (Micromonospora phage pMLP1, complete sequence) position: , mismatch: 8, identity: 0.758

tcggt--caccccggccgtggtccgcgaagaagac	CRISPR spacer
--ggctacaccccggccgaggtccgcgaggacatc	Protospacer
  **.  *********** *********.** . *

78. spacer 8.1|2040750|34|NC_011884|PILER-CR matches to NZ_CP025810 (Sulfitobacter sp. SK025 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735

gccatctccgcccgaggctgtggt----accgcgaaat	CRISPR spacer
gccattcccgcccgaggctgtggtcgtgaccata----	Protospacer
*****..*****************    ***...    

79. spacer 8.2|2040801|34|NC_011884|PILER-CR matches to MT740244 (Proteus phage 3H10_20, partial genome) position: , mismatch: 9, identity: 0.735

gccatctccaccagaagcagatccaccccgataa	CRISPR spacer
actgtcatcaccagaagaagatccacccctattc	Protospacer
.*..** .********* *********** **  

80. spacer 8.3|2040852|31|NC_011884|PILER-CR matches to NC_011143 (Phenylobacterium zucineum HLK1 plasmid, complete sequence) position: , mismatch: 9, identity: 0.71

cccgccgccgccagacgctgtgccgcgaaat	CRISPR spacer
gacgctgccgccagaggctgtgccgctggtc	Protospacer
  ***.********* ********** .. .

81. spacer 8.3|2040852|31|NC_011884|PILER-CR matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.71

cccgccgccgccagacgctgtgccgcgaaat	CRISPR spacer
gccgccaccgccagacgctgcgccagcggct	Protospacer
 *****.*************.***.  .. *

82. spacer 8.3|2040852|31|NC_011884|PILER-CR matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71

cccgccgccgccagacgctgtgccgcgaaat	CRISPR spacer
gccgccgccgccgaacgctgtgccagcgtac	Protospacer
 ***********..**********.  . *.

83. spacer 8.3|2040852|31|NC_011884|PILER-CR matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 9, identity: 0.71

cccgccgccgccagacgctgtgccgcgaaat	CRISPR spacer
gccgccaccgccagacgctgcgccagcggct	Protospacer
 *****.*************.***.  .. *

84. spacer 8.3|2040852|31|NC_011884|PILER-CR matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 9, identity: 0.71

cccgccgccgccagacgctgtgccgcgaaat	CRISPR spacer
gccgccaccgccagacgctgcgccagcggct	Protospacer
 *****.*************.***.  .. *

85. spacer 8.3|2040852|31|NC_011884|PILER-CR matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71

cccgccgccgccagacgctgtgccgcgaaat	CRISPR spacer
gccgccgccgccgaacgctgtgccagcgtac	Protospacer
 ***********..**********.  . *.

86. spacer 8.3|2040852|31|NC_011884|PILER-CR matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 9, identity: 0.71

cccgccgccgccagacgctgtgccgcgaaat	CRISPR spacer
gccgccgccgccgaacgctgtgccagcgtac	Protospacer
 ***********..**********.  . *.

87. spacer 8.3|2040852|31|NC_011884|PILER-CR matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71

cccgccgccgccagacgctgtgccgcgaaat	CRISPR spacer
gccgccgccgccgaacgctgtgccagcgtac	Protospacer
 ***********..**********.  . *.

88. spacer 8.3|2040852|31|NC_011884|PILER-CR matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71

cccgccgccgccagacgctgtgccgcgaaat	CRISPR spacer
gccgccgccgccgaacgctgtgccagcgtac	Protospacer
 ***********..**********.  . *.

89. spacer 8.3|2040852|31|NC_011884|PILER-CR matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71

cccgccgccgccagacgctgtgccgcgaaat	CRISPR spacer
gccgccgccgccgaacgctgtgccagcgtac	Protospacer
 ***********..**********.  . *.

90. spacer 8.3|2040852|31|NC_011884|PILER-CR matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.71

cccgccgccgccagacgctgtgccgcgaaat	CRISPR spacer
gccgccaccgccagacgctgcgccagcggct	Protospacer
 *****.*************.***.  .. *

91. spacer 10.12|4119107|33|NC_011884|CRISPRCasFinder,CRT matches to NZ_LR723678 (Arsenite-oxidising bacterium NT-25 plasmid 2) position: , mismatch: 9, identity: 0.727

ctcagcatggacggggggcaattgttttctaga	CRISPR spacer
cccttcaaggacggggggcaactgttttccgcc	Protospacer
*.*  ** *************.*******..  

92. spacer 10.12|4119107|33|NC_011884|CRISPRCasFinder,CRT matches to NZ_FO082821 (Rhizobium sp. NT-26 plasmid NT26_p1, complete sequence) position: , mismatch: 9, identity: 0.727

ctcagcatggacggggggcaattgttttctaga	CRISPR spacer
cccttcaaggacggggggcaactgttttccgcc	Protospacer
*.*  ** *************.*******..  

93. spacer 10.16|4119356|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP043831 (Bacillus sp. BS98 plasmid unnamed1) position: , mismatch: 9, identity: 0.719

gaatataaaataaatagcttgatcaagggtga	CRISPR spacer
gaacttaaaataaatagcttgataacatggag	Protospacer
***. ****************** * . * ..

94. spacer 10.16|4119356|32|NC_011884|CRISPRCasFinder,CRT matches to CP046512 (Bacillus cereus strain JHU plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719

gaatataaaataaatagcttgatcaagggtga	CRISPR spacer
gaacttaaaataaatagcttgataacaaggag	Protospacer
***. ****************** * ..* ..

95. spacer 10.32|4120340|33|NC_011884|CRISPRCasFinder,CRT matches to MT080583 (UNVERIFIED: Staphylococcus phage vB_SauM_EW13, complete genome) position: , mismatch: 9, identity: 0.727

ggtcgggtggtttttttattgataataaattca	CRISPR spacer
aatggggtggtttttttatttataataagggtt	Protospacer
..* **************** *******.  . 

96. spacer 10.34|4120463|32|NC_011884|CRISPRCasFinder,CRT matches to NC_014534 (Gloeothece verrucosa PCC 7822 plasmid Cy782202, complete sequence) position: , mismatch: 9, identity: 0.719

gcccagtcggtaatcatgaattgcttggtgtt	CRISPR spacer
ggggcaaaggtaatgatgaattgcttggtttt	Protospacer
*    .  ****** ************** **

97. spacer 10.35|4120524|33|NC_011884|CRISPRCasFinder,CRT matches to NC_014825 (Ruminococcus albus 7 = DSM 20455 plasmid pRUMAL02, complete sequence) position: , mismatch: 9, identity: 0.727

tgctgccgataaaatccaaatcaatgattgtgt	CRISPR spacer
agccgccgataaaatcgaaatcaataccggaat	Protospacer
 **.************ ********. . * .*

98. spacer 10.37|4120648|33|NC_011884|CRISPRCasFinder,CRT matches to NC_014825 (Ruminococcus albus 7 = DSM 20455 plasmid pRUMAL02, complete sequence) position: , mismatch: 9, identity: 0.727

tgctgccgataaaatccaaatcaatgattgtgt	CRISPR spacer
agccgccgataaaatcgaaatcaataccggaat	Protospacer
 **.************ ********. . * .*

99. spacer 10.45|4121146|32|NC_011884|CRISPRCasFinder,CRT matches to HG796416 (Uncultured bacterium plasmid pRGI01031) position: , mismatch: 9, identity: 0.719

gctgctgctgcccttgctgaggttgcgaggaa	CRISPR spacer
ctcgccgctgccgttgctgaggttgcaaagt-	Protospacer
 ..**.****** *************.*.*  

100. spacer 10.48|4121331|32|NC_011884|CRISPRCasFinder,CRT matches to NC_048864 (Salmonella phage birk, complete genome) position: , mismatch: 9, identity: 0.719

gttgtttgttgctttccagtaagctaaaggtg	CRISPR spacer
gttgtatgtcgctttccagtaagtcaatctca	Protospacer
***** ***.*************..**   ..

101. spacer 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

tcggtcaccccggccgtggtccgcgaagaaga	CRISPR spacer
gtgccgaccgcggccgtggtgcgcgaagacaa	Protospacer
 .* . *** ********** ******** .*

102. spacer 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 9, identity: 0.719

tcggtcaccccggccgtggtccgcgaagaaga	CRISPR spacer
gtgccgaccgcggccgtggtgcgcgaagacaa	Protospacer
 .* . *** ********** ******** .*

103. spacer 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcggtcaccccggccgtggtccgcgaagaaga	CRISPR spacer
gtgccgaccgcggccgtggtgcgcgaagacaa	Protospacer
 .* . *** ********** ******** .*

104. spacer 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcggtcaccccggccgtggtccgcgaagaaga	CRISPR spacer
gtgccgaccgcggccgtggtgcgcgaagacaa	Protospacer
 .* . *** ********** ******** .*

105. spacer 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcggtcaccccggccgtggtccgcgaagaaga	CRISPR spacer
gtgccgaccgcggccgtggtgcgcgaagacaa	Protospacer
 .* . *** ********** ******** .*

106. spacer 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcggtcaccccggccgtggtccgcgaagaaga	CRISPR spacer
gtgccgaccgcggccgtggtgcgcgaagacaa	Protospacer
 .* . *** ********** ******** .*

107. spacer 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcggtcaccccggccgtggtccgcgaagaaga	CRISPR spacer
gtgccgaccgcggccgtggtgcgcgaagacaa	Protospacer
 .* . *** ********** ******** .*

108. spacer 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 9, identity: 0.719

tcggtcaccccggccgtggtccgcgaagaaga	CRISPR spacer
gtgccgacctcggccgtggtgcgcgaagacaa	Protospacer
 .* . ***.********** ******** .*

109. spacer 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcggtcaccccggccgtggtccgcgaagaaga	CRISPR spacer
gtgccgaccgcggccgtggtgcgcgaagacaa	Protospacer
 .* . *** ********** ******** .*

110. spacer 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcggtcaccccggccgtggtccgcgaagaaga	CRISPR spacer
gtgccgaccgcggccgtggtgcgcgaagacaa	Protospacer
 .* . *** ********** ******** .*

111. spacer 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tcggtcaccccggccgtggtccgcgaagaaga	CRISPR spacer
gtgccgaccgcggccgtggtgcgcgaagacaa	Protospacer
 .* . *** ********** ******** .*

112. spacer 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcggtcaccccggccgtggtccgcgaagaaga	CRISPR spacer
gtgccgaccgcggccgtggtgcgcgaagacaa	Protospacer
 .* . *** ********** ******** .*

113. spacer 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tcggtcaccccggccgtggtccgcgaagaaga	CRISPR spacer
gtgccgaccgcggccgtggtgcgcgaagacaa	Protospacer
 .* . *** ********** ******** .*

114. spacer 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcggtcaccccggccgtggtccgcgaagaaga	CRISPR spacer
gtgccgaccgcggccgtggtgcgcgaagacaa	Protospacer
 .* . *** ********** ******** .*

115. spacer 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 9, identity: 0.719

tcggtcaccccggccgtggtccgcgaagaaga	CRISPR spacer
gtgccgaccgcggccgtggtgcgcgaagacaa	Protospacer
 .* . *** ********** ******** .*

116. spacer 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcggtcaccccggccgtggtccgcgaagaaga	CRISPR spacer
gtgccgaccgcggccgtggtgcgcgaagacaa	Protospacer
 .* . *** ********** ******** .*

117. spacer 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 9, identity: 0.719

tcggtcaccccggccgtggtccgcgaagaaga	CRISPR spacer
gtgccgaccgcggccgtggtgcgcgaagacaa	Protospacer
 .* . *** ********** ******** .*

118. spacer 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcggtcaccccggccgtggtccgcgaagaaga	CRISPR spacer
gtgccgaccgcggccgtggtgcgcgaagacaa	Protospacer
 .* . *** ********** ******** .*

119. spacer 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcggtcaccccggccgtggtccgcgaagaaga	CRISPR spacer
gtgccgaccgcggccgtggtgcgcgaagacaa	Protospacer
 .* . *** ********** ******** .*

120. spacer 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcggtcaccccggccgtggtccgcgaagaaga	CRISPR spacer
gtgccgaccgcggccgtggtgcgcgaagacaa	Protospacer
 .* . *** ********** ******** .*

121. spacer 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tcggtcaccccggccgtggtccgcgaagaaga	CRISPR spacer
gtgccgaccgcggccgtggtgcgcgaagacaa	Protospacer
 .* . *** ********** ******** .*

122. spacer 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 9, identity: 0.719

tcggtcaccccggccgtggtccgcgaagaaga	CRISPR spacer
gtgccgaccgcggccgtggtgcgcgaagacaa	Protospacer
 .* . *** ********** ******** .*

123. spacer 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcggtcaccccggccgtggtccgcgaagaaga	CRISPR spacer
gtgccgaccgcggccgtggtgcgcgaagacaa	Protospacer
 .* . *** ********** ******** .*

124. spacer 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcggtcaccccggccgtggtccgcgaagaaga	CRISPR spacer
gtgccgaccgcggccgtggtgcgcgaagacaa	Protospacer
 .* . *** ********** ******** .*

125. spacer 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcggtcaccccggccgtggtccgcgaagaaga	CRISPR spacer
gtgccgaccgcggccgtggtgcgcgaagacaa	Protospacer
 .* . *** ********** ******** .*

126. spacer 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tcggtcaccccggccgtggtccgcgaagaaga	CRISPR spacer
gtgccgaccgcggccgtggtgcgcgaagacaa	Protospacer
 .* . *** ********** ******** .*

127. spacer 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tcggtcaccccggccgtggtccgcgaagaaga	CRISPR spacer
gtgccgaccgcggccgtggtgcgcgaagacaa	Protospacer
 .* . *** ********** ******** .*

128. spacer 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tcggtcaccccggccgtggtccgcgaagaaga	CRISPR spacer
gtgccgaccgcggccgtggtgcgcgaagacaa	Protospacer
 .* . *** ********** ******** .*

129. spacer 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tcggtcaccccggccgtggtccgcgaagaaga	CRISPR spacer
gtgccgaccgcggccgtggtgcgcgaagacaa	Protospacer
 .* . *** ********** ******** .*

130. spacer 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tcggtcaccccggccgtggtccgcgaagaaga	CRISPR spacer
gtgccgaccgcggccgtggtgcgcgaagacaa	Protospacer
 .* . *** ********** ******** .*

131. spacer 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tcggtcaccccggccgtggtccgcgaagaaga	CRISPR spacer
gtgccgaccgcggccgtggtgcgcgaagacaa	Protospacer
 .* . *** ********** ******** .*

132. spacer 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tcggtcaccccggccgtggtccgcgaagaaga	CRISPR spacer
gtgccgaccgcggccgtggtgcgcgaagacaa	Protospacer
 .* . *** ********** ******** .*

133. spacer 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tcggtcaccccggccgtggtccgcgaagaaga	CRISPR spacer
gtgccgaccgcggccgtggtgcgcgaagacaa	Protospacer
 .* . *** ********** ******** .*

134. spacer 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tcggtcaccccggccgtggtccgcgaagaaga	CRISPR spacer
gtgccgaccgcggccgtggtgcgcgaagacaa	Protospacer
 .* . *** ********** ******** .*

135. spacer 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tcggtcaccccggccgtggtccgcgaagaaga	CRISPR spacer
gtgccgaccgcggccgtggtgcgcgaagacaa	Protospacer
 .* . *** ********** ******** .*

136. spacer 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tcggtcaccccggccgtggtccgcgaagaaga	CRISPR spacer
gtgccgaccgcggccgtggtgcgcgaagacaa	Protospacer
 .* . *** ********** ******** .*

137. spacer 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tcggtcaccccggccgtggtccgcgaagaaga	CRISPR spacer
gtgccgaccgcggccgtggtgcgcgaagacaa	Protospacer
 .* . *** ********** ******** .*

138. spacer 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tcggtcaccccggccgtggtccgcgaagaaga	CRISPR spacer
gtgccgaccgcggccgtggtgcgcgaagacaa	Protospacer
 .* . *** ********** ******** .*

139. spacer 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tcggtcaccccggccgtggtccgcgaagaaga	CRISPR spacer
gtgccgaccgcggccgtggtgcgcgaagacaa	Protospacer
 .* . *** ********** ******** .*

140. spacer 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tcggtcaccccggccgtggtccgcgaagaaga	CRISPR spacer
gtgccgaccgcggccgtggtgcgcgaagacaa	Protospacer
 .* . *** ********** ******** .*

141. spacer 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcggtcaccccggccgtggtccgcgaagaaga	CRISPR spacer
gtgccgaccgcggccgtggtgcgcgaagacaa	Protospacer
 .* . *** ********** ******** .*

142. spacer 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tcggtcaccccggccgtggtccgcgaagaaga	CRISPR spacer
gtgccgaccgcggccgtggtgcgcgaagacaa	Protospacer
 .* . *** ********** ******** .*

143. spacer 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tcggtcaccccggccgtggtccgcgaagaaga	CRISPR spacer
gtgccgaccgcggccgtggtgcgcgaagacaa	Protospacer
 .* . *** ********** ******** .*

144. spacer 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcggtcaccccggccgtggtccgcgaagaaga	CRISPR spacer
gtgccgaccgcggccgtggtgcgcgaagacaa	Protospacer
 .* . *** ********** ******** .*

145. spacer 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcggtcaccccggccgtggtccgcgaagaaga	CRISPR spacer
gtgccgaccgcggccgtggtgcgcgaagacaa	Protospacer
 .* . *** ********** ******** .*

146. spacer 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcggtcaccccggccgtggtccgcgaagaaga	CRISPR spacer
gtgccgaccgcggccgtggtgcgcgaagacaa	Protospacer
 .* . *** ********** ******** .*

147. spacer 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcggtcaccccggccgtggtccgcgaagaaga	CRISPR spacer
gtgccgaccgcggccgtggtgcgcgaagacaa	Protospacer
 .* . *** ********** ******** .*

148. spacer 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tcggtcaccccggccgtggtccgcgaagaaga	CRISPR spacer
gtgccgaccgcggccgtggtgcgcgaagacaa	Protospacer
 .* . *** ********** ******** .*

149. spacer 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tcggtcaccccggccgtggtccgcgaagaaga	CRISPR spacer
gtgccgaccgcggccgtggtgcgcgaagacaa	Protospacer
 .* . *** ********** ******** .*

150. spacer 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tcggtcaccccggccgtggtccgcgaagaaga	CRISPR spacer
gtgccgaccgcggccgtggtgcgcgaagacaa	Protospacer
 .* . *** ********** ******** .*

151. spacer 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tcggtcaccccggccgtggtccgcgaagaaga	CRISPR spacer
gtgccgaccgcggccgtggtgcgcgaagacaa	Protospacer
 .* . *** ********** ******** .*

152. spacer 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 9, identity: 0.719

tcggtcaccccggccgtggtccgcgaagaaga	CRISPR spacer
gtgccgaccgcggccgtggtgcgcgaagacaa	Protospacer
 .* . *** ********** ******** .*

153. spacer 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tcggtcaccccggccgtggtccgcgaagaaga	CRISPR spacer
gtgccgaccgcggccgtggtgcgcgaagacaa	Protospacer
 .* . *** ********** ******** .*

154. spacer 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tcggtcaccccggccgtggtccgcgaagaaga	CRISPR spacer
gtgccgaccgcggccgtggtgcgcgaagacaa	Protospacer
 .* . *** ********** ******** .*

155. spacer 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tcggtcaccccggccgtggtccgcgaagaaga	CRISPR spacer
gtgccgaccgcggccgtggtgcgcgaagacaa	Protospacer
 .* . *** ********** ******** .*

156. spacer 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tcggtcaccccggccgtggtccgcgaagaaga	CRISPR spacer
gtgccgaccgcggccgtggtgcgcgaagacaa	Protospacer
 .* . *** ********** ******** .*

157. spacer 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tcggtcaccccggccgtggtccgcgaagaaga	CRISPR spacer
gtgccgaccgcggccgtggtgcgcgaagacaa	Protospacer
 .* . *** ********** ******** .*

158. spacer 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tcggtcaccccggccgtggtccgcgaagaaga	CRISPR spacer
gtgccgaccgcggccgtggtgcgcgaagacaa	Protospacer
 .* . *** ********** ******** .*

159. spacer 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tcggtcaccccggccgtggtccgcgaagaaga	CRISPR spacer
gtgccgaccgcggccgtggtgcgcgaagacaa	Protospacer
 .* . *** ********** ******** .*

160. spacer 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tcggtcaccccggccgtggtccgcgaagaaga	CRISPR spacer
gtgccgaccgcggccgtggtgcgcgaagacaa	Protospacer
 .* . *** ********** ******** .*

161. spacer 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tcggtcaccccggccgtggtccgcgaagaaga	CRISPR spacer
gtgccgaccgcggccgtggtgcgcgaagacaa	Protospacer
 .* . *** ********** ******** .*

162. spacer 10.63|4122261|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 9, identity: 0.719

gataggtgcaatgtgtttgccaccttcgtata	CRISPR spacer
gctctgtccaaggtgtttgccaccttcgaccc	Protospacer
* *  ** *** ****************  . 

163. spacer 10.69|4122632|32|NC_011884|CRISPRCasFinder,CRT matches to NC_008270 (Rhodococcus jostii RHA1 plasmid pRHL2, complete sequence) position: , mismatch: 9, identity: 0.719

gggtgattattggtccgaatggcgcaggtaag	CRISPR spacer
ttgccctgcttgggccgaatggcgcaggcaag	Protospacer
  *.  *  **** **************.***

164. spacer 10.69|4122632|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP028385 (Providencia heimbachae strain 99101 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

gggtgattattggtccgaatggcgcaggtaag	CRISPR spacer
ttgccttaattggtccgaatggttcaggtaaa	Protospacer
  *.  * **************. *******.

165. spacer 10.91|4121146|33|NC_011884|PILER-CR matches to MN694219 (Marine virus AFVG_250M758, complete genome) position: , mismatch: 9, identity: 0.727

gctgctgctgcccttgctgaggttgcgaggaac	CRISPR spacer
actgctgctgcccttactgagggtgtaactatt	Protospacer
.**************.****** **..*  * .

166. spacer 10.97|4121518|34|NC_011884|PILER-CR matches to NC_049350 (Vibrio phage VCO139, complete genome) position: , mismatch: 9, identity: 0.735

gtcccgttgccatttgttccacagcatccaatac	CRISPR spacer
ctcccggtgccatttgttctacagctttatagaa	Protospacer
 ***** ************.***** *.  * * 

167. spacer 10.97|4121518|34|NC_011884|PILER-CR matches to NC_021540 (Vibrio phage JA-1, complete genome) position: , mismatch: 9, identity: 0.735

gtcccgttgccatttgttccacagcatccaatac	CRISPR spacer
ctcccggtgccatttgttctacagctttatagaa	Protospacer
 ***** ************.***** *.  * * 

168. spacer 10.97|4121518|34|NC_011884|PILER-CR matches to NC_049380 (Vibrio phage JSF3, complete genome) position: , mismatch: 9, identity: 0.735

gtcccgttgccatttgttccacagcatccaatac	CRISPR spacer
ctcccggtgccatttgttctacagctttatagaa	Protospacer
 ***** ************.***** *.  * * 

169. spacer 10.115|4122632|33|NC_011884|PILER-CR matches to NZ_CP054613 (Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.727

gggtgattattggtccgaatggcgcaggtaaga	CRISPR spacer
acggcttgatcggtgcgaatggcgcaggtaagt	Protospacer
. *   * **.*** ***************** 

170. spacer 8.1|2040750|34|NC_011884|PILER-CR matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 10, identity: 0.706

gccatctccgcccgaggctgtggtaccgcgaaat	CRISPR spacer
aagagggacgcccgaggctgtggaacagcgaaag	Protospacer
.  *    *************** ** ****** 

171. spacer 8.3|2040852|31|NC_011884|PILER-CR matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.677

cccgccgccgccagacgctgtgccgcgaaat	CRISPR spacer
gccgccgccgccgaacgctgtgccagcgtgc	Protospacer
 ***********..**********.  . ..

172. spacer 8.3|2040852|31|NC_011884|PILER-CR matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 10, identity: 0.677

cccgccgccgccagacgctgtgccgcgaaat	CRISPR spacer
gccgccgccgccgaacgctgtgccagcgtgc	Protospacer
 ***********..**********.  . ..

173. spacer 8.3|2040852|31|NC_011884|PILER-CR matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.677

cccgccgccgccagacgctgtgccgcgaaat	CRISPR spacer
gccgccgccgccgaacgctgtgccagcgtgc	Protospacer
 ***********..**********.  . ..

174. spacer 8.3|2040852|31|NC_011884|PILER-CR matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.677

cccgccgccgccagacgctgtgccgcgaaat	CRISPR spacer
gccgccgccgccgaacgctgtgccagcgtgc	Protospacer
 ***********..**********.  . ..

175. spacer 8.3|2040852|31|NC_011884|PILER-CR matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.677

cccgccgccgccagacgctgtgccgcgaaat	CRISPR spacer
gccgccgccgccgaacgctgtgccagcgtgc	Protospacer
 ***********..**********.  . ..

176. spacer 8.3|2040852|31|NC_011884|PILER-CR matches to NZ_CP016891 (Pantoea agglomerans strain C410P1 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.677

cccgccgccgccagacgctgtgccgcgaaat	CRISPR spacer
tggcccgccgcctgacgctgtgccacggtta	Protospacer
.   ******** ***********.**.   

177. spacer 9.3|2422003|35|NC_011884|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029986 (Sphingomonas sp. FARSPH plasmid p01, complete sequence) position: , mismatch: 10, identity: 0.714

caattcttagccgatcggattgaggaactgaccga	CRISPR spacer
cgccgccatgccgatcggatggaggaacagaccgc	Protospacer
*. . *.  *********** ******* ***** 

178. spacer 9.35|2424350|35|NC_011884|PILER-CR,CRISPRCasFinder,CRT matches to CP003955 (Rhodococcus opacus PD630 plasmid 6, complete sequence) position: , mismatch: 10, identity: 0.714

acgattccgggcgatgcccggcgcgacggcgagga	CRISPR spacer
ctcgatccgggcgatgccggccgcgacggcgtgtg	Protospacer
 . . ************* * ********** * .

179. spacer 9.35|2424350|35|NC_011884|PILER-CR,CRISPRCasFinder,CRT matches to NC_011887 (Methylobacterium nodulans ORS 2060 plasmid pMNOD02, complete sequence) position: , mismatch: 10, identity: 0.714

acgattccgggcgatgcccggcgcgacggcgagga	CRISPR spacer
aaggcggcggtcgatgcgcggcgcgacggcgacct	Protospacer
* *..  *** ****** **************   

180. spacer 10.7|4118797|33|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP049735 (Rhizobium leguminosarum strain A1 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.697

caggagccacgtccaagccaggaagaggcaagc	CRISPR spacer
caggaaccacgtccaggccaggaatgttcgttg	Protospacer
*****.*********.******** .  *.   

181. spacer 10.7|4118797|33|NC_011884|CRISPRCasFinder,CRT matches to CP049735 (Rhizobium leguminosarum strain A1 plasmid pRLa12, complete sequence) position: , mismatch: 10, identity: 0.697

caggagccacgtccaagccaggaagaggcaagc	CRISPR spacer
caggaaccacgtccaggccaggaatgttcgttg	Protospacer
*****.*********.******** .  *.   

182. spacer 10.22|4119727|32|NC_011884|CRISPRCasFinder,CRT matches to JQ680355 (Unidentified phage clone 1013_scaffold7838 genomic sequence) position: , mismatch: 10, identity: 0.688

gctaacctgacggcggcgttcttccgcaacat	CRISPR spacer
gacgacctgaaggcggcgatcttccgcgtgcg	Protospacer
* ..****** ******* ********.    

183. spacer 10.32|4120340|33|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP018877 (Bacillus megaterium strain JX285 plasmid 4, complete sequence) position: , mismatch: 10, identity: 0.697

ggtcgggtggtttttttattgataataaattca	CRISPR spacer
taaacattggtttttgtgttgataataaattta	Protospacer
 .   . ******** *.*************.*

184. spacer 10.39|4120772|34|NC_011884|CRISPRCasFinder,CRT matches to MH825713 (Mycobacterium phage Zalkecks, complete genome) position: , mismatch: 10, identity: 0.706

gttcagtcatcgtccgctgcctcactatctctgg	CRISPR spacer
attcggtcatcgtccgcttcctcaccgatcccga	Protospacer
.***.************* ******.. ..*.*.

185. spacer 10.45|4121146|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP016462 (Blastomonas sp. RAC04 plasmid pBSY18_1, complete sequence) position: , mismatch: 10, identity: 0.688

gctgctgctgcccttgctgaggttgcgaggaa	CRISPR spacer
ccggctgctgcgcgtgctgaggttgccgcatt	Protospacer
 * ******** * ************ . .  

186. spacer 10.45|4121146|32|NC_011884|CRISPRCasFinder,CRT matches to MG592506 (Vibrio phage 1.135.O._10N.222.54.B6, partial genome) position: , mismatch: 10, identity: 0.688

gctgctgctgcccttgctgaggttgcgaggaa	CRISPR spacer
caaactgctgcccttgctgctgttgcggtgcg	Protospacer
   .***************  ******. * .

187. spacer 10.45|4121146|32|NC_011884|CRISPRCasFinder,CRT matches to MG592583 (Vibrio phage 1.213.O._10N.222.54.F10, partial genome) position: , mismatch: 10, identity: 0.688

gctgctgctgcccttgctgaggttgcgaggaa	CRISPR spacer
caaactgctgcccttgctgctgttgcggtgcg	Protospacer
   .***************  ******. * .

188. spacer 10.47|4121270|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP014284 (Bacillus thuringiensis strain Bt185 plasmid pBT1850294, complete sequence) position: , mismatch: 10, identity: 0.688

agaagtggagtgaaaaagaatggctgacaacg	CRISPR spacer
aaaagtggacttaaaaagaatggctattttgc	Protospacer
*.******* * *************. .    

189. spacer 10.47|4121270|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP032609 (Bacillus thuringiensis strain QZL38 plasmid p.2, complete sequence) position: , mismatch: 10, identity: 0.688

agaagtggagtgaaaaagaatggctgacaacg	CRISPR spacer
aaaagtggacttaaaaagaatggctattttgc	Protospacer
*.******* * *************. .    

190. spacer 10.47|4121270|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_AP018284 (Chondrocystis sp. NIES-4102 plasmid plasmid3 DNA, complete genome) position: , mismatch: 10, identity: 0.688

agaagtggagtgaaaaagaatggctgacaacg	CRISPR spacer
ttagaaagagtcaaaaagaatggcttacaaat	Protospacer
  *.. .**** ************* ****  

191. spacer 10.54|4121703|32|NC_011884|CRISPRCasFinder,CRT matches to MT024862 (Microbacterium phage Alakazam, complete genome) position: , mismatch: 10, identity: 0.688

actgaattagccgatcgcgtctctgatgccta	CRISPR spacer
cagcagccagccggtcgcgtcactgatgcctc	Protospacer
    *...*****.******* ********* 

192. spacer 10.55|4121764|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 10, identity: 0.688

tcggtcaccccggccgtggtccgcgaagaaga	CRISPR spacer
gctgtcaccccggccgagatccgcgagcgcat	Protospacer
 * ************* *.*******. . . 

193. spacer 10.66|4122446|32|NC_011884|CRISPRCasFinder,CRT matches to NZ_CP012641 (Massilia sp. WG5 plasmid unnamed 1, complete sequence) position: , mismatch: 10, identity: 0.688

agtagtccgtccacatcgaagcaggtcacgta	CRISPR spacer
ttcaacgcgtccagaacgaagcaggtcacggt	Protospacer
  .*.. ****** * **************  

194. spacer 10.72|4122817|32|NC_011884|CRISPRCasFinder,CRT matches to KP313531 (Citrobacter phage phiCFP-1, complete genome) position: , mismatch: 10, identity: 0.688

gtttgaatcgtcagcccctgccgtgtataaaa	CRISPR spacer
tacccagtcgtcagcctctaccgtgtataacc	Protospacer
  .. *.*********.**.**********  

195. spacer 10.72|4122817|32|NC_011884|CRISPRCasFinder,CRT matches to NC_028655 (Yersinia phage vB_YenP_AP10, complete genome) position: , mismatch: 10, identity: 0.688

gtttgaatcgtcagcccctgccgtgtataaaa	CRISPR spacer
tacccagtcgtcagccgctaccgtgtataacc	Protospacer
  .. *.********* **.**********  

196. spacer 11.14|4143401|32|NC_011884|PILER-CR matches to MK250029 (Prevotella phage Lak-C1, complete genome) position: , mismatch: 10, identity: 0.688

tcataatttacatctctataatttacatcttt	CRISPR spacer
atttaatttacatgtctttaatttactggtac	Protospacer
 . ********** *** ********   * .

197. spacer 8.2|2040801|34|NC_011884|PILER-CR matches to MF189170 (Arthrobacter phage Arcadia, complete genome) position: , mismatch: 11, identity: 0.676

gccatctccaccagaagcagatccaccccgataa	CRISPR spacer
aagtcgaccaccagaagcagagccacccagagta	Protospacer
.   .  ************** ****** **  *

198. spacer 8.2|2040801|34|NC_011884|PILER-CR matches to MF189172 (Arthrobacter phage Elsa, complete genome) position: , mismatch: 11, identity: 0.676

gccatctccaccagaagcagatccaccccgataa	CRISPR spacer
aagtcgaccaccagaagcagagccacccagagta	Protospacer
.   .  ************** ****** **  *

199. spacer 8.2|2040801|34|NC_011884|PILER-CR matches to MF189174 (Arthrobacter phage Nason, complete genome) position: , mismatch: 11, identity: 0.676

gccatctccaccagaagcagatccaccccgataa	CRISPR spacer
aagtcgaccaccagaagcagagccacccagagta	Protospacer
.   .  ************** ****** **  *

200. spacer 9.44|2425011|35|NC_011884|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015595 (Acinetobacter sp. NCu2D-2 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.686

aacagatagcgatagatcctttgcttgtgaggact	CRISPR spacer
tacagatagcgatagatcatttgtttatttttttc	Protospacer
 ***************** ****.**.*     ..

201. spacer 10.32|4120340|33|NC_011884|CRISPRCasFinder,CRT matches to KU160494 (Vibrio phage vB_VmeM-32, complete genome) position: , mismatch: 11, identity: 0.667

ggtcgggtggtttttttattgataataaattca	CRISPR spacer
atatttgtggtttctttattgataatgaataat	Protospacer
.  .  *******.************.***   

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 202338 : 263712 57 Acanthocystis_turfacea_Chlorella_virus(16.67%) protease,transposase NA
DBSCAN-SWA_2 385883 : 438808 59 Bacillus_phage(33.33%) protease,tRNA,transposase NA
DBSCAN-SWA_3 1596562 : 1633323 28 Bacillus_phage(25.0%) bacteriocin,protease,tRNA,transposase NA
DBSCAN-SWA_4 2935393 : 3009567 56 Hokovirus(14.29%) tRNA,transposase NA
DBSCAN-SWA_5 3013068 : 3072449 50 Bacillus_phage(20.0%) bacteriocin,integrase,transposase attL 3041216:3041230|attR 3076531:3076545
DBSCAN-SWA_6 4249199 : 4256798 8 Tupanvirus(16.67%) NA NA
DBSCAN-SWA_7 4384798 : 4437861 50 Enterobacteria_phage(12.5%) protease,integrase,transposase attL 4373987:4374036|attR 4397548:4397597
DBSCAN-SWA_8 5178334 : 5225493 47 Nostoc_phage(50.0%) protease,transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_011885
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 4735 : 49359 41 Mycobacterium_phage(22.22%) transposase NA
DBSCAN-SWA_2 75398 : 130653 49 Enterobacteria_phage(15.38%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NC_011880
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_011880_1 48240-54633 TypeIII NA
87 spacers
cas2,cas1,csx1

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_011880_2 96801-97206 Orphan NA
5 spacers
WYL,DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_011880_3 98160-99155 Orphan NA
13 spacers
WYL,DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_011880_1 1.1|48276|38|NC_011880|CRISPRCasFinder,CRT 48276-48313 38 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 48276-48313 0 1.0
NC_011880_1 1.2|48350|34|NC_011880|CRISPRCasFinder,CRT 48350-48383 34 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 48350-48383 0 1.0
NC_011880_1 1.3|48420|36|NC_011880|CRISPRCasFinder,CRT,PILER-CR 48420-48455 36 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 48420-48455 0 1.0
NC_011880_1 1.4|48492|35|NC_011880|CRISPRCasFinder,CRT,PILER-CR 48492-48526 35 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 48492-48526 0 1.0
NC_011880_1 1.5|48563|37|NC_011880|CRISPRCasFinder,CRT,PILER-CR 48563-48599 37 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 48563-48599 0 1.0
NC_011880_1 1.6|48636|37|NC_011880|CRISPRCasFinder,CRT,PILER-CR 48636-48672 37 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 48636-48672 0 1.0
NC_011880_1 1.7|48709|36|NC_011880|CRISPRCasFinder,CRT,PILER-CR 48709-48744 36 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 48709-48744 0 1.0
NC_011880_1 1.8|48781|38|NC_011880|CRISPRCasFinder,CRT,PILER-CR 48781-48818 38 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 48781-48818 0 1.0
NC_011880_1 1.9|48855|36|NC_011880|CRISPRCasFinder,CRT,PILER-CR 48855-48890 36 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 48855-48890 0 1.0
NC_011880_1 1.10|48927|39|NC_011880|CRISPRCasFinder,CRT,PILER-CR 48927-48965 39 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 48927-48965 0 1.0
NC_011880_1 1.11|49002|38|NC_011880|CRISPRCasFinder,CRT,PILER-CR 49002-49039 38 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 49002-49039 0 1.0
NC_011880_1 1.12|49076|37|NC_011880|CRISPRCasFinder,CRT,PILER-CR 49076-49112 37 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 49076-49112 0 1.0
NC_011880_1 1.13|49149|36|NC_011880|CRISPRCasFinder,CRT,PILER-CR 49149-49184 36 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 49149-49184 0 1.0
NC_011880_1 1.14|49221|40|NC_011880|CRISPRCasFinder,CRT,PILER-CR 49221-49260 40 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 49221-49260 0 1.0
NC_011880_1 1.15|49297|36|NC_011880|CRISPRCasFinder,CRT,PILER-CR 49297-49332 36 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 49297-49332 0 1.0
NC_011880_1 1.16|49369|34|NC_011880|CRISPRCasFinder,CRT,PILER-CR 49369-49402 34 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 49369-49402 0 1.0
NC_011880_1 1.17|49439|38|NC_011880|CRISPRCasFinder,CRT,PILER-CR 49439-49476 38 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 49439-49476 0 1.0
NC_011880_1 1.18|49513|38|NC_011880|CRISPRCasFinder,CRT,PILER-CR 49513-49550 38 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 49513-49550 0 1.0
NC_011880_1 1.19|49587|36|NC_011880|CRISPRCasFinder,CRT,PILER-CR 49587-49622 36 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 49587-49622 0 1.0
NC_011880_1 1.20|49659|37|NC_011880|CRISPRCasFinder,CRT,PILER-CR 49659-49695 37 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 49659-49695 0 1.0
NC_011880_1 1.21|49732|38|NC_011880|CRISPRCasFinder,CRT,PILER-CR 49732-49769 38 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 49732-49769 0 1.0
NC_011880_1 1.22|49806|40|NC_011880|CRISPRCasFinder,CRT,PILER-CR 49806-49845 40 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 49806-49845 0 1.0
NC_011880_1 1.23|49882|37|NC_011880|CRISPRCasFinder,CRT,PILER-CR 49882-49918 37 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 49882-49918 0 1.0
NC_011880_1 1.24|49955|37|NC_011880|CRISPRCasFinder,CRT,PILER-CR 49955-49991 37 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 49955-49991 0 1.0
NC_011880_1 1.25|50028|36|NC_011880|CRISPRCasFinder,CRT,PILER-CR 50028-50063 36 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 50028-50063 0 1.0
NC_011880_1 1.26|50100|39|NC_011880|CRISPRCasFinder,CRT,PILER-CR 50100-50138 39 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 50100-50138 0 1.0
NC_011880_1 1.27|50175|39|NC_011880|CRISPRCasFinder,CRT,PILER-CR 50175-50213 39 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 50175-50213 0 1.0
NC_011880_1 1.28|50250|39|NC_011880|CRISPRCasFinder,CRT,PILER-CR 50250-50288 39 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 50250-50288 0 1.0
NC_011880_1 1.29|50325|37|NC_011880|CRISPRCasFinder,CRT,PILER-CR 50325-50361 37 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 50325-50361 0 1.0
NC_011880_1 1.30|50398|38|NC_011880|CRISPRCasFinder,CRT,PILER-CR 50398-50435 38 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 50398-50435 0 1.0
NC_011880_1 1.31|50472|36|NC_011880|CRISPRCasFinder,CRT,PILER-CR 50472-50507 36 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 50472-50507 0 1.0
NC_011880_1 1.32|50544|37|NC_011880|CRISPRCasFinder,CRT,PILER-CR 50544-50580 37 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 50544-50580 0 1.0
NC_011880_1 1.33|50617|36|NC_011880|CRISPRCasFinder,CRT,PILER-CR 50617-50652 36 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 50617-50652 0 1.0
NC_011880_1 1.34|50689|36|NC_011880|CRISPRCasFinder,CRT,PILER-CR 50689-50724 36 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 50689-50724 0 1.0
NC_011880_1 1.35|50761|35|NC_011880|CRISPRCasFinder,CRT,PILER-CR 50761-50795 35 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 50761-50795 0 1.0
NC_011880_1 1.36|50832|37|NC_011880|CRISPRCasFinder,CRT,PILER-CR 50832-50868 37 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 50832-50868 0 1.0
NC_011880_1 1.37|50905|39|NC_011880|CRISPRCasFinder,CRT,PILER-CR 50905-50943 39 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 50905-50943 0 1.0
NC_011880_1 1.38|50980|38|NC_011880|CRISPRCasFinder,CRT,PILER-CR 50980-51017 38 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 50980-51017 0 1.0
NC_011880_1 1.39|51054|39|NC_011880|CRISPRCasFinder,CRT,PILER-CR 51054-51092 39 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 51054-51092 0 1.0
NC_011880_1 1.40|51129|36|NC_011880|CRISPRCasFinder,CRT,PILER-CR 51129-51164 36 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 51129-51164 0 1.0
NC_011880_1 1.41|51201|35|NC_011880|CRISPRCasFinder,CRT,PILER-CR 51201-51235 35 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 51201-51235 0 1.0
NC_011880_1 1.42|51272|38|NC_011880|CRISPRCasFinder,CRT,PILER-CR 51272-51309 38 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 51272-51309 0 1.0
NC_011880_1 1.43|51346|40|NC_011880|CRISPRCasFinder,CRT,PILER-CR 51346-51385 40 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 51346-51385 0 1.0
NC_011880_1 1.44|51422|37|NC_011880|CRISPRCasFinder,CRT,PILER-CR 51422-51458 37 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 51422-51458 0 1.0
NC_011880_1 1.45|51495|37|NC_011880|CRISPRCasFinder,CRT,PILER-CR 51495-51531 37 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 51495-51531 0 1.0
NC_011880_1 1.46|51568|38|NC_011880|CRISPRCasFinder,CRT,PILER-CR 51568-51605 38 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 51568-51605 0 1.0
NC_011880_1 1.47|51642|38|NC_011880|CRISPRCasFinder,CRT,PILER-CR 51642-51679 38 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 51642-51679 0 1.0
NC_011880_1 1.48|51716|37|NC_011880|CRISPRCasFinder,CRT,PILER-CR 51716-51752 37 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 51716-51752 0 1.0
NC_011880_1 1.49|51789|37|NC_011880|CRISPRCasFinder,CRT,PILER-CR 51789-51825 37 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 51789-51825 0 1.0
NC_011880_1 1.50|51862|34|NC_011880|CRISPRCasFinder,CRT,PILER-CR 51862-51895 34 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 51862-51895 0 1.0
NC_011880_1 1.51|51932|39|NC_011880|CRISPRCasFinder,CRT,PILER-CR 51932-51970 39 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 51932-51970 0 1.0
NC_011880_1 1.52|52007|36|NC_011880|CRISPRCasFinder,CRT,PILER-CR 52007-52042 36 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 52007-52042 0 1.0
NC_011880_1 1.53|52079|41|NC_011880|CRISPRCasFinder,CRT,PILER-CR 52079-52119 41 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 52079-52119 0 1.0
NC_011880_1 1.54|52156|38|NC_011880|CRISPRCasFinder,CRT,PILER-CR 52156-52193 38 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 52156-52193 0 1.0
NC_011880_1 1.55|52230|37|NC_011880|CRISPRCasFinder,CRT,PILER-CR 52230-52266 37 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 52230-52266 0 1.0
NC_011880_1 1.56|52303|39|NC_011880|CRISPRCasFinder,CRT,PILER-CR 52303-52341 39 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 52303-52341 0 1.0
NC_011880_1 1.57|52378|38|NC_011880|CRISPRCasFinder,CRT,PILER-CR 52378-52415 38 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 52378-52415 0 1.0
NC_011880_1 1.58|52452|36|NC_011880|CRISPRCasFinder,CRT,PILER-CR 52452-52487 36 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 52452-52487 0 1.0
NC_011880_1 1.59|52524|34|NC_011880|CRISPRCasFinder,CRT,PILER-CR 52524-52557 34 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 52524-52557 0 1.0
NC_011880_1 1.60|52594|38|NC_011880|CRISPRCasFinder,CRT,PILER-CR 52594-52631 38 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 52594-52631 0 1.0
NC_011880_1 1.61|52668|37|NC_011880|CRISPRCasFinder,CRT,PILER-CR 52668-52704 37 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 52668-52704 0 1.0
NC_011880_1 1.62|52741|36|NC_011880|CRISPRCasFinder,CRT,PILER-CR 52741-52776 36 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 52741-52776 0 1.0
NC_011880_1 1.63|52813|37|NC_011880|CRISPRCasFinder,CRT,PILER-CR 52813-52849 37 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 52813-52849 0 1.0
NC_011880_1 1.64|52886|36|NC_011880|CRISPRCasFinder,CRT,PILER-CR 52886-52921 36 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 52886-52921 0 1.0
NC_011880_1 1.65|52958|38|NC_011880|CRISPRCasFinder,CRT,PILER-CR 52958-52995 38 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 52958-52995 0 1.0
NC_011880_1 1.66|53032|34|NC_011880|CRISPRCasFinder,CRT 53032-53065 34 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 53032-53065 0 1.0
NC_011880_1 1.67|53102|37|NC_011880|CRISPRCasFinder,CRT 53102-53138 37 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 53102-53138 0 1.0
NC_011880_1 1.68|53175|35|NC_011880|CRISPRCasFinder,CRT 53175-53209 35 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 53175-53209 0 1.0
NC_011880_1 1.69|53246|36|NC_011880|CRISPRCasFinder,CRT 53246-53281 36 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 53246-53281 0 1.0
NC_011880_1 1.70|53318|36|NC_011880|CRISPRCasFinder,CRT 53318-53353 36 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 53318-53353 0 1.0
NC_011880_1 1.71|53390|37|NC_011880|CRISPRCasFinder,CRT 53390-53426 37 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 53390-53426 0 1.0
NC_011880_1 1.72|53463|37|NC_011880|CRISPRCasFinder,CRT 53463-53499 37 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 53463-53499 0 1.0
NC_011880_1 1.73|53536|37|NC_011880|CRISPRCasFinder,CRT 53536-53572 37 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 53536-53572 0 1.0
NC_011880_1 1.74|53609|37|NC_011880|CRISPRCasFinder,CRT 53609-53645 37 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 53609-53645 0 1.0
NC_011880_1 1.75|53682|37|NC_011880|CRISPRCasFinder,CRT 53682-53718 37 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 53682-53718 0 1.0
NC_011880_1 1.76|53755|36|NC_011880|CRISPRCasFinder,CRT 53755-53790 36 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 53755-53790 0 1.0
NC_011880_1 1.77|53827|35|NC_011880|CRISPRCasFinder,CRT 53827-53861 35 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 53827-53861 0 1.0
NC_011880_1 1.78|53898|39|NC_011880|CRISPRCasFinder,CRT 53898-53936 39 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 53898-53936 0 1.0
NC_011880_1 1.79|53973|37|NC_011880|CRISPRCasFinder,CRT 53973-54009 37 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 53973-54009 0 1.0
NC_011880_1 1.80|54046|35|NC_011880|CRISPRCasFinder,CRT 54046-54080 35 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 54046-54080 0 1.0
NC_011880_1 1.81|54117|36|NC_011880|CRISPRCasFinder,CRT 54117-54152 36 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 54117-54152 0 1.0
NC_011880_1 1.82|54189|37|NC_011880|CRISPRCasFinder,CRT 54189-54225 37 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 54189-54225 0 1.0
NC_011880_1 1.83|54262|39|NC_011880|CRISPRCasFinder,CRT 54262-54300 39 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 54262-54300 0 1.0
NC_011880_1 1.84|54337|39|NC_011880|CRISPRCasFinder,CRT 54337-54375 39 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 54337-54375 0 1.0
NC_011880_1 1.85|54412|39|NC_011880|CRISPRCasFinder,CRT 54412-54450 39 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 54412-54450 0 1.0
NC_011880_1 1.86|54487|38|NC_011880|CRISPRCasFinder,CRT 54487-54524 38 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 54487-54524 0 1.0
NC_011880_1 1.87|54561|37|NC_011880|CRISPRCasFinder,CRT 54561-54597 37 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 54561-54597 0 1.0
NC_011880_1 1.88|53032|35|NC_011880|PILER-CR 53032-53066 35 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 53031-53065 0 1.0
NC_011880_1 1.89|53103|37|NC_011880|PILER-CR 53103-53139 37 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 53102-53138 0 1.0
NC_011880_1 1.90|53176|35|NC_011880|PILER-CR 53176-53210 35 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 53175-53209 0 1.0
NC_011880_1 1.91|53247|36|NC_011880|PILER-CR 53247-53282 36 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 53246-53281 0 1.0
NC_011880_1 1.92|53319|36|NC_011880|PILER-CR 53319-53354 36 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 53318-53353 0 1.0
NC_011880_1 1.93|53391|37|NC_011880|PILER-CR 53391-53427 37 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 53390-53426 0 1.0
NC_011880_1 1.94|53464|37|NC_011880|PILER-CR 53464-53500 37 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 53463-53499 0 1.0
NC_011880_1 1.95|53537|37|NC_011880|PILER-CR 53537-53573 37 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 53536-53572 0 1.0
NC_011880_1 1.96|53610|37|NC_011880|PILER-CR 53610-53646 37 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 53609-53645 0 1.0
NC_011880_1 1.97|53683|37|NC_011880|PILER-CR 53683-53719 37 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 53682-53718 0 1.0
NC_011880_1 1.98|53756|36|NC_011880|PILER-CR 53756-53791 36 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 53755-53790 0 1.0
NC_011880_1 1.99|53828|35|NC_011880|PILER-CR 53828-53862 35 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 53827-53861 0 1.0
NC_011880_1 1.100|53899|39|NC_011880|PILER-CR 53899-53937 39 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 53898-53936 0 1.0
NC_011880_1 1.101|53974|37|NC_011880|PILER-CR 53974-54010 37 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 53973-54009 0 1.0
NC_011880_1 1.102|54047|35|NC_011880|PILER-CR 54047-54081 35 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 54046-54080 0 1.0
NC_011880_1 1.103|54118|36|NC_011880|PILER-CR 54118-54153 36 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 54117-54152 0 1.0
NC_011880_1 1.104|54190|37|NC_011880|PILER-CR 54190-54226 37 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 54189-54225 0 1.0
NC_011880_1 1.105|54263|39|NC_011880|PILER-CR 54263-54301 39 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 54262-54300 0 1.0
NC_011880_1 1.106|54338|39|NC_011880|PILER-CR 54338-54376 39 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 54337-54375 0 1.0
NC_011880_1 1.107|54413|39|NC_011880|PILER-CR 54413-54451 39 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 54412-54450 0 1.0
NC_011880_1 1.108|54488|38|NC_011880|PILER-CR 54488-54525 38 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 54487-54524 0 1.0
NC_011880_1 1.109|54562|37|NC_011880|PILER-CR 54562-54598 37 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 54561-54597 0 1.0
NC_011880_2 2.1|96837|38|NC_011880|CRISPRCasFinder 96837-96874 38 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 96837-96874 0 1.0
NC_011880_2 2.2|96911|38|NC_011880|CRISPRCasFinder 96911-96948 38 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 96911-96948 0 1.0
NC_011880_2 2.3|96985|36|NC_011880|CRISPRCasFinder 96985-97020 36 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 96985-97020 0 1.0
NC_011880_2 2.4|97057|37|NC_011880|CRISPRCasFinder 97057-97093 37 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 97057-97093 0 1.0
NC_011880_2 2.5|97130|40|NC_011880|CRISPRCasFinder 97130-97169 40 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 97130-97169 0 1.0
NC_011880_2 2.6|96836|44|NC_011880|PILER-CR 96836-96879 44 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 96836-96879 0 1.0
NC_011880_2 2.7|96910|44|NC_011880|PILER-CR 96910-96953 44 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 96910-96953 0 1.0
NC_011880_2 2.8|96984|42|NC_011880|PILER-CR 96984-97025 42 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 96984-97025 0 1.0
NC_011880_2 2.9|97056|43|NC_011880|PILER-CR 97056-97098 43 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 97056-97098 0 1.0
NC_011880_2 2.10|97129|46|NC_011880|PILER-CR 97129-97174 46 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 97129-97174 0 1.0
NC_011880_2 2.11|96836|51|NC_011880|CRT 96836-96886 51 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 96836-96886 0 1.0
NC_011880_2 2.12|96910|51|NC_011880|CRT 96910-96960 51 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 96910-96960 0 1.0
NC_011880_2 2.13|96984|49|NC_011880|CRT 96984-97032 49 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 96984-97032 0 1.0
NC_011880_2 2.14|97056|50|NC_011880|CRT 97056-97105 50 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 97056-97105 0 1.0
NC_011880_2 2.15|97129|53|NC_011880|CRT 97129-97181 53 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 97129-97181 0 1.0
NC_011880_3 3.1|98196|37|NC_011880|CRISPRCasFinder,CRT 98196-98232 37 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 98196-98232 0 1.0
NC_011880_3 3.2|98269|36|NC_011880|CRISPRCasFinder,CRT,PILER-CR 98269-98304 36 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 98269-98304 0 1.0
NC_011880_3 3.3|98341|37|NC_011880|CRISPRCasFinder,CRT,PILER-CR 98341-98377 37 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 98341-98377 0 1.0
NC_011880_3 3.4|98414|37|NC_011880|CRISPRCasFinder,CRT,PILER-CR 98414-98450 37 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 98414-98450 0 1.0
NC_011880_3 3.5|98487|36|NC_011880|CRISPRCasFinder,CRT,PILER-CR 98487-98522 36 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 98487-98522 0 1.0
NC_011880_3 3.6|98559|39|NC_011880|CRISPRCasFinder,CRT,PILER-CR 98559-98597 39 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 98559-98597 0 1.0
NC_011880_3 3.7|98634|38|NC_011880|CRISPRCasFinder,CRT,PILER-CR 98634-98671 38 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 98634-98671 0 1.0
NC_011880_3 3.8|98708|41|NC_011880|CRISPRCasFinder,CRT,PILER-CR 98708-98748 41 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 98708-98748 0 1.0
NC_011880_3 3.9|98785|35|NC_011880|CRISPRCasFinder,CRT,PILER-CR 98785-98819 35 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 98785-98819 0 1.0
NC_011880_3 3.10|98856|41|NC_011880|CRISPRCasFinder,CRT,PILER-CR 98856-98896 41 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 98856-98896 0 1.0
NC_011880_3 3.11|98933|36|NC_011880|CRISPRCasFinder,CRT,PILER-CR 98933-98968 36 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 98933-98968 0 1.0
NC_011880_3 3.12|99005|40|NC_011880|CRISPRCasFinder,CRT,PILER-CR 99005-99044 40 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 99005-99044 0 1.0
NC_011880_3 3.13|99081|39|NC_011880|CRISPRCasFinder,CRT 99081-99119 39 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 99081-99119 0 1.0
NC_011880_1 1.59|52524|34|NC_011880|CRISPRCasFinder,CRT,PILER-CR 52524-52557 34 AY939844 Prochlorococcus phage P-SSM2, complete genome 206640-206673 6 0.824
NC_011880_1 1.59|52524|34|NC_011880|CRISPRCasFinder,CRT,PILER-CR 52524-52557 34 HQ632825 Prochlorococcus phage P-SSM5 genomic sequence 132701-132734 6 0.824
NC_011880_1 1.59|52524|34|NC_011880|CRISPRCasFinder,CRT,PILER-CR 52524-52557 34 MH319732 Marine virus AG-345-E02 Ga0172268_12 genomic sequence 26250-26283 7 0.794
NC_011880_1 1.50|51862|34|NC_011880|CRISPRCasFinder,CRT,PILER-CR 51862-51895 34 NZ_CP029835 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed5, complete sequence 212272-212305 9 0.735
NC_011880_1 1.66|53032|34|NC_011880|CRISPRCasFinder,CRT 53032-53065 34 NZ_CP044217 Mesorhizobium sp. NIBRBAC000500504 plasmid unnamed, complete sequence 211621-211654 9 0.735
NC_011880_1 1.88|53032|35|NC_011880|PILER-CR 53032-53066 35 NZ_CP044217 Mesorhizobium sp. NIBRBAC000500504 plasmid unnamed, complete sequence 211621-211655 9 0.743
NC_011880_1 1.45|51495|37|NC_011880|CRISPRCasFinder,CRT,PILER-CR 51495-51531 37 NZ_AP022319 Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence 1350086-1350122 11 0.703

1. spacer 1.1|48276|38|NC_011880|CRISPRCasFinder,CRT matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

aactcttccgtcgcgccactgggttgggtgagtggaag	CRISPR spacer
aactcttccgtcgcgccactgggttgggtgagtggaag	Protospacer
**************************************

2. spacer 1.2|48350|34|NC_011880|CRISPRCasFinder,CRT matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

ctagtttatagagttgttcatctgccagttgaaa	CRISPR spacer
ctagtttatagagttgttcatctgccagttgaaa	Protospacer
**********************************

3. spacer 1.3|48420|36|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

gcttcgactcggcagcagggcattaccgaccactga	CRISPR spacer
gcttcgactcggcagcagggcattaccgaccactga	Protospacer
************************************

4. spacer 1.4|48492|35|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

ctgttcatgctccttgcggaaggaggcagtcagct	CRISPR spacer
ctgttcatgctccttgcggaaggaggcagtcagct	Protospacer
***********************************

5. spacer 1.5|48563|37|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

tcgtgttggacagtatcgtaataacgagtttattaat	CRISPR spacer
tcgtgttggacagtatcgtaataacgagtttattaat	Protospacer
*************************************

6. spacer 1.6|48636|37|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

gattgcgggccagtcgcttgaccttgccagttcaaga	CRISPR spacer
gattgcgggccagtcgcttgaccttgccagttcaaga	Protospacer
*************************************

7. spacer 1.7|48709|36|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

aaaatctagctaactggcaaggttttctagatgatt	CRISPR spacer
aaaatctagctaactggcaaggttttctagatgatt	Protospacer
************************************

8. spacer 1.8|48781|38|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

tgtatcgtcattagttaggtatgggtaagggtaagaaa	CRISPR spacer
tgtatcgtcattagttaggtatgggtaagggtaagaaa	Protospacer
**************************************

9. spacer 1.9|48855|36|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

caaaattcattacatcttcttactctaaagacttag	CRISPR spacer
caaaattcattacatcttcttactctaaagacttag	Protospacer
************************************

10. spacer 1.10|48927|39|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

aagaggggataccggagactaacagtgcagggccaggat	CRISPR spacer
aagaggggataccggagactaacagtgcagggccaggat	Protospacer
***************************************

11. spacer 1.11|49002|38|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaagactgaggacggcagcgacctgctgtttgacag	CRISPR spacer
ggtaagactgaggacggcagcgacctgctgtttgacag	Protospacer
**************************************

12. spacer 1.12|49076|37|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

aggagttagcaggagattagactacgggactagcaac	CRISPR spacer
aggagttagcaggagattagactacgggactagcaac	Protospacer
*************************************

13. spacer 1.13|49149|36|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

ttggcagggttacaccgcagacagcgcagactttcc	CRISPR spacer
ttggcagggttacaccgcagacagcgcagactttcc	Protospacer
************************************

14. spacer 1.14|49221|40|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

tatcagcagcgaggcactggcccttctactgactcaacga	CRISPR spacer
tatcagcagcgaggcactggcccttctactgactcaacga	Protospacer
****************************************

15. spacer 1.15|49297|36|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

tattgcgtacccaaatggaaccaatagcgtgctttt	CRISPR spacer
tattgcgtacccaaatggaaccaatagcgtgctttt	Protospacer
************************************

16. spacer 1.16|49369|34|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

gatgggttttatgattctggtcactacttctaca	CRISPR spacer
gatgggttttatgattctggtcactacttctaca	Protospacer
**********************************

17. spacer 1.17|49439|38|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

aacttctattaaattactacaaaccgctatttacgata	CRISPR spacer
aacttctattaaattactacaaaccgctatttacgata	Protospacer
**************************************

18. spacer 1.18|49513|38|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

gagcagagaaggtcgataagaaggcgctgcagagattt	CRISPR spacer
gagcagagaaggtcgataagaaggcgctgcagagattt	Protospacer
**************************************

19. spacer 1.19|49587|36|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

cagtcggtgggatggtccctcaggctagcgagacag	CRISPR spacer
cagtcggtgggatggtccctcaggctagcgagacag	Protospacer
************************************

20. spacer 1.20|49659|37|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

ataacagttagggggtcgagaggcccccttctcctta	CRISPR spacer
ataacagttagggggtcgagaggcccccttctcctta	Protospacer
*************************************

21. spacer 1.21|49732|38|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

ggtgaatgtgcctggcggcgcggggaagagtgacatac	CRISPR spacer
ggtgaatgtgcctggcggcgcggggaagagtgacatac	Protospacer
**************************************

22. spacer 1.22|49806|40|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

aaagtcacgggcggtgaagcgacgcatcaacttctcagct	CRISPR spacer
aaagtcacgggcggtgaagcgacgcatcaacttctcagct	Protospacer
****************************************

23. spacer 1.23|49882|37|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

tggttctcagcaggtgactgagggatggagcaaagat	CRISPR spacer
tggttctcagcaggtgactgagggatggagcaaagat	Protospacer
*************************************

24. spacer 1.24|49955|37|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

gatcggagcagagcttacgcaattccctgatgtttag	CRISPR spacer
gatcggagcagagcttacgcaattccctgatgtttag	Protospacer
*************************************

25. spacer 1.25|50028|36|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

gcaactaagaccgcacaggcagagttaaaccgattc	CRISPR spacer
gcaactaagaccgcacaggcagagttaaaccgattc	Protospacer
************************************

26. spacer 1.26|50100|39|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

tacctcagtcatcgctcaccctcttcttcaggttcccag	CRISPR spacer
tacctcagtcatcgctcaccctcttcttcaggttcccag	Protospacer
***************************************

27. spacer 1.27|50175|39|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

ccgctttaggggagtcatccttagctgatcttgcttacc	CRISPR spacer
ccgctttaggggagtcatccttagctgatcttgcttacc	Protospacer
***************************************

28. spacer 1.28|50250|39|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

ctctgatgtccgcttagagatcagccagagataactgac	CRISPR spacer
ctctgatgtccgcttagagatcagccagagataactgac	Protospacer
***************************************

29. spacer 1.29|50325|37|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

accagatagaagttagctgtatgtcctacctggtaag	CRISPR spacer
accagatagaagttagctgtatgtcctacctggtaag	Protospacer
*************************************

30. spacer 1.30|50398|38|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

cccctaacctaagctggctaagggttctaaaatttttt	CRISPR spacer
cccctaacctaagctggctaagggttctaaaatttttt	Protospacer
**************************************

31. spacer 1.31|50472|36|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

ccggggttggtcatacctgagtagtaagactcttat	CRISPR spacer
ccggggttggtcatacctgagtagtaagactcttat	Protospacer
************************************

32. spacer 1.32|50544|37|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

ctactgtgagtcaagcaaatttgcctctccagataac	CRISPR spacer
ctactgtgagtcaagcaaatttgcctctccagataac	Protospacer
*************************************

33. spacer 1.33|50617|36|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

cttgggtaatgcgctggtttcgttcggcgttctctt	CRISPR spacer
cttgggtaatgcgctggtttcgttcggcgttctctt	Protospacer
************************************

34. spacer 1.34|50689|36|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

gagatagacaacgttatcaggtttggacatattact	CRISPR spacer
gagatagacaacgttatcaggtttggacatattact	Protospacer
************************************

35. spacer 1.35|50761|35|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

cataaccatgctgctggcatctccattgcaccaat	CRISPR spacer
cataaccatgctgctggcatctccattgcaccaat	Protospacer
***********************************

36. spacer 1.36|50832|37|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

ctaaacatcataaaattgatggtggttgggaatattg	CRISPR spacer
ctaaacatcataaaattgatggtggttgggaatattg	Protospacer
*************************************

37. spacer 1.37|50905|39|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatcaattctcaagaaaaggctaaagctttagacct	CRISPR spacer
aggtatcaattctcaagaaaaggctaaagctttagacct	Protospacer
***************************************

38. spacer 1.38|50980|38|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

gttggatgcggcgggacagcggcggttctacaaccttt	CRISPR spacer
gttggatgcggcgggacagcggcggttctacaaccttt	Protospacer
**************************************

39. spacer 1.39|51054|39|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

acccgctcacggagctgctcggcgctgaacccaccccgg	CRISPR spacer
acccgctcacggagctgctcggcgctgaacccaccccgg	Protospacer
***************************************

40. spacer 1.40|51129|36|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

accgtagcctgcggctgatcttctacgacaggttga	CRISPR spacer
accgtagcctgcggctgatcttctacgacaggttga	Protospacer
************************************

41. spacer 1.41|51201|35|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

gtaacttagagtacacaggcaccaagtcccattgg	CRISPR spacer
gtaacttagagtacacaggcaccaagtcccattgg	Protospacer
***********************************

42. spacer 1.42|51272|38|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

aatgtggacacggattgtcccttccgtgttagtggcat	CRISPR spacer
aatgtggacacggattgtcccttccgtgttagtggcat	Protospacer
**************************************

43. spacer 1.43|51346|40|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

atcctctgcttgccacccaccagcttgcgctagaagagtc	CRISPR spacer
atcctctgcttgccacccaccagcttgcgctagaagagtc	Protospacer
****************************************

44. spacer 1.44|51422|37|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

agccagtaggttagaaactgtgatattcccggatagc	CRISPR spacer
agccagtaggttagaaactgtgatattcccggatagc	Protospacer
*************************************

45. spacer 1.45|51495|37|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

accaggttgctgccttttctgcaatttcacgcttcat	CRISPR spacer
accaggttgctgccttttctgcaatttcacgcttcat	Protospacer
*************************************

46. spacer 1.46|51568|38|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

aaggcggccccacacttacctagccgatgctgttaatc	CRISPR spacer
aaggcggccccacacttacctagccgatgctgttaatc	Protospacer
**************************************

47. spacer 1.47|51642|38|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

tccccatcgctggggcttagtcatatcgacccagcaaa	CRISPR spacer
tccccatcgctggggcttagtcatatcgacccagcaaa	Protospacer
**************************************

48. spacer 1.48|51716|37|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

tgttaacgcttcccacttctgggttgcactttttaaa	CRISPR spacer
tgttaacgcttcccacttctgggttgcactttttaaa	Protospacer
*************************************

49. spacer 1.49|51789|37|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

gggggatgcgttcgactccctggcctccctagttact	CRISPR spacer
gggggatgcgttcgactccctggcctccctagttact	Protospacer
*************************************

50. spacer 1.50|51862|34|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

tcattaccccgcccaagatgcccagcctcagcca	CRISPR spacer
tcattaccccgcccaagatgcccagcctcagcca	Protospacer
**********************************

51. spacer 1.51|51932|39|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

aaaggagttcgtctatgagtgaatacttaccttggaaga	CRISPR spacer
aaaggagttcgtctatgagtgaatacttaccttggaaga	Protospacer
***************************************

52. spacer 1.52|52007|36|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

tgggcgtagtgcgcctcatctgcaatcaagatatat	CRISPR spacer
tgggcgtagtgcgcctcatctgcaatcaagatatat	Protospacer
************************************

53. spacer 1.53|52079|41|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

ccgcaactgggtattaatcgggaatcgtcgccggtcttcag	CRISPR spacer
ccgcaactgggtattaatcgggaatcgtcgccggtcttcag	Protospacer
*****************************************

54. spacer 1.54|52156|38|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

tagatgtagtaatcactggcctggaagagaccagggaa	CRISPR spacer
tagatgtagtaatcactggcctggaagagaccagggaa	Protospacer
**************************************

55. spacer 1.55|52230|37|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

gtctggttaccattgacttcgacaagcgcgaggttaa	CRISPR spacer
gtctggttaccattgacttcgacaagcgcgaggttaa	Protospacer
*************************************

56. spacer 1.56|52303|39|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

acaggctcagtgagtatgaattcagcgaattgactcaac	CRISPR spacer
acaggctcagtgagtatgaattcagcgaattgactcaac	Protospacer
***************************************

57. spacer 1.57|52378|38|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

tttaggtcaactgggaatatgcgtccactcgccgatgg	CRISPR spacer
tttaggtcaactgggaatatgcgtccactcgccgatgg	Protospacer
**************************************

58. spacer 1.58|52452|36|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

agatttacctgtaccgccatcagcaaagaaaatgcc	CRISPR spacer
agatttacctgtaccgccatcagcaaagaaaatgcc	Protospacer
************************************

59. spacer 1.59|52524|34|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

tgctgtagcagaaacagcaatccagtaaggtagg	CRISPR spacer
tgctgtagcagaaacagcaatccagtaaggtagg	Protospacer
**********************************

60. spacer 1.60|52594|38|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

gcaggcttgaacatggcgcgcacagcgagcttcatatc	CRISPR spacer
gcaggcttgaacatggcgcgcacagcgagcttcatatc	Protospacer
**************************************

61. spacer 1.61|52668|37|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

atgactaggtagatacggtacagctcctctcgtaaag	CRISPR spacer
atgactaggtagatacggtacagctcctctcgtaaag	Protospacer
*************************************

62. spacer 1.62|52741|36|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

aatctatgagagcggctacttggggggttacaccaa	CRISPR spacer
aatctatgagagcggctacttggggggttacaccaa	Protospacer
************************************

63. spacer 1.63|52813|37|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

ccaacaggttgctgcagtaccccctatccaggcggag	CRISPR spacer
ccaacaggttgctgcagtaccccctatccaggcggag	Protospacer
*************************************

64. spacer 1.64|52886|36|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

atgttgaagtggttagctaggaaggataagtcaggg	CRISPR spacer
atgttgaagtggttagctaggaaggataagtcaggg	Protospacer
************************************

65. spacer 1.65|52958|38|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

tggatggtggtatagacagacggcgcccaggtgtgctc	CRISPR spacer
tggatggtggtatagacagacggcgcccaggtgtgctc	Protospacer
**************************************

66. spacer 1.66|53032|34|NC_011880|CRISPRCasFinder,CRT matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

tcacaccatccggaccgacgatcgtgatgttgcg	CRISPR spacer
tcacaccatccggaccgacgatcgtgatgttgcg	Protospacer
**********************************

67. spacer 1.67|53102|37|NC_011880|CRISPRCasFinder,CRT matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

cagaggcggggcgatcggagagggagcagcgagggcc	CRISPR spacer
cagaggcggggcgatcggagagggagcagcgagggcc	Protospacer
*************************************

68. spacer 1.68|53175|35|NC_011880|CRISPRCasFinder,CRT matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

gccacgagcactgaaattgtggctcaggcgcttca	CRISPR spacer
gccacgagcactgaaattgtggctcaggcgcttca	Protospacer
***********************************

69. spacer 1.69|53246|36|NC_011880|CRISPRCasFinder,CRT matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

ttcaatatgggtttcccagagtccaccacctcggag	CRISPR spacer
ttcaatatgggtttcccagagtccaccacctcggag	Protospacer
************************************

70. spacer 1.70|53318|36|NC_011880|CRISPRCasFinder,CRT matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

atactcaatttcgttgccgaagccgacaaaattgcg	CRISPR spacer
atactcaatttcgttgccgaagccgacaaaattgcg	Protospacer
************************************

71. spacer 1.71|53390|37|NC_011880|CRISPRCasFinder,CRT matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

tccaccagaagtggcccttgctagcgctataaggcag	CRISPR spacer
tccaccagaagtggcccttgctagcgctataaggcag	Protospacer
*************************************

72. spacer 1.72|53463|37|NC_011880|CRISPRCasFinder,CRT matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

accgactcattgccaacaacagcaaacaattctccag	CRISPR spacer
accgactcattgccaacaacagcaaacaattctccag	Protospacer
*************************************

73. spacer 1.73|53536|37|NC_011880|CRISPRCasFinder,CRT matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

gacggcatcacggtcctcctgccaggagtccaggata	CRISPR spacer
gacggcatcacggtcctcctgccaggagtccaggata	Protospacer
*************************************

74. spacer 1.74|53609|37|NC_011880|CRISPRCasFinder,CRT matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

ccgacagcggggatgcaagtagcctcacggtagtcac	CRISPR spacer
ccgacagcggggatgcaagtagcctcacggtagtcac	Protospacer
*************************************

75. spacer 1.75|53682|37|NC_011880|CRISPRCasFinder,CRT matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

ttcacctcgtacagcacgaccttgcagacgttctgca	CRISPR spacer
ttcacctcgtacagcacgaccttgcagacgttctgca	Protospacer
*************************************

76. spacer 1.76|53755|36|NC_011880|CRISPRCasFinder,CRT matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

cgagggggccttgaggggttactcttccacttcgag	CRISPR spacer
cgagggggccttgaggggttactcttccacttcgag	Protospacer
************************************

77. spacer 1.77|53827|35|NC_011880|CRISPRCasFinder,CRT matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

tacataaaaggagaaatctcatgggtctgtttaat	CRISPR spacer
tacataaaaggagaaatctcatgggtctgtttaat	Protospacer
***********************************

78. spacer 1.78|53898|39|NC_011880|CRISPRCasFinder,CRT matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

gccttgtcccacttctggcgttccgactcattctcaccg	CRISPR spacer
gccttgtcccacttctggcgttccgactcattctcaccg	Protospacer
***************************************

79. spacer 1.79|53973|37|NC_011880|CRISPRCasFinder,CRT matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

caggggagggctagccaattttgtatcagttattctc	CRISPR spacer
caggggagggctagccaattttgtatcagttattctc	Protospacer
*************************************

80. spacer 1.80|54046|35|NC_011880|CRISPRCasFinder,CRT matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

acaagacgaaaggtgacacgctgcttccccttcgg	CRISPR spacer
acaagacgaaaggtgacacgctgcttccccttcgg	Protospacer
***********************************

81. spacer 1.81|54117|36|NC_011880|CRISPRCasFinder,CRT matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

catacttgccgttaatggtttcccagaattccttag	CRISPR spacer
catacttgccgttaatggtttcccagaattccttag	Protospacer
************************************

82. spacer 1.82|54189|37|NC_011880|CRISPRCasFinder,CRT matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

cgccagtaatcgacgagagtattcgcgaccttgataa	CRISPR spacer
cgccagtaatcgacgagagtattcgcgaccttgataa	Protospacer
*************************************

83. spacer 1.83|54262|39|NC_011880|CRISPRCasFinder,CRT matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

ttcaccttgaatagctcccactagtgggagggcgaggac	CRISPR spacer
ttcaccttgaatagctcccactagtgggagggcgaggac	Protospacer
***************************************

84. spacer 1.84|54337|39|NC_011880|CRISPRCasFinder,CRT matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

gttacaatgaggggcgcaacatcggtaacgcaaaagtgc	CRISPR spacer
gttacaatgaggggcgcaacatcggtaacgcaaaagtgc	Protospacer
***************************************

85. spacer 1.85|54412|39|NC_011880|CRISPRCasFinder,CRT matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

tcatctctatcgtaattcctttacgtatgcagtactcaa	CRISPR spacer
tcatctctatcgtaattcctttacgtatgcagtactcaa	Protospacer
***************************************

86. spacer 1.86|54487|38|NC_011880|CRISPRCasFinder,CRT matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

aatggactcagcttagagcgcttgctagcgctatctga	CRISPR spacer
aatggactcagcttagagcgcttgctagcgctatctga	Protospacer
**************************************

87. spacer 1.87|54561|37|NC_011880|CRISPRCasFinder,CRT matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

gatcatatttctgttcgcagtaccgaacccagaagga	CRISPR spacer
gatcatatttctgttcgcagtaccgaacccagaagga	Protospacer
*************************************

88. spacer 1.88|53032|35|NC_011880|PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

atcacaccatccggaccgacgatcgtgatgttgcg	CRISPR spacer
atcacaccatccggaccgacgatcgtgatgttgcg	Protospacer
***********************************

89. spacer 1.89|53103|37|NC_011880|PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

cagaggcggggcgatcggagagggagcagcgagggcc	CRISPR spacer
cagaggcggggcgatcggagagggagcagcgagggcc	Protospacer
*************************************

90. spacer 1.90|53176|35|NC_011880|PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

gccacgagcactgaaattgtggctcaggcgcttca	CRISPR spacer
gccacgagcactgaaattgtggctcaggcgcttca	Protospacer
***********************************

91. spacer 1.91|53247|36|NC_011880|PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

ttcaatatgggtttcccagagtccaccacctcggag	CRISPR spacer
ttcaatatgggtttcccagagtccaccacctcggag	Protospacer
************************************

92. spacer 1.92|53319|36|NC_011880|PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

atactcaatttcgttgccgaagccgacaaaattgcg	CRISPR spacer
atactcaatttcgttgccgaagccgacaaaattgcg	Protospacer
************************************

93. spacer 1.93|53391|37|NC_011880|PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

tccaccagaagtggcccttgctagcgctataaggcag	CRISPR spacer
tccaccagaagtggcccttgctagcgctataaggcag	Protospacer
*************************************

94. spacer 1.94|53464|37|NC_011880|PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

accgactcattgccaacaacagcaaacaattctccag	CRISPR spacer
accgactcattgccaacaacagcaaacaattctccag	Protospacer
*************************************

95. spacer 1.95|53537|37|NC_011880|PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

gacggcatcacggtcctcctgccaggagtccaggata	CRISPR spacer
gacggcatcacggtcctcctgccaggagtccaggata	Protospacer
*************************************

96. spacer 1.96|53610|37|NC_011880|PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

ccgacagcggggatgcaagtagcctcacggtagtcac	CRISPR spacer
ccgacagcggggatgcaagtagcctcacggtagtcac	Protospacer
*************************************

97. spacer 1.97|53683|37|NC_011880|PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

ttcacctcgtacagcacgaccttgcagacgttctgca	CRISPR spacer
ttcacctcgtacagcacgaccttgcagacgttctgca	Protospacer
*************************************

98. spacer 1.98|53756|36|NC_011880|PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

cgagggggccttgaggggttactcttccacttcgag	CRISPR spacer
cgagggggccttgaggggttactcttccacttcgag	Protospacer
************************************

99. spacer 1.99|53828|35|NC_011880|PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

tacataaaaggagaaatctcatgggtctgtttaat	CRISPR spacer
tacataaaaggagaaatctcatgggtctgtttaat	Protospacer
***********************************

100. spacer 1.100|53899|39|NC_011880|PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

gccttgtcccacttctggcgttccgactcattctcaccg	CRISPR spacer
gccttgtcccacttctggcgttccgactcattctcaccg	Protospacer
***************************************

101. spacer 1.101|53974|37|NC_011880|PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

caggggagggctagccaattttgtatcagttattctc	CRISPR spacer
caggggagggctagccaattttgtatcagttattctc	Protospacer
*************************************

102. spacer 1.102|54047|35|NC_011880|PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

acaagacgaaaggtgacacgctgcttccccttcgg	CRISPR spacer
acaagacgaaaggtgacacgctgcttccccttcgg	Protospacer
***********************************

103. spacer 1.103|54118|36|NC_011880|PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

catacttgccgttaatggtttcccagaattccttag	CRISPR spacer
catacttgccgttaatggtttcccagaattccttag	Protospacer
************************************

104. spacer 1.104|54190|37|NC_011880|PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

cgccagtaatcgacgagagtattcgcgaccttgataa	CRISPR spacer
cgccagtaatcgacgagagtattcgcgaccttgataa	Protospacer
*************************************

105. spacer 1.105|54263|39|NC_011880|PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

ttcaccttgaatagctcccactagtgggagggcgaggac	CRISPR spacer
ttcaccttgaatagctcccactagtgggagggcgaggac	Protospacer
***************************************

106. spacer 1.106|54338|39|NC_011880|PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

gttacaatgaggggcgcaacatcggtaacgcaaaagtgc	CRISPR spacer
gttacaatgaggggcgcaacatcggtaacgcaaaagtgc	Protospacer
***************************************

107. spacer 1.107|54413|39|NC_011880|PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

tcatctctatcgtaattcctttacgtatgcagtactcaa	CRISPR spacer
tcatctctatcgtaattcctttacgtatgcagtactcaa	Protospacer
***************************************

108. spacer 1.108|54488|38|NC_011880|PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

aatggactcagcttagagcgcttgctagcgctatctga	CRISPR spacer
aatggactcagcttagagcgcttgctagcgctatctga	Protospacer
**************************************

109. spacer 1.109|54562|37|NC_011880|PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

gatcatatttctgttcgcagtaccgaacccagaagga	CRISPR spacer
gatcatatttctgttcgcagtaccgaacccagaagga	Protospacer
*************************************

110. spacer 2.1|96837|38|NC_011880|CRISPRCasFinder matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

actttgatgttcttgattgccccacatttttttgtgaa	CRISPR spacer
actttgatgttcttgattgccccacatttttttgtgaa	Protospacer
**************************************

111. spacer 2.2|96911|38|NC_011880|CRISPRCasFinder matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

gtgtcaacctcaaatgttccccaaccaataccgtagct	CRISPR spacer
gtgtcaacctcaaatgttccccaaccaataccgtagct	Protospacer
**************************************

112. spacer 2.3|96985|36|NC_011880|CRISPRCasFinder matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgaaccagaccatcatagtcgtgagggagtttg	CRISPR spacer
tggtgaaccagaccatcatagtcgtgagggagtttg	Protospacer
************************************

113. spacer 2.4|97057|37|NC_011880|CRISPRCasFinder matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

taaagatgccagcagctatcgccccggaacacataaa	CRISPR spacer
taaagatgccagcagctatcgccccggaacacataaa	Protospacer
*************************************

114. spacer 2.5|97130|40|NC_011880|CRISPRCasFinder matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

tggcctgtgcggggaacataacggctgatggagtagacta	CRISPR spacer
tggcctgtgcggggaacataacggctgatggagtagacta	Protospacer
****************************************

115. spacer 2.6|96836|44|NC_011880|PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

tactttgatgttcttgattgccccacatttttttgtgaagtatc	CRISPR spacer
tactttgatgttcttgattgccccacatttttttgtgaagtatc	Protospacer
********************************************

116. spacer 2.7|96910|44|NC_011880|PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtcaacctcaaatgttccccaaccaataccgtagctttccc	CRISPR spacer
tgtgtcaacctcaaatgttccccaaccaataccgtagctttccc	Protospacer
********************************************

117. spacer 2.8|96984|42|NC_011880|PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

ctggtgaaccagaccatcatagtcgtgagggagtttggtctc	CRISPR spacer
ctggtgaaccagaccatcatagtcgtgagggagtttggtctc	Protospacer
******************************************

118. spacer 2.9|97056|43|NC_011880|PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

ctaaagatgccagcagctatcgccccggaacacataaagtccc	CRISPR spacer
ctaaagatgccagcagctatcgccccggaacacataaagtccc	Protospacer
*******************************************

119. spacer 2.10|97129|46|NC_011880|PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

ctggcctgtgcggggaacataacggctgatggagtagactagtccc	CRISPR spacer
ctggcctgtgcggggaacataacggctgatggagtagactagtccc	Protospacer
**********************************************

120. spacer 2.11|96836|51|NC_011880|CRT matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

tactttgatgttcttgattgccccacatttttttgtgaagtatctacttgt	CRISPR spacer
tactttgatgttcttgattgccccacatttttttgtgaagtatctacttgt	Protospacer
***************************************************

121. spacer 2.12|96910|51|NC_011880|CRT matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtcaacctcaaatgttccccaaccaataccgtagctttccctacttga	CRISPR spacer
tgtgtcaacctcaaatgttccccaaccaataccgtagctttccctacttga	Protospacer
***************************************************

122. spacer 2.13|96984|49|NC_011880|CRT matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

ctggtgaaccagaccatcatagtcgtgagggagtttggtctctacttgt	CRISPR spacer
ctggtgaaccagaccatcatagtcgtgagggagtttggtctctacttgt	Protospacer
*************************************************

123. spacer 2.14|97056|50|NC_011880|CRT matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

ctaaagatgccagcagctatcgccccggaacacataaagtccctacttgt	CRISPR spacer
ctaaagatgccagcagctatcgccccggaacacataaagtccctacttgt	Protospacer
**************************************************

124. spacer 2.15|97129|53|NC_011880|CRT matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

ctggcctgtgcggggaacataacggctgatggagtagactagtccctacttgt	CRISPR spacer
ctggcctgtgcggggaacataacggctgatggagtagactagtccctacttgt	Protospacer
*****************************************************

125. spacer 3.1|98196|37|NC_011880|CRISPRCasFinder,CRT matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

atccgagacagcggccgcggcagcgggttaggctctc	CRISPR spacer
atccgagacagcggccgcggcagcgggttaggctctc	Protospacer
*************************************

126. spacer 3.2|98269|36|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

tcggaggagtcttcgtcccgatcaccgaacatgaca	CRISPR spacer
tcggaggagtcttcgtcccgatcaccgaacatgaca	Protospacer
************************************

127. spacer 3.3|98341|37|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

tacaggtaccagcggtccatgttgatcgggttcttcg	CRISPR spacer
tacaggtaccagcggtccatgttgatcgggttcttcg	Protospacer
*************************************

128. spacer 3.4|98414|37|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

agccagaagtgggcaagtgcctcaatccgcttcaggt	CRISPR spacer
agccagaagtgggcaagtgcctcaatccgcttcaggt	Protospacer
*************************************

129. spacer 3.5|98487|36|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

tgggcgatcgcttcaatctgctcctctagttctgca	CRISPR spacer
tgggcgatcgcttcaatctgctcctctagttctgca	Protospacer
************************************

130. spacer 3.6|98559|39|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaatactcgccatgaaaagaataggatatgccagg	CRISPR spacer
ggtaaaatactcgccatgaaaagaataggatatgccagg	Protospacer
***************************************

131. spacer 3.7|98634|38|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

gttatgtagccatgagcgatcatgtagtttacgctata	CRISPR spacer
gttatgtagccatgagcgatcatgtagtttacgctata	Protospacer
**************************************

132. spacer 3.8|98708|41|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

atcgcggcctcgttttctgttccacgccgggccatctccaa	CRISPR spacer
atcgcggcctcgttttctgttccacgccgggccatctccaa	Protospacer
*****************************************

133. spacer 3.9|98785|35|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

cggtacttgccttcgctggactcctcgatgatgtc	CRISPR spacer
cggtacttgccttcgctggactcctcgatgatgtc	Protospacer
***********************************

134. spacer 3.10|98856|41|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

gatcatgggtccgcccaggcacacatagaaatggtcatcga	CRISPR spacer
gatcatgggtccgcccaggcacacatagaaatggtcatcga	Protospacer
*****************************************

135. spacer 3.11|98933|36|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

gcctggaggatctgggcctgggattccccatcgtaa	CRISPR spacer
gcctggaggatctgggcctgggattccccatcgtaa	Protospacer
************************************

136. spacer 3.12|99005|40|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

tcttttgtcacttcaaacagtttctccatcagtcctagca	CRISPR spacer
tcttttgtcacttcaaacagtttctccatcagtcctagca	Protospacer
****************************************

137. spacer 3.13|99081|39|NC_011880|CRISPRCasFinder,CRT matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 0, identity: 1.0

gagtcctgccgatagcattgaccccagaagccatcaccc	CRISPR spacer
gagtcctgccgatagcattgaccccagaagccatcaccc	Protospacer
***************************************

138. spacer 1.59|52524|34|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to AY939844 (Prochlorococcus phage P-SSM2, complete genome) position: , mismatch: 6, identity: 0.824

tgctgtagcagaaacagcaatccagtaaggtagg---	CRISPR spacer
tgctgtagcagaaaccgctatcc---aaggtaagttg	Protospacer
*************** ** ****   ******.*   

139. spacer 1.59|52524|34|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to HQ632825 (Prochlorococcus phage P-SSM5 genomic sequence) position: , mismatch: 6, identity: 0.824

tgctgtagcagaaacagcaatccagtaaggtagg---	CRISPR spacer
tgctgtagcagaaaccgctatcc---aaggtaagttg	Protospacer
*************** ** ****   ******.*   

140. spacer 1.59|52524|34|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to MH319732 (Marine virus AG-345-E02 Ga0172268_12 genomic sequence) position: , mismatch: 7, identity: 0.794

tgctgtagcagaaacagcaatccagtaaggtagg---	CRISPR spacer
tgctgtagcagaaaccgctatcc---aaggcaagttg	Protospacer
*************** ** ****   ****.*.*   

141. spacer 1.50|51862|34|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029835 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.735

tcattaccccgcccaagatgcccagcct-cagcca	CRISPR spacer
cggcgaccccgcccgagatgccctgcctccagtc-	Protospacer
. .. *********.******** **** ***.* 

142. spacer 1.66|53032|34|NC_011880|CRISPRCasFinder,CRT matches to NZ_CP044217 (Mesorhizobium sp. NIBRBAC000500504 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

tcacaccatccggaccgacgatcgtgatgttgcg	CRISPR spacer
ccgagccatccggattgacgatcgtgatgtcgtt	Protospacer
.*. .*********..**************.*. 

143. spacer 1.88|53032|35|NC_011880|PILER-CR matches to NZ_CP044217 (Mesorhizobium sp. NIBRBAC000500504 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.743

atcacaccatccggaccgacgatcgtgatgttgcg	CRISPR spacer
accgagccatccggattgacgatcgtgatgtcgtt	Protospacer
*.*. .*********..**************.*. 

144. spacer 1.45|51495|37|NC_011880|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 11, identity: 0.703

accaggttgctgccttttctgcaatttcacgcttcat	CRISPR spacer
atcgcattgcttcgttttctgcaatttcacgcgcacc	Protospacer
*.*. .***** * ****************** .  .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 25638 : 45961 20 Burkholderia_phage(33.33%) transposase NA
DBSCAN-SWA_2 134838 : 185646 40 Lactococcus_phage(16.67%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage