Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_012416 Wolbachia sp. wRi, complete sequence 12 crisprs DEDDh,RT,PD-DExK,cas3 4 3 16 1

Results visualization

1. NC_012416
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_012416_1 51701-51805 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_012416_2 296536-296634 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_012416_3 316495-316593 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_012416_4 346171-346275 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_012416_5 374548-374658 Orphan NA
1 spacers
RT

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_012416_6 418918-419367 Orphan NA
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_012416_7 842142-842456 Unclear NA
4 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_012416_8 852778-852874 Unclear NA
1 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_012416_9 1013342-1013452 Orphan NA
1 spacers
RT

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_012416_10 1040928-1041068 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_012416_11 1203648-1203758 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_012416_12 1327149-1327254 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_012416_6 6.4|419202|45|NC_012416|CRT 419202-419246 45 NC_012416.1 1327296-1327340 0 1.0
NC_012416_6 6.5|419291|33|NC_012416|CRT 419291-419323 33 NC_012416.1 374628-374660 1 0.97
NC_012416_6 6.5|419291|33|NC_012416|CRT 419291-419323 33 NC_012416.1 1013422-1013454 1 0.97
NC_012416_8 8.1|852801|51|NC_012416|CRISPRCasFinder 852801-852851 51 NC_012416.1 711611-711661 1 0.98
NC_012416_8 8.1|852801|51|NC_012416|CRISPRCasFinder 852801-852851 51 NC_012416.1 711723-711773 1 0.98
NC_012416_8 8.1|852801|51|NC_012416|CRISPRCasFinder 852801-852851 51 NC_012416.1 1203582-1203632 1 0.98
NC_012416_1 1.1|51725|57|NC_012416|CRISPRCasFinder 51725-51781 57 NC_012416.1 936845-936901 2 0.965

1. spacer 6.4|419202|45|NC_012416|CRT matches to position: 1327296-1327340, mismatch: 0, identity: 1.0

atgttgagagataccgcgaatgaatcgcggtatgacggtgtagat	CRISPR spacer
atgttgagagataccgcgaatgaatcgcggtatgacggtgtagat	Protospacer
*********************************************

2. spacer 6.5|419291|33|NC_012416|CRT matches to position: 374628-374660, mismatch: 1, identity: 0.97

agagataccgcggcggtatgacggttcgtggcg	CRISPR spacer
agagataccgcggcggtatgacggttcgcggcg	Protospacer
****************************.****

3. spacer 6.5|419291|33|NC_012416|CRT matches to position: 1013422-1013454, mismatch: 1, identity: 0.97

agagataccgcggcggtatgacggttcgtggcg	CRISPR spacer
agagataccgcggcggtatgacggttcgcggcg	Protospacer
****************************.****

4. spacer 8.1|852801|51|NC_012416|CRISPRCasFinder matches to position: 711611-711661, mismatch: 1, identity: 0.98

agataccgcgaatgaatcgcggtatgacggtgtaatgacggttaagtaatt	CRISPR spacer
agataccgcgaatgaatcgcggtatgacggtgtaatgatggttaagtaatt	Protospacer
**************************************.************

5. spacer 8.1|852801|51|NC_012416|CRISPRCasFinder matches to position: 711723-711773, mismatch: 1, identity: 0.98

agataccgcgaatgaatcgcggtatgacggtgtaatgacggttaagtaatt	CRISPR spacer
agataccgcgaatgaatcgcggtatgacggtgtaatgatggttaagtaatt	Protospacer
**************************************.************

6. spacer 8.1|852801|51|NC_012416|CRISPRCasFinder matches to position: 1203582-1203632, mismatch: 1, identity: 0.98

agataccgcgaatgaatcgcggtatgacggtgtaatgacggttaagtaatt	CRISPR spacer
agataccgcgaatgaatcgcggtatgacggtgtaatgatggttaagtaatt	Protospacer
**************************************.************

7. spacer 1.1|51725|57|NC_012416|CRISPRCasFinder matches to position: 936845-936901, mismatch: 2, identity: 0.965

ctgagataccgcgaatgaatcgcggtatgacggttcgtggcggcgtgacgataagct	CRISPR spacer
ctgagataccgcgaatgaatcgcggtatgacggttcgcggcggcatgacgataagct	Protospacer
*************************************.******.************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_012416_6 6.1|418962|36|NC_012416|CRT 418962-418997 36 MN180249 UNVERIFIED: Wolbachia phage WO isolate Seq2WORi_AMD2 genomic sequence 19843-19878 5 0.861
NC_012416_6 6.3|419122|36|NC_012416|CRT 419122-419157 36 MN180249 UNVERIFIED: Wolbachia phage WO isolate Seq2WORi_AMD2 genomic sequence 19843-19878 5 0.861
NC_012416_7 7.1|842166|57|NC_012416|CRT 842166-842222 57 MN180249 UNVERIFIED: Wolbachia phage WO isolate Seq2WORi_AMD2 genomic sequence 19772-19828 11 0.807

1. spacer 6.1|418962|36|NC_012416|CRT matches to MN180249 (UNVERIFIED: Wolbachia phage WO isolate Seq2WORi_AMD2 genomic sequence) position: , mismatch: 5, identity: 0.861

cttgttagcgccgcggcggtatgacggttcgtggca	CRISPR spacer
cgtgttagcgccgcggcggtatgacgattcgcagcg	Protospacer
* ************************.****..**.

2. spacer 6.3|419122|36|NC_012416|CRT matches to MN180249 (UNVERIFIED: Wolbachia phage WO isolate Seq2WORi_AMD2 genomic sequence) position: , mismatch: 5, identity: 0.861

cttgttagcgccgcggcggtatgacggttcgtggca	CRISPR spacer
cgtgttagcgccgcggcggtatgacgattcgcagcg	Protospacer
* ************************.****..**.

3. spacer 7.1|842166|57|NC_012416|CRT matches to MN180249 (UNVERIFIED: Wolbachia phage WO isolate Seq2WORi_AMD2 genomic sequence) position: , mismatch: 11, identity: 0.807

gatctatgccgagataccgcggcggtatgacggttcgcggtggcatgacgataagct	CRISPR spacer
tagcggctaagagataccgtgacggtatgacggttcgcggtggcatgacgataagcc	Protospacer
 * * ..   *********.*.**********************************.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 29338 : 133736 97 Shigella_phage(15.38%) tRNA,head,tail,transposase NA
DBSCAN-SWA_2 138334 : 273410 114 Shigella_phage(20.69%) tRNA,integrase,transposase attL 200212:200254|attR 258473:259954
DBSCAN-SWA_3 291503 : 364654 56 Tupanvirus(18.75%) tRNA,protease,head,transposase NA
DBSCAN-SWA_4 374739 : 424131 40 Wolbachia_phage(33.33%) tRNA,transposase NA
DBSCAN-SWA_5 432768 : 492960 55 Shigella_phage(22.22%) tRNA,transposase NA
DBSCAN-SWA_6 500326 : 536032 30 Bacillus_phage(12.5%) protease,transposase NA
DBSCAN-SWA_7 560175 : 609359 38 Wolbachia_phage(77.42%) capsid,tail,plate,head,portal,terminase,transposase NA
DBSCAN-SWA_8 625748 : 696244 58 Wolbachia_phage(25.0%) tRNA,transposase NA
DBSCAN-SWA_9 709995 : 841712 112 Wolbachia_phage(79.69%) capsid,tail,tRNA,plate,head,portal,terminase,transposase NA
DBSCAN-SWA_10 847748 : 917707 50 Prochlorococcus_phage(40.0%) tRNA,protease,transposase NA
DBSCAN-SWA_11 930313 : 982352 45 Bacillus_virus(11.11%) transposase NA
DBSCAN-SWA_12 998609 : 1052472 51 Bacillus_virus(14.29%) tRNA,portal,protease,terminase,transposase NA
DBSCAN-SWA_13 1059135 : 1115818 48 Wolbachia_phage(77.42%) capsid,tail,plate,head,portal,terminase,transposase NA
DBSCAN-SWA_14 1132207 : 1195086 53 Wolbachia_phage(27.78%) tRNA,holin,transposase NA
DBSCAN-SWA_15 1200793 : 1266506 53 Orpheovirus(12.5%) tRNA,protease,transposase NA
DBSCAN-SWA_16 1318515 : 1405799 87 Wolbachia_phage(50.0%) capsid,tRNA,plate,head,portal,protease,terminase,transposase NA
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NC_012416.1|WP_012673405.1|1362627_1362837_-|hypothetical-protein 1362627_1362837_- 69 aa aa NA NA NA 1318515-1405799 yes