Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_015679 Blattabacterium sp. (Blattella germanica) str. Bge plasmid pBge, complete sequence 0 crisprs NA 0 0 0 0
NC_013454 Blattabacterium sp. (Blattella germanica) str. Bge, complete sequence 2 crisprs DEDDh 0 1 2 0

Results visualization

1. NC_013454
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_013454_1 610039-610113 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_013454_2 632805-633005 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_013454_1 1.1|610063|27|NC_013454|CRISPRCasFinder 610063-610089 27 MT774405 CrAssphage cr115_1, complete genome 60368-60394 5 0.815

1. spacer 1.1|610063|27|NC_013454|CRISPRCasFinder matches to MT774405 (CrAssphage cr115_1, complete genome) position: , mismatch: 5, identity: 0.815

acataaggacctattatactattctca	CRISPR spacer
ccataaagagctattatactattccta	Protospacer
 *****.** **************..*

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 475457 : 491644 12 Prochlorococcus_phage(20.0%) NA NA
DBSCAN-SWA_2 582739 : 593432 10 Acanthamoeba_polyphaga_moumouvirus(14.29%) protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage