Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_012718 Burkholderia glumae BGR1 plasmid bglu_2p, complete sequence 0 crisprs NA 0 0 1 0
NC_012720 Burkholderia glumae BGR1 plasmid bglu_3p, complete sequence 0 crisprs NA 0 0 1 0
NC_012723 Burkholderia glumae BGR1 plasmid bglu_1p, complete sequence 1 crisprs NA 0 2 1 0
NC_012724 Burkholderia glumae BGR1 chromosome 1, complete sequence 2 crisprs cas3,DEDDh,csa3,DinG,RT 1 8 14 0
NC_012721 Burkholderia glumae BGR1 chromosome 2, complete sequence 0 crisprs cas3,csa3,DinG 0 0 7 0
NC_012725 Burkholderia glumae BGR1 plasmid bglu_4p, complete sequence 0 crisprs csa3 0 0 1 0

Results visualization

1. NC_012718
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 8649 : 54877 36 uncultured_Caudovirales_phage(25.0%) integrase,transposase attL 3812:3827|attR 66437:66452
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_012721
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 143892 : 207047 44 Ostreococcus_lucimarinus_virus(16.67%) transposase,plate NA
DBSCAN-SWA_2 819000 : 897654 60 Bacillus_phage(33.33%) transposase,plate,tRNA NA
DBSCAN-SWA_3 1019309 : 1069196 39 Phaeocystis_globosa_virus(12.5%) transposase,tRNA NA
DBSCAN-SWA_4 1394289 : 1431581 26 Pseudomonas_phage(50.0%) transposase,plate NA
DBSCAN-SWA_5 1612592 : 1700871 49 Tupanvirus(33.33%) transposase,tail NA
DBSCAN-SWA_6 1992507 : 2030882 31 Leptospira_phage(20.0%) transposase,tRNA,integrase attL 1994967:1995026|attR 2030889:2032211
DBSCAN-SWA_7 2700518 : 2724995 30 Burkholderia_phage(88.89%) transposase,plate,tail,holin NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NC_012723
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_012723_1 1917-2105 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_012723_1 1.1|1955|55|NC_012723|PILER-CR 1955-2009 55 NC_012723 Burkholderia glumae BGR1 plasmid bglu_1p, complete sequence 1950-2004 0 1.0
NC_012723_1 1.1|1955|55|NC_012723|PILER-CR 1955-2009 55 NZ_CP035902 Burkholderia glumae strain 257sh-1 plasmid plas1, complete sequence 47917-47971 0 1.0
NC_012723_1 1.1|1955|55|NC_012723|PILER-CR 1955-2009 55 NZ_CP052134 Burkholderia glumae strain HN plasmid pbghn2, complete sequence 205632-205686 0 1.0
NC_012723_1 1.1|1955|55|NC_012723|PILER-CR 1955-2009 55 NZ_CP045089 Burkholderia glumae strain GX plasmid pWSGX1, complete sequence 160016-160070 0 1.0
NC_012723_1 1.2|2048|54|NC_012723|PILER-CR 2048-2101 54 NZ_CP052134 Burkholderia glumae strain HN plasmid pbghn2, complete sequence 205557-205610 0 1.0
NC_012723_1 1.2|2048|54|NC_012723|PILER-CR 2048-2101 54 NZ_CP045089 Burkholderia glumae strain GX plasmid pWSGX1, complete sequence 159941-159994 0 1.0
NC_012723_1 1.2|2048|54|NC_012723|PILER-CR 2048-2101 54 NC_012723 Burkholderia glumae BGR1 plasmid bglu_1p, complete sequence 2026-2079 0 1.0
NC_012723_1 1.2|2048|54|NC_012723|PILER-CR 2048-2101 54 NZ_CP035902 Burkholderia glumae strain 257sh-1 plasmid plas1, complete sequence 47993-48046 0 1.0

1. spacer 1.1|1955|55|NC_012723|PILER-CR matches to NC_012723 (Burkholderia glumae BGR1 plasmid bglu_1p, complete sequence) position: , mismatch: 0, identity: 1.0

gggcgtaagggtgagagtgtgtactcaccttgcagcacggtggtttagcgatttc	CRISPR spacer
gggcgtaagggtgagagtgtgtactcaccttgcagcacggtggtttagcgatttc	Protospacer
*******************************************************

2. spacer 1.1|1955|55|NC_012723|PILER-CR matches to NZ_CP035902 (Burkholderia glumae strain 257sh-1 plasmid plas1, complete sequence) position: , mismatch: 0, identity: 1.0

gggcgtaagggtgagagtgtgtactcaccttgcagcacggtggtttagcgatttc	CRISPR spacer
gggcgtaagggtgagagtgtgtactcaccttgcagcacggtggtttagcgatttc	Protospacer
*******************************************************

3. spacer 1.1|1955|55|NC_012723|PILER-CR matches to NZ_CP052134 (Burkholderia glumae strain HN plasmid pbghn2, complete sequence) position: , mismatch: 0, identity: 1.0

gggcgtaagggtgagagtgtgtactcaccttgcagcacggtggtttagcgatttc	CRISPR spacer
gggcgtaagggtgagagtgtgtactcaccttgcagcacggtggtttagcgatttc	Protospacer
*******************************************************

4. spacer 1.1|1955|55|NC_012723|PILER-CR matches to NZ_CP045089 (Burkholderia glumae strain GX plasmid pWSGX1, complete sequence) position: , mismatch: 0, identity: 1.0

gggcgtaagggtgagagtgtgtactcaccttgcagcacggtggtttagcgatttc	CRISPR spacer
gggcgtaagggtgagagtgtgtactcaccttgcagcacggtggtttagcgatttc	Protospacer
*******************************************************

5. spacer 1.2|2048|54|NC_012723|PILER-CR matches to NZ_CP052134 (Burkholderia glumae strain HN plasmid pbghn2, complete sequence) position: , mismatch: 0, identity: 1.0

cgttaaggtgaggtcgtctctccagcgatggtcagacaacttctttgctcagta	CRISPR spacer
cgttaaggtgaggtcgtctctccagcgatggtcagacaacttctttgctcagta	Protospacer
******************************************************

6. spacer 1.2|2048|54|NC_012723|PILER-CR matches to NZ_CP045089 (Burkholderia glumae strain GX plasmid pWSGX1, complete sequence) position: , mismatch: 0, identity: 1.0

cgttaaggtgaggtcgtctctccagcgatggtcagacaacttctttgctcagta	CRISPR spacer
cgttaaggtgaggtcgtctctccagcgatggtcagacaacttctttgctcagta	Protospacer
******************************************************

7. spacer 1.2|2048|54|NC_012723|PILER-CR matches to NC_012723 (Burkholderia glumae BGR1 plasmid bglu_1p, complete sequence) position: , mismatch: 0, identity: 1.0

cgttaaggtgaggtcgtctctccagcgatggtcagacaacttctttgctcagta	CRISPR spacer
cgttaaggtgaggtcgtctctccagcgatggtcagacaacttctttgctcagta	Protospacer
******************************************************

8. spacer 1.2|2048|54|NC_012723|PILER-CR matches to NZ_CP035902 (Burkholderia glumae strain 257sh-1 plasmid plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgttaaggtgaggtcgtctctccagcgatggtcagacaacttctttgctcagta	CRISPR spacer
cgttaaggtgaggtcgtctctccagcgatggtcagacaacttctttgctcagta	Protospacer
******************************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 5800 : 79865 56 Mycobacterium_phage(22.22%) integrase,transposase attL 18347:18406|attR 79051:79921
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NC_012724
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_012724_1 528496-528993 Orphan NA
9 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_012724_2 1995500-1995830 Orphan I-F
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_012724_1 1.2|528595|18|NC_012724|CRT 528595-528612 18 NC_012721.2 417119-417136 2 0.889

1. spacer 1.2|528595|18|NC_012724|CRT matches to position: 417119-417136, mismatch: 2, identity: 0.889

gttgtcgccaagaaggcg	CRISPR spacer
gttgtcgccgagcaggcg	Protospacer
*********.** *****

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_012724_1 1.3|528640|21|NC_012724|CRT 528640-528660 21 KX815338 Streptomyces phage Joe, complete genome 23722-23742 1 0.952
NC_012724_1 1.5|528733|21|NC_012724|CRT 528733-528753 21 KX815338 Streptomyces phage Joe, complete genome 23722-23742 1 0.952
NC_012724_1 1.3|528640|21|NC_012724|CRT 528640-528660 21 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2695874-2695894 2 0.905
NC_012724_1 1.3|528640|21|NC_012724|CRT 528640-528660 21 MT711979 Streptomyces phage Endor2, complete genome 24001-24021 2 0.905
NC_012724_1 1.5|528733|21|NC_012724|CRT 528733-528753 21 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2695874-2695894 2 0.905
NC_012724_1 1.5|528733|21|NC_012724|CRT 528733-528753 21 MT711979 Streptomyces phage Endor2, complete genome 24001-24021 2 0.905
NC_012724_2 2.6|1995528|32|NC_012724|CRT 1995528-1995559 32 NZ_CP007214 Burkholderia plantarii strain ATCC 43733 plasmid bpln_1p, complete sequence 116403-116434 2 0.938
NC_012724_2 2.7|1995588|33|NC_012724|CRT 1995588-1995620 33 NZ_CP013415 Burkholderia ubonensis strain MSMB2035 plasmid pMSMB2035, complete sequence 242614-242646 3 0.909
NC_012724_2 2.7|1995588|33|NC_012724|CRT 1995588-1995620 33 NZ_CP013369 Burkholderia ubonensis strain RF23-BP41 plasmid pRF23, complete sequence 216809-216841 3 0.909
NC_012724_1 1.9|528940|27|NC_012724|CRT 528940-528966 27 CP003954 Rhodococcus opacus PD630 plasmid 5, complete sequence 15484-15510 4 0.852
NC_012724_1 1.9|528940|27|NC_012724|CRT 528940-528966 27 CP003954 Rhodococcus opacus PD630 plasmid 5, complete sequence 15844-15870 5 0.815
NC_012724_1 1.9|528940|27|NC_012724|CRT 528940-528966 27 CP003954 Rhodococcus opacus PD630 plasmid 5, complete sequence 15937-15963 5 0.815
NC_012724_1 1.9|528940|27|NC_012724|CRT 528940-528966 27 NZ_CP045122 Rubrobacter sp. SCSIO 52915 plasmid unnamed1, complete sequence 7887-7913 5 0.815
NC_012724_1 1.9|528940|27|NC_012724|CRT 528940-528966 27 JX100810 Caulobacter phage CcrColossus, complete genome 245907-245933 5 0.815
NC_012724_1 1.9|528940|27|NC_012724|CRT 528940-528966 27 MN585966 Gordonia phage Faith5x5, complete genome 5841-5867 5 0.815
NC_012724_1 1.9|528940|27|NC_012724|CRT 528940-528966 27 NC_049851 Burkholderia phage BcepSauron, complete genome 91813-91839 6 0.778
NC_012724_1 1.9|528940|27|NC_012724|CRT 528940-528966 27 NC_010811 Ralstonia phage RSL1, complete genome 231059-231085 6 0.778
NC_012724_1 1.9|528940|27|NC_012724|CRT 528940-528966 27 AB366653 Ralstonia phage RSL1 DNA, complete genome 231059-231085 6 0.778
NC_012724_1 1.9|528940|27|NC_012724|CRT 528940-528966 27 NZ_CP034185 Deinococcus sp. S14-83 strain S14-83T plasmid unnamed1, complete sequence 148393-148419 7 0.741
NC_012724_2 2.6|1995528|32|NC_012724|CRT 1995528-1995559 32 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 194572-194603 7 0.781
NC_012724_2 2.6|1995528|32|NC_012724|CRT 1995528-1995559 32 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 1618545-1618576 7 0.781
NC_012724_2 2.7|1995588|33|NC_012724|CRT 1995588-1995620 33 NC_009427 Novosphingobium aromaticivorans DSM 12444 plasmid pNL2, complete sequence 248617-248649 7 0.788
NC_012724_2 2.10|1995771|32|NC_012724|CRT 1995771-1995802 32 GQ919031 Streptomyces phage ZL12, complete genome 62929-62960 7 0.781
NC_012724_1 1.1|528523|45|NC_012724|CRT 528523-528567 45 MK875791 Gordonia phage Yakult, complete genome 26737-26781 8 0.822
NC_012724_2 2.2|1995583|38|NC_012724|PILER-CR,CRISPRCasFinder 1995583-1995620 38 NZ_CP013415 Burkholderia ubonensis strain MSMB2035 plasmid pMSMB2035, complete sequence 242609-242646 8 0.789
NC_012724_2 2.2|1995583|38|NC_012724|PILER-CR,CRISPRCasFinder 1995583-1995620 38 NZ_CP013369 Burkholderia ubonensis strain RF23-BP41 plasmid pRF23, complete sequence 216809-216846 8 0.789
NC_012724_2 2.6|1995528|32|NC_012724|CRT 1995528-1995559 32 NZ_CP029835 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed5, complete sequence 138393-138424 8 0.75
NC_012724_2 2.6|1995528|32|NC_012724|CRT 1995528-1995559 32 NZ_CP017077 Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence 433456-433487 8 0.75
NC_012724_2 2.6|1995528|32|NC_012724|CRT 1995528-1995559 32 NC_016586 Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence 10021-10052 8 0.75
NC_012724_2 2.6|1995528|32|NC_012724|CRT 1995528-1995559 32 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 1300782-1300813 8 0.75
NC_012724_2 2.6|1995528|32|NC_012724|CRT 1995528-1995559 32 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 1879937-1879968 8 0.75
NC_012724_2 2.6|1995528|32|NC_012724|CRT 1995528-1995559 32 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 684374-684405 10 0.688
NC_012724_2 2.6|1995528|32|NC_012724|CRT 1995528-1995559 32 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 676977-677008 10 0.688
NC_012724_2 2.6|1995528|32|NC_012724|CRT 1995528-1995559 32 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 579738-579769 10 0.688
NC_012724_2 2.6|1995528|32|NC_012724|CRT 1995528-1995559 32 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 638562-638593 10 0.688
NC_012724_2 2.6|1995528|32|NC_012724|CRT 1995528-1995559 32 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 578853-578884 10 0.688
NC_012724_2 2.6|1995528|32|NC_012724|CRT 1995528-1995559 32 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 577639-577670 10 0.688
NC_012724_2 2.6|1995528|32|NC_012724|CRT 1995528-1995559 32 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 577629-577660 10 0.688
NC_012724_2 2.6|1995528|32|NC_012724|CRT 1995528-1995559 32 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 579726-579757 10 0.688
NC_012724_2 2.6|1995528|32|NC_012724|CRT 1995528-1995559 32 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 579745-579776 10 0.688
NC_012724_2 2.6|1995528|32|NC_012724|CRT 1995528-1995559 32 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 579723-579754 10 0.688
NC_012724_2 2.6|1995528|32|NC_012724|CRT 1995528-1995559 32 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 684432-684463 10 0.688
NC_012724_2 2.6|1995528|32|NC_012724|CRT 1995528-1995559 32 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 684432-684463 10 0.688
NC_012724_2 2.6|1995528|32|NC_012724|CRT 1995528-1995559 32 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 684421-684452 10 0.688

1. spacer 1.3|528640|21|NC_012724|CRT matches to KX815338 (Streptomyces phage Joe, complete genome) position: , mismatch: 1, identity: 0.952

gcggcaccggccaagaaggca	CRISPR spacer
ccggcaccggccaagaaggca	Protospacer
 ********************

2. spacer 1.5|528733|21|NC_012724|CRT matches to KX815338 (Streptomyces phage Joe, complete genome) position: , mismatch: 1, identity: 0.952

gcggcaccggccaagaaggca	CRISPR spacer
ccggcaccggccaagaaggca	Protospacer
 ********************

3. spacer 1.3|528640|21|NC_012724|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 2, identity: 0.905

gcggcaccggccaagaaggca	CRISPR spacer
aaggcaccggccaagaaggca	Protospacer
. *******************

4. spacer 1.3|528640|21|NC_012724|CRT matches to MT711979 (Streptomyces phage Endor2, complete genome) position: , mismatch: 2, identity: 0.905

gcggcaccggccaagaaggca	CRISPR spacer
acggcaccggccaagaaggcg	Protospacer
.*******************.

5. spacer 1.5|528733|21|NC_012724|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 2, identity: 0.905

gcggcaccggccaagaaggca	CRISPR spacer
aaggcaccggccaagaaggca	Protospacer
. *******************

6. spacer 1.5|528733|21|NC_012724|CRT matches to MT711979 (Streptomyces phage Endor2, complete genome) position: , mismatch: 2, identity: 0.905

gcggcaccggccaagaaggca	CRISPR spacer
acggcaccggccaagaaggcg	Protospacer
.*******************.

7. spacer 2.6|1995528|32|NC_012724|CRT matches to NZ_CP007214 (Burkholderia plantarii strain ATCC 43733 plasmid bpln_1p, complete sequence) position: , mismatch: 2, identity: 0.938

ctaccggcgcgaactggagcgcctgctgctct	CRISPR spacer
ctaccggcgcgaacttgaacgcctgctgctct	Protospacer
*************** **.*************

8. spacer 2.7|1995588|33|NC_012724|CRT matches to NZ_CP013415 (Burkholderia ubonensis strain MSMB2035 plasmid pMSMB2035, complete sequence) position: , mismatch: 3, identity: 0.909

cacgagcgcacacggcaccggccagtgcgtgca	CRISPR spacer
aacgagcgcacacggcaccggacattgcgtgca	Protospacer
 ******************** ** ********

9. spacer 2.7|1995588|33|NC_012724|CRT matches to NZ_CP013369 (Burkholderia ubonensis strain RF23-BP41 plasmid pRF23, complete sequence) position: , mismatch: 3, identity: 0.909

cacgagcgcacacggcaccggccagtgcgtgca	CRISPR spacer
aacgagcgcacacggcaccggacattgcgtgca	Protospacer
 ******************** ** ********

10. spacer 1.9|528940|27|NC_012724|CRT matches to CP003954 (Rhodococcus opacus PD630 plasmid 5, complete sequence) position: , mismatch: 4, identity: 0.852

aaggcaccggctgcgaagaaggctgca	CRISPR spacer
aaggcaccggcggcgaagaaggtggct	Protospacer
*********** **********. ** 

11. spacer 1.9|528940|27|NC_012724|CRT matches to CP003954 (Rhodococcus opacus PD630 plasmid 5, complete sequence) position: , mismatch: 5, identity: 0.815

aaggcaccggctgcgaagaaggctgca	CRISPR spacer
aaggcaccggcggcgaagaagacggtc	Protospacer
*********** *********.* *. 

12. spacer 1.9|528940|27|NC_012724|CRT matches to CP003954 (Rhodococcus opacus PD630 plasmid 5, complete sequence) position: , mismatch: 5, identity: 0.815

aaggcaccggctgcgaagaaggctgca	CRISPR spacer
aaggcaccggcggcgaagaagacggtc	Protospacer
*********** *********.* *. 

13. spacer 1.9|528940|27|NC_012724|CRT matches to NZ_CP045122 (Rubrobacter sp. SCSIO 52915 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815

aaggcaccggctgcgaagaaggctgca	CRISPR spacer
gtggggccggctgcgaagaaggctgcg	Protospacer
. ** .********************.

14. spacer 1.9|528940|27|NC_012724|CRT matches to JX100810 (Caulobacter phage CcrColossus, complete genome) position: , mismatch: 5, identity: 0.815

aaggcaccggctgcgaagaaggctgca	CRISPR spacer
atcgcaccggcttcgaagaaggatgcg	Protospacer
*  ********* ********* ***.

15. spacer 1.9|528940|27|NC_012724|CRT matches to MN585966 (Gordonia phage Faith5x5, complete genome) position: , mismatch: 5, identity: 0.815

aaggcaccggctgcgaagaaggctgca	CRISPR spacer
aaggaaccggccgcgaagaaggcgacg	Protospacer
**** ******.*********** .*.

16. spacer 1.9|528940|27|NC_012724|CRT matches to NC_049851 (Burkholderia phage BcepSauron, complete genome) position: , mismatch: 6, identity: 0.778

aaggcaccggctgcgaagaaggctgca	CRISPR spacer
gctgcaccggcagcgaagaaggccgct	Protospacer
.  ******** ***********.** 

17. spacer 1.9|528940|27|NC_012724|CRT matches to NC_010811 (Ralstonia phage RSL1, complete genome) position: , mismatch: 6, identity: 0.778

aaggcaccggctgcgaagaaggctgca	CRISPR spacer
gctgctccggctgccaagaaggctgcg	Protospacer
.  ** ******** ***********.

18. spacer 1.9|528940|27|NC_012724|CRT matches to AB366653 (Ralstonia phage RSL1 DNA, complete genome) position: , mismatch: 6, identity: 0.778

aaggcaccggctgcgaagaaggctgca	CRISPR spacer
gctgctccggctgccaagaaggctgcg	Protospacer
.  ** ******** ***********.

19. spacer 1.9|528940|27|NC_012724|CRT matches to NZ_CP034185 (Deinococcus sp. S14-83 strain S14-83T plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.741

aaggcaccggctgcgaagaaggctgca	CRISPR spacer
ggctgaccggctgcaaagaaggctgcg	Protospacer
..   *********.***********.

20. spacer 2.6|1995528|32|NC_012724|CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 7, identity: 0.781

ctaccggcgcgaactggagcgcctgctgctct	CRISPR spacer
cgaccggctcgaactggagggcctgctcgggt	Protospacer
* ****** ********** *******    *

21. spacer 2.6|1995528|32|NC_012724|CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 7, identity: 0.781

ctaccggcgcgaactggagcgcctgctgctct	CRISPR spacer
cgaccggctcgaactggagggcctgctcgggt	Protospacer
* ****** ********** *******    *

22. spacer 2.7|1995588|33|NC_012724|CRT matches to NC_009427 (Novosphingobium aromaticivorans DSM 12444 plasmid pNL2, complete sequence) position: , mismatch: 7, identity: 0.788

cacgagcgcacacggcaccggccagtgcgtgca	CRISPR spacer
caccagcgcacagggcaccggccacgccgcgga	Protospacer
*** ******** ***********   **.* *

23. spacer 2.10|1995771|32|NC_012724|CRT matches to GQ919031 (Streptomyces phage ZL12, complete genome) position: , mismatch: 7, identity: 0.781

cgcgtcatgcgaaacggatacgtcgagatccc	CRISPR spacer
aactccatgcgaaacggatacgccgcgatctc	Protospacer
 .* .*****************.** ****.*

24. spacer 1.1|528523|45|NC_012724|CRT matches to MK875791 (Gordonia phage Yakult, complete genome) position: , mismatch: 8, identity: 0.822

--gcggctccggttgccaagaaggcagcggcaccggcgaagaaggct	CRISPR spacer
aagcgaccc--gccgccaagaaggcagcggcgccggcgaagaaggcc	Protospacer
  ***.*.*  *..*****************.**************.

25. spacer 2.2|1995583|38|NC_012724|PILER-CR,CRISPRCasFinder matches to NZ_CP013415 (Burkholderia ubonensis strain MSMB2035 plasmid pMSMB2035, complete sequence) position: , mismatch: 8, identity: 0.789

cgaaccacgagcgcacacggcaccggccagtgcgtgca	CRISPR spacer
gctgtaacgagcgcacacggcaccggacattgcgtgca	Protospacer
   .. ******************** ** ********

26. spacer 2.2|1995583|38|NC_012724|PILER-CR,CRISPRCasFinder matches to NZ_CP013369 (Burkholderia ubonensis strain RF23-BP41 plasmid pRF23, complete sequence) position: , mismatch: 8, identity: 0.789

cgaaccacgagcgcacacggcaccggccagtgcgtgca	CRISPR spacer
gctgtaacgagcgcacacggcaccggacattgcgtgca	Protospacer
   .. ******************** ** ********

27. spacer 2.6|1995528|32|NC_012724|CRT matches to NZ_CP029835 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed5, complete sequence) position: , mismatch: 8, identity: 0.75

ctaccggcgcgaactggagcgcctgctgctct	CRISPR spacer
gacccggcgcgatctggagcgcctgctcggcc	Protospacer
   ********* **************   *.

28. spacer 2.6|1995528|32|NC_012724|CRT matches to NZ_CP017077 (Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence) position: , mismatch: 8, identity: 0.75

ctaccggcgcgaactggagcgcctgctgctct	CRISPR spacer
cctgcgccgcgaactggatcgcctgctgcgac	Protospacer
*.  ** *********** **********  .

29. spacer 2.6|1995528|32|NC_012724|CRT matches to NC_016586 (Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence) position: , mismatch: 8, identity: 0.75

ctaccggcgcgaactggagcgcctgctgctct	CRISPR spacer
acaatggcgcgaactggggcgcctgctggggt	Protospacer
 .* .************.**********   *

30. spacer 2.6|1995528|32|NC_012724|CRT matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75

ctaccggcgcgaactggagcgcctgctgctct	CRISPR spacer
cttgcggcgcgaactgctgcgcctgcttgacc	Protospacer
**  ************  *********   *.

31. spacer 2.6|1995528|32|NC_012724|CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

ctaccggcgcgaactggagcgcctgctgctct	CRISPR spacer
cttgcggcgcgaactgctgcgcctgcttgacc	Protospacer
**  ************  *********   *.

32. spacer 2.6|1995528|32|NC_012724|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

ctaccggcgcgaactggagcgcctgctgctct	CRISPR spacer
gcgccgccgcgagctggagcgcctgcccgacc	Protospacer
 ..*** *****.*************.   *.

33. spacer 2.6|1995528|32|NC_012724|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 10, identity: 0.688

ctaccggcgcgaactggagcgcctgctgctct	CRISPR spacer
gcgccgccgcgagctggagcgcctgcccgacc	Protospacer
 ..*** *****.*************.   *.

34. spacer 2.6|1995528|32|NC_012724|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

ctaccggcgcgaactggagcgcctgctgctct	CRISPR spacer
gcgccgccgcgagctggagcgcctgcccgacc	Protospacer
 ..*** *****.*************.   *.

35. spacer 2.6|1995528|32|NC_012724|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

ctaccggcgcgaactggagcgcctgctgctct	CRISPR spacer
gcgccgccgcgagctggagcgcctgcccgacc	Protospacer
 ..*** *****.*************.   *.

36. spacer 2.6|1995528|32|NC_012724|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 10, identity: 0.688

ctaccggcgcgaactggagcgcctgctgctct	CRISPR spacer
gcgccgccgcgagctggagcgcctgcccgacc	Protospacer
 ..*** *****.*************.   *.

37. spacer 2.6|1995528|32|NC_012724|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

ctaccggcgcgaactggagcgcctgctgctct	CRISPR spacer
gcgccgccgcgagctggagcgcctgcccgacc	Protospacer
 ..*** *****.*************.   *.

38. spacer 2.6|1995528|32|NC_012724|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

ctaccggcgcgaactggagcgcctgctgctct	CRISPR spacer
gcgccgccgcgagctggagcgcctgcccgacc	Protospacer
 ..*** *****.*************.   *.

39. spacer 2.6|1995528|32|NC_012724|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

ctaccggcgcgaactggagcgcctgctgctct	CRISPR spacer
gcgccgccgcgagctggagcgcctgcccgacc	Protospacer
 ..*** *****.*************.   *.

40. spacer 2.6|1995528|32|NC_012724|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

ctaccggcgcgaactggagcgcctgctgctct	CRISPR spacer
gcgccgccgcgagctggagcgcctgcccgacc	Protospacer
 ..*** *****.*************.   *.

41. spacer 2.6|1995528|32|NC_012724|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

ctaccggcgcgaactggagcgcctgctgctct	CRISPR spacer
gcgccgccgcgagctggagcgcctgcccgacc	Protospacer
 ..*** *****.*************.   *.

42. spacer 2.6|1995528|32|NC_012724|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

ctaccggcgcgaactggagcgcctgctgctct	CRISPR spacer
gcgccgccgcgagctggagcgcctgcccgacc	Protospacer
 ..*** *****.*************.   *.

43. spacer 2.6|1995528|32|NC_012724|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

ctaccggcgcgaactggagcgcctgctgctct	CRISPR spacer
gcgccgccgcgagctggagcgcctgcccgacc	Protospacer
 ..*** *****.*************.   *.

44. spacer 2.6|1995528|32|NC_012724|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

ctaccggcgcgaactggagcgcctgctgctct	CRISPR spacer
gcgccgccgcgagctggagcgcctgcccgacc	Protospacer
 ..*** *****.*************.   *.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 123230 : 156502 42 Burkholderia_phage(84.62%) capsid,head,plate,integrase,holin,terminase,tail,portal attL 113701:113719|attR 165467:165485
DBSCAN-SWA_2 366274 : 404447 46 Burkholderia_phage(55.0%) plate,protease,transposase,integrase attL 366843:366881|attR 393641:393679
DBSCAN-SWA_3 674388 : 683286 7 Pandoravirus(33.33%) NA NA
DBSCAN-SWA_4 961893 : 970224 9 Bacillus_phage(16.67%) NA NA
DBSCAN-SWA_5 1310910 : 1320426 11 Burkholderia_virus(55.56%) lysis,transposase,integrase attL 1303213:1303228|attR 1335147:1335162
DBSCAN-SWA_6 1679560 : 1734316 80 Burkholderia_phage(54.17%) capsid,plate NA
DBSCAN-SWA_7 1891348 : 1929489 51 Burkholderia_phage(95.65%) transposase,capsid,head,plate,holin,terminase,tail,portal NA
DBSCAN-SWA_8 2067039 : 2090736 17 Enterobacteria_phage(50.0%) tRNA,transposase NA
DBSCAN-SWA_9 2190927 : 2243551 58 uncultured_virus(27.27%) transposase,capsid,tRNA,plate,tail,portal NA
DBSCAN-SWA_10 2258002 : 2281348 30 Burkholderia_virus(27.78%) integrase attL 2266570:2266597|attR 2277381:2277408
DBSCAN-SWA_11 2292626 : 2312821 27 Aeromonas_phage(42.86%) terminase,head,plate NA
DBSCAN-SWA_12 2556919 : 2624698 63 Mannheimia_phage(11.11%) integrase,tRNA,transposase,plate attL 2561777:2561792|attR 2601366:2601381
DBSCAN-SWA_13 3023778 : 3132605 100 uncultured_Caudovirales_phage(19.44%) transposase,tRNA,protease,head,plate,integrase,terminase,tail,portal attL 3073650:3073671|attR 3118312:3118333
DBSCAN-SWA_14 3262742 : 3270254 7 Methanothermobacter_phage(16.67%) protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NC_012720
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 54789 : 93411 31 Enterobacteria_phage(22.22%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NC_012725
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 49707 : 117503 55 uncultured_Caudovirales_phage(33.33%) integrase,transposase attL 59679:59696|attR 124724:124741
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage