Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_012847 Bartonella grahamii as4aup plasmid pBGR3, complete sequence 0 crisprs NA 0 0 0 0
NC_012846 Bartonella grahamii as4aup, complete sequence 2 crisprs cas3 3 1 9 1

Results visualization

1. NC_012846
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_012846_1 1129280-1129466 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_012846_2 2141888-2141979 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_012846_1 1.2|1129359|29|NC_012846|CRISPRCasFinder 1129359-1129387 29 NC_012846.1 914366-914394 0 1.0
NC_012846_1 1.3|1129413|29|NC_012846|CRISPRCasFinder 1129413-1129441 29 NC_012846.1 914420-914448 0 1.0
NC_012846_1 1.1|1129305|29|NC_012846|CRISPRCasFinder 1129305-1129333 29 NC_012846.1 914312-914340 1 0.966

1. spacer 1.2|1129359|29|NC_012846|CRISPRCasFinder matches to position: 914366-914394, mismatch: 0, identity: 1.0

ttctgcatgaccgtaaatgcatggttcat	CRISPR spacer
ttctgcatgaccgtaaatgcatggttcat	Protospacer
*****************************

2. spacer 1.3|1129413|29|NC_012846|CRISPRCasFinder matches to position: 914420-914448, mismatch: 0, identity: 1.0

acgagaattgtcgtaaacctcggcataac	CRISPR spacer
acgagaattgtcgtaaacctcggcataac	Protospacer
*****************************

3. spacer 1.1|1129305|29|NC_012846|CRISPRCasFinder matches to position: 914312-914340, mismatch: 1, identity: 0.966

ttctgcattatcaaaaatgtgcggttcac	CRISPR spacer
ttctgcattatcaaaaacgtgcggttcac	Protospacer
*****************.***********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_012846_1 1.3|1129413|29|NC_012846|CRISPRCasFinder 1129413-1129441 29 MT735629 Vibrio alginolyticus phage vB_ValS_PJ32, complete genome 78205-78233 8 0.724

1. spacer 1.3|1129413|29|NC_012846|CRISPRCasFinder matches to MT735629 (Vibrio alginolyticus phage vB_ValS_PJ32, complete genome) position: , mismatch: 8, identity: 0.724

acgagaattgtcgtaaacctcggcataac	CRISPR spacer
cggtccattgtcgtaaacctcgggataca	Protospacer
  *   ***************** ***  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 372751 : 459212 85 Acidithiobacillus_phage(20.59%) integrase,tRNA,capsid,head,plate,terminase,tail,portal attL 370202:370219|attR 458622:458639
DBSCAN-SWA_2 907699 : 981922 58 Edwardsiella_phage(21.43%) integrase,terminase,capsid,portal attL 926065:926096|attR 987039:987070
DBSCAN-SWA_3 1005411 : 1037128 38 Escherichia_phage(25.0%) tail,integrase attL 1005033:1005048|attR 1031799:1031814
DBSCAN-SWA_4 1040309 : 1065911 35 Acidithiobacillus_phage(33.33%) capsid,head,plate,terminase,portal NA
DBSCAN-SWA_5 1123116 : 1151153 37 Ochrobactrum_phage(13.64%) integrase,capsid,terminase,tail,portal attL 1111736:1111752|attR 1159172:1159188
DBSCAN-SWA_6 1390109 : 1398535 6 uncultured_Mediterranean_phage(66.67%) NA NA
DBSCAN-SWA_7 1806254 : 1885850 43 Ochrobactrum_phage(41.67%) tail,integrase attL 1797287:1797304|attR 1880306:1880323
DBSCAN-SWA_8 1919152 : 1979166 31 Caulobacter_phage(31.25%) integrase,capsid,head,terminase,tail,portal attL 1947625:1947659|attR 1984423:1984457
DBSCAN-SWA_9 2237636 : 2245783 11 Rhizobium_phage(33.33%) transposase NA
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NC_012846.1|WP_015856186.1|958333_958858_-|hypothetical-protein 958333_958858_- 174 aa aa NA NA NA 907699-981922 yes