1. spacer 2.14|1498706|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to MK416018 (Klebsiella phage ST147-VIM1phi7.1, complete genome) position: , mismatch: 5, identity: 0.844
aacgtaggcgtgaatggcgtcacaggcatttc CRISPR spacer
aacgttggcgtgaatggcgtcaccggcatcag Protospacer
***** ***************** *****.
2. spacer 2.22|1499186|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to NC_015579 (Novosphingobium sp. PP1Y plasmid Lpl, complete sequence) position: , mismatch: 5, identity: 0.844
tttggcgatcaggtggcggcgatc-caatcctc CRISPR spacer
cttggcggtctggtggcggcgatcgcgatcct- Protospacer
.******.** ************* *.*****
3. spacer 2.75|1502367|32|NC_012691|CRISPRCasFinder,CRT matches to NZ_CP021332 (Maritalea myrionectae strain HL2708#5 plasmid pHL2708Y3, complete sequence) position: , mismatch: 5, identity: 0.844
aaggaatccgccgtgatggcgaatttcaccag CRISPR spacer
aaccgatccggcgtgatggcgattttcaccag Protospacer
** .***** *********** *********
4. spacer 2.114|1502367|33|NC_012691|PILER-CR matches to NZ_CP021332 (Maritalea myrionectae strain HL2708#5 plasmid pHL2708Y3, complete sequence) position: , mismatch: 5, identity: 0.848
aaggaatccgccgtgatggcgaatttcaccagc CRISPR spacer
aaccgatccggcgtgatggcgattttcaccagc Protospacer
** .***** *********** **********
5. spacer 2.13|1498646|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to AP014720 (Arthrobacter sp. Hiyo8 plasmid pHiyo8-1 DNA, complete genome, strain: Hiyo8) position: , mismatch: 6, identity: 0.812
gtcgacgaactggagcacgccggagcgccgga CRISPR spacer
atcgacgaactggagcacgccgtagttgcggc Protospacer
.********************* **. ***
6. spacer 2.13|1498646|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to KJ173786 (Microbacterium phage vB_MoxS-ISF9, complete genome) position: , mismatch: 6, identity: 0.812
gtcgacgaactggagcacgccggagc--gccgga CRISPR spacer
gacgacgtactggagcacgcccgagtgggccg-- Protospacer
* ***** ************* ***. ****
7. spacer 2.17|1498886|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to KC107834 (Cronobacter sakazakii phage vB_CskP_GAP227, complete genome) position: , mismatch: 6, identity: 0.812
tggtacgcgccttgtgctatttcagctccgct CRISPR spacer
tgtaacgcgcctggtgctctttcagctccggg Protospacer
** ******** ***** ***********
8. spacer 2.17|1498886|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to LN878149 (Cronobacter phage Dev-CD-23823 complete sequence) position: , mismatch: 6, identity: 0.812
tggtacgcgccttgtgctatttcagctccgct CRISPR spacer
tgtaacgcgcctggtgctctttcagctccggg Protospacer
** ******** ***** ***********
9. spacer 2.41|1500326|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030762 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812
agcggggcagggatggcgacatgg-aacgcatg CRISPR spacer
ggcggggcaggcttggcgacatggcaaagcct- Protospacer
.********** *********** ** ** *
10. spacer 2.55|1501166|32|NC_012691|CRISPRCasFinder,CRT matches to NZ_CP042508 (Leclercia adecarboxylata strain E1 plasmid pE1_003, complete sequence) position: , mismatch: 6, identity: 0.812
-cgcagcgtgcacaaagaacgccagcaaagcca CRISPR spacer
gcgc-gcgttcacaaagaacaccagcaattaca Protospacer
*** **** **********.******* **
11. spacer 2.13|1498646|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044425 (Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence) position: , mismatch: 7, identity: 0.781
gtcgacgaactggagcacgccggagcgccgga CRISPR spacer
gaccaccgactggatcacgccggagggccggg Protospacer
* * ** .****** ********** *****.
12. spacer 2.19|1499006|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to MN284906 (Gordonia phage CherryonLim, complete genome) position: , mismatch: 7, identity: 0.781
agcaagcgcgcaagatgcttgagcgaatgaaa CRISPR spacer
agcacgcgcgcaagatgtttgagcccgtgacg Protospacer
**** ************.****** .*** .
13. spacer 2.22|1499186|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049029 (Fluviibacterium aquatile strain SC52 plasmid pSC52_1, complete sequence) position: , mismatch: 7, identity: 0.781
tttggcgatcaggtggcggcgatccaatcctc CRISPR spacer
cttggcgatcaggtggccgcgatgcagggcgc Protospacer
.**************** ***** **. * *
14. spacer 2.30|1499666|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029776 (Deinococcus actinosclerus strain Deinococcus actinosclerus SJTR plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781
ggagctgagcagcacgctggtgt-cagtcgtga CRISPR spacer
ggagctgggcggcacgctggtgtatggacggg- Protospacer
*******.**.************ ..* ** *
15. spacer 2.42|1500386|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to NC_014908 (Alicycliphilus denitrificans BC plasmid pALIDE01, complete sequence) position: , mismatch: 7, identity: 0.781
gaaagtgattgagctgtgccatggcatcaaga CRISPR spacer
gaccagcattgaggtgtgccatgggatcaaga Protospacer
** . ****** ********** *******
16. spacer 2.42|1500386|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027670 (Simplicispira suum strain SC1-8 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
gaaagtgattgagctgtgccatggcatcaaga CRISPR spacer
gaccagcattgaggtgtgccatgggatcaaga Protospacer
** . ****** ********** *******
17. spacer 2.56|1501226|32|NC_012691|CRISPRCasFinder,CRT matches to NZ_CP020929 (Weissella cibaria strain M2 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
agctggca---gctaactactacactgccgaaatc CRISPR spacer
---tagcacacgcaaactactacacggccgaaatt Protospacer
*.*** ** *********** ********.
18. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to LN881734 (Escherichia phage slur11, complete genome) position: , mismatch: 7, identity: 0.781
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
actgctgctaatgcaactaaacaaactgctaa Protospacer
.**************** *******. . **.
19. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to MN895435 (Escherichia phage teqhal, complete genome) position: , mismatch: 7, identity: 0.781
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
actgctgctaatgcaactaaacaaactgctaa Protospacer
.**************** *******. . **.
20. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to MG781191 (Escherichia phage vB_EcoM-fHoEco02, complete genome) position: , mismatch: 7, identity: 0.781
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
actgctgctaatgcaactaaacaaactgctaa Protospacer
.**************** *******. . **.
21. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to MN895437 (Escherichia phage teqskov, complete genome) position: , mismatch: 7, identity: 0.781
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
actgctgctaatgcaactaaacaaactgctaa Protospacer
.**************** *******. . **.
22. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to KY290975 (Escherichia phage YUEEL01, complete genome) position: , mismatch: 7, identity: 0.781
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
actgctgctaatgcaactaaacaaactgctaa Protospacer
.**************** *******. . **.
23. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to NC_019399 (Enterobacteria phage vB_EcoM_ACG-C40, complete genome) position: , mismatch: 7, identity: 0.781
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
actgctgctaatgcaactaaacaaactgctaa Protospacer
.**************** *******. . **.
24. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to LN881736 (Escherichia phage slur14, complete genome) position: , mismatch: 7, identity: 0.781
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
actgctgctaatgcaactaaacaaactgctaa Protospacer
.**************** *******. . **.
25. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to KU925172 (Escherichia phage PE37, complete genome) position: , mismatch: 7, identity: 0.781
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
actgctgctaatgcaactaaacaaactgctaa Protospacer
.**************** *******. . **.
26. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to MK327937 (Escherichia phage vB_EcoM_G10400, complete genome) position: , mismatch: 7, identity: 0.781
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
actgctgctaatgcaactaaacaaactgctaa Protospacer
.**************** *******. . **.
27. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to NC_042129 (Escherichia phage slur03, complete genome) position: , mismatch: 7, identity: 0.781
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
actgctgctaatgcaactaaacaaactgctaa Protospacer
.**************** *******. . **.
28. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to MH809535 (Yersinia phage PYPS2T, complete genome) position: , mismatch: 7, identity: 0.781
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
actgctgctaatgcaactaaacaaactgctaa Protospacer
.**************** *******. . **.
29. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to NC_042077 (Shigella phage Sf21, complete genome) position: , mismatch: 7, identity: 0.781
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
actgctgctaatgcaactaaacaaactgctaa Protospacer
.**************** *******. . **.
30. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to MN508618 (UNVERIFIED: Escherichia phage ES26, complete genome) position: , mismatch: 7, identity: 0.781
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
actgctgctaatgcaactaaacaaactgctaa Protospacer
.**************** *******. . **.
31. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to KY608967 (UNVERIFIED: Escherichia phage CF2, complete genome) position: , mismatch: 7, identity: 0.781
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
actgctgctaatgcaactaaacaaactgctaa Protospacer
.**************** *******. . **.
32. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to NC_042039 (Shigella phage Sf22, complete genome) position: , mismatch: 7, identity: 0.781
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
actgctgctaatgcaactaaacaaactgctaa Protospacer
.**************** *******. . **.
33. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to MF327009 (Shigella phage Sf25, complete genome) position: , mismatch: 7, identity: 0.781
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
actgctgctaatgcaactaaacaaactgctaa Protospacer
.**************** *******. . **.
34. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to MK373781 (Escherichia phage vB_EcoM_KAW1E185, complete genome) position: , mismatch: 7, identity: 0.781
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
actgctgctaatgcaactaaacaaactgctaa Protospacer
.**************** *******. . **.
35. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to LN881737 (Escherichia phage slur13, complete genome) position: , mismatch: 7, identity: 0.781
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
actgctgctaatgcaactaaacaaactgctaa Protospacer
.**************** *******. . **.
36. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to MN508614 (UNVERIFIED: Escherichia phage ES12, complete genome) position: , mismatch: 7, identity: 0.781
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
actgctgctaatgcaactaaacaaactgctaa Protospacer
.**************** *******. . **.
37. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to MG781190 (Escherichia phage vB_EcoM-fFiEco06, complete genome) position: , mismatch: 7, identity: 0.781
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
actgctgctaatgcaactaaacaaactgctaa Protospacer
.**************** *******. . **.
38. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to LR215723 (Yersinia phage fPS-90 genome assembly, chromosome: I) position: , mismatch: 7, identity: 0.781
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
actgctgctaatgcaactaaacaaactgctaa Protospacer
.**************** *******. . **.
39. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to KJ668714 (Escherichia phage e11/2, complete genome) position: , mismatch: 7, identity: 0.781
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
actgctgctaatgcaactaaacaaactgctaa Protospacer
.**************** *******. . **.
40. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to MT682714 (Escherichia phage vB_EcoM_Lutter, complete genome) position: , mismatch: 7, identity: 0.781
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
actgctgctaatgcaactaaacaaactgctaa Protospacer
.**************** *******. . **.
41. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to MK962750 (Shigella phage CM8, complete genome) position: , mismatch: 7, identity: 0.781
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
actgctgctaatgcaactaaacaaactgctaa Protospacer
.**************** *******. . **.
42. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to MN895436 (Escherichia phage teqsoen, complete genome) position: , mismatch: 7, identity: 0.781
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
actgctgctaatgcaactaaacaaactgctaa Protospacer
.**************** *******. . **.
43. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to MT682710 (Escherichia phage vB_EcoM_FT, complete genome) position: , mismatch: 7, identity: 0.781
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
actgctgctaatgcaactaaacaaactgctaa Protospacer
.**************** *******. . **.
44. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to MG775043 (Citrobacter phage vB_CroM_CrRp10, complete genome) position: , mismatch: 7, identity: 0.781
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
actgctgctaatgcaactaaacaaactgctaa Protospacer
.**************** *******. . **.
45. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to LN881726 (Escherichia phage slur02, complete genome) position: , mismatch: 7, identity: 0.781
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
actgctgctaatgcaactaaacaaactgctaa Protospacer
.**************** *******. . **.
46. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to MK373785 (Escherichia phage vB_EcoM_OE5505, complete genome) position: , mismatch: 7, identity: 0.781
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
actgctgctaatgcaactaaacaaactgctaa Protospacer
.**************** *******. . **.
47. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to NC_042078 (Shigella phage Sf24, complete genome) position: , mismatch: 7, identity: 0.781
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
actgctgctaatgcaactaaacaaactgctaa Protospacer
.**************** *******. . **.
48. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to MH992121 (UNVERIFIED: Escherichia phage MLF4, partial genome) position: , mismatch: 7, identity: 0.781
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
actgctgctaatgcaactaaacaaactgctaa Protospacer
.**************** *******. . **.
49. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to MK373779 (Escherichia phage vB_EcoM_G9062, complete genome) position: , mismatch: 7, identity: 0.781
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
actgctgctaatgcaactaaacaaactgctaa Protospacer
.**************** *******. . **.
50. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to MN508616 (UNVERIFIED: Escherichia phage ES19, complete genome) position: , mismatch: 7, identity: 0.781
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
actgctgctaatgcaactaaacaaactgctaa Protospacer
.**************** *******. . **.
51. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to MT446387 (UNVERIFIED: Escherichia virus TH09, complete genome) position: , mismatch: 7, identity: 0.781
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
actgctgctaatgcaactaaacaaactgctaa Protospacer
.**************** *******. . **.
52. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to MK327946 (Escherichia phage vB_EcoM_G4507, complete genome) position: , mismatch: 7, identity: 0.781
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
actgctgctaatgcaactaaacaaactgctaa Protospacer
.**************** *******. . **.
53. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to MH355584 (Escherichia phage vB_EcoM_JB75, complete genome) position: , mismatch: 7, identity: 0.781
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
actgctgctaatgcaactaaacaaactgctaa Protospacer
.**************** *******. . **.
54. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to LC465543 (Shigella phage SfPhi01 DNA, complete sequence) position: , mismatch: 7, identity: 0.781
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
actgctgctaatgcaactaaacaaactgctaa Protospacer
.**************** *******. . **.
55. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to MK977694 (Escherichia phage vB_EcoM-Sa45lw, complete genome) position: , mismatch: 7, identity: 0.781
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
actgctgctaatgcaactaaacaaactgctaa Protospacer
.**************** *******. . **.
56. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to LR877332 (Shigella phage vB_SsoM_JK08 genome assembly, chromosome: 1) position: , mismatch: 7, identity: 0.781
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
actgctgctaatgcaactaaacaaactgctaa Protospacer
.**************** *******. . **.
57. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to MK327929 (Escherichia phage D5505, complete genome) position: , mismatch: 7, identity: 0.781
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
actgctgctaatgcaactaaacaaactgctaa Protospacer
.**************** *******. . **.
58. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to MK327936 (Escherichia phage vB_EcoM_G2540, complete genome) position: , mismatch: 7, identity: 0.781
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
actgctgctaatgcaactaaacaaactgctaa Protospacer
.**************** *******. . **.
59. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to MK327939 (Escherichia phage vB_EcoM_G4498, complete genome) position: , mismatch: 7, identity: 0.781
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
actgctgctaatgcaactaaacaaactgctaa Protospacer
.**************** *******. . **.
60. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to MN508617 (UNVERIFIED: Escherichia phage ES21, complete genome) position: , mismatch: 7, identity: 0.781
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
actgctgctaatgcaactaaacaaactgctaa Protospacer
.**************** *******. . **.
61. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to MK962755 (Shigella phage JK38, complete genome) position: , mismatch: 7, identity: 0.781
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
actgctgctaatgcaactaaacaaactgctaa Protospacer
.**************** *******. . **.
62. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to MK327945 (Escherichia phage vB_EcoM_G4500, complete genome) position: , mismatch: 7, identity: 0.781
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
actgctgctaatgcaactaaacaaactgctaa Protospacer
.**************** *******. . **.
63. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to MF001360 (Escherichia phage ECO4, partial genome) position: , mismatch: 7, identity: 0.781
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
actgctgctaatgcaactaaacaaactgctaa Protospacer
.**************** *******. . **.
64. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to KT184311 (Enterobacteria phage GiZh, complete genome) position: , mismatch: 7, identity: 0.781
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
actgctgctaatgcaactaaacaaactgctaa Protospacer
.**************** *******. . **.
65. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to LR215724 (Yersinia phage fPS-65 genome assembly, chromosome: I) position: , mismatch: 7, identity: 0.781
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
actgctgctaatgcaactaaacaaactgctaa Protospacer
.**************** *******. . **.
66. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to MK327940 (Escherichia phage vB_EcoM_G29, complete genome) position: , mismatch: 7, identity: 0.781
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
actgctgctaatgcaactaaacaaactgctaa Protospacer
.**************** *******. . **.
67. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to LN881733 (Escherichia phage slur08, complete genome) position: , mismatch: 7, identity: 0.781
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
actgctgctaatgcaactaaacaaactgctaa Protospacer
.**************** *******. . **.
68. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to MK373786 (Escherichia phage vB_EcoM_R5505, complete genome) position: , mismatch: 7, identity: 0.781
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
actgctgctaatgcaactaaacaaactgctaa Protospacer
.**************** *******. . **.
69. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to KT184312 (Enterobacteria phage Kha5h, complete genome) position: , mismatch: 7, identity: 0.781
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
actgctgctaatgcaactaaacaaactgctaa Protospacer
.**************** *******. . **.
70. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to HE956711 (Yersinia phage phiD1 complete genome) position: , mismatch: 7, identity: 0.781
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
actgctgctaatgcaactaaacaaactgctaa Protospacer
.**************** *******. . **.
71. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to NC_031085 (Shigella phage SHBML-50-1, complete genome) position: , mismatch: 7, identity: 0.781
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
actgctgctaatgcaactaaacaaactgctaa Protospacer
.**************** *******. . **.
72. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to KT184308 (Enterobacteria phage Aplg8, complete genome) position: , mismatch: 7, identity: 0.781
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
actgctgctaatgcaactaaacaaactgctaa Protospacer
.**************** *******. . **.
73. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to MH992510 (Escherichia phage vB_EcoM_DalCa, complete genome) position: , mismatch: 7, identity: 0.781
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
actgctgctaatgcaactaaacaaactgctaa Protospacer
.**************** *******. . **.
74. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to LN881729 (Escherichia phage slur04, complete genome) position: , mismatch: 7, identity: 0.781
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
actgctgctaatgcaactaaacaaactgctaa Protospacer
.**************** *******. . **.
75. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to MG945451 (UNVERIFIED: Microviridae sp. isolate 7450-1711, complete genome) position: , mismatch: 7, identity: 0.781
-gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
tgcctttg-tagtgtaacaaaacaaataaataa Protospacer
**. .** **.**.*****************.
76. spacer 2.70|1502067|32|NC_012691|CRISPRCasFinder,CRT matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 7, identity: 0.781
acatggcaacagattatcaccacggcgtccgc CRISPR spacer
acatggcaactgattatcaacaccgggacgac Protospacer
********** ******** *** * * * .*
77. spacer 2.70|1502067|32|NC_012691|CRISPRCasFinder,CRT matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 7, identity: 0.781
acatggcaacagattatcaccacggcgtccgc CRISPR spacer
acatggcaactgattatcaacaccgggacgac Protospacer
********** ******** *** * * * .*
78. spacer 2.77|1502487|32|NC_012691|CRISPRCasFinder,CRT matches to NZ_CP032696 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525b, complete sequence) position: , mismatch: 7, identity: 0.781
caatccctgcgggcttgcgcggtatgggggca CRISPR spacer
caatccgcgcgggcttgcgcggtgtacgtgta Protospacer
****** .***************.*. * *.*
79. spacer 2.78|1502547|32|NC_012691|CRISPRCasFinder,CRT matches to J02451 (Enterobacteria phage fd strain 478, complete genome) position: , mismatch: 7, identity: 0.781
ggaaatctccaaatcaccgtcaatctcatatt CRISPR spacer
ggagacagtcaaatcaccgtcaatatgatatt Protospacer
***.*. .*************** * *****
80. spacer 2.80|1502667|32|NC_012691|CRISPRCasFinder,CRT matches to NZ_CP016481 (Synechococcus sp. PCC 7117 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.781
-caagcgtgatgaatatcatcccgatttttcgt CRISPR spacer
attggcgt-atgaatatgatccctatttttcgc Protospacer
. .**** ******** ***** ********.
81. spacer 2.88|1503147|32|NC_012691|CRISPRCasFinder,CRT matches to NZ_CP022523 (Pseudoalteromonas sp. NC201 plasmid pNC201, complete sequence) position: , mismatch: 7, identity: 0.781
ttattaatgctcttaatgagtctataacgtta-- CRISPR spacer
gcattaatgctgttaatgagcctat--ctttatc Protospacer
.********* ********.**** * ***
82. spacer 2.88|1503147|32|NC_012691|CRISPRCasFinder,CRT matches to NC_047983 (Lactobacillus phage Lb, complete genome) position: , mismatch: 7, identity: 0.781
ttattaatgctcttaatgagtct----ataacgtta CRISPR spacer
ttattagtgctctttatgagtctcgccataat---- Protospacer
******.******* ******** ****.
83. spacer 2.97|1501346|33|NC_012691|PILER-CR matches to NZ_CP013526 (Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence) position: , mismatch: 7, identity: 0.788
aatgtgcgcattttatcaggatctaattcgacc--- CRISPR spacer
aatttgcgcattttatcaggatc---tttgcgcgtg Protospacer
*** ******************* **.* *
84. spacer 2.99|1501467|33|NC_012691|PILER-CR matches to MN693103 (Marine virus AFVG_25M539, complete genome) position: , mismatch: 7, identity: 0.788
gctgctgctaatgcaacaaaacaaata--aatagc CRISPR spacer
gctgctgctaatgtaacacaacaagcattaaca-- Protospacer
*************.**** *****..* **.*
85. spacer 2.117|1502547|33|NC_012691|PILER-CR matches to J02451 (Enterobacteria phage fd strain 478, complete genome) position: , mismatch: 7, identity: 0.788
ggaaatctccaaatcaccgtcaatctcatattc CRISPR spacer
ggagacagtcaaatcaccgtcaatatgatattc Protospacer
***.*. .*************** * ******
86. spacer 2.2|1497986|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to NC_018069 (Solibacillus silvestris StLB046 plasmid pSSIL1, complete sequence) position: , mismatch: 8, identity: 0.75
tattattagaagccattaagctagaaaaagat CRISPR spacer
tggaaatccaagccattaatctagaaaatgat Protospacer
*. * * ********** ******** ***
87. spacer 2.8|1498346|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to MF351863 (Synechococcus phage Bellamy, complete genome) position: , mismatch: 8, identity: 0.75
tggctgtttaacagatggcagtcattctgtat- CRISPR spacer
atgctgatgaacagatggcagtca-tcagcacc Protospacer
**** * *************** ** *.*.
88. spacer 2.9|1498406|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP006570 (Sodalis praecaptivus strain HS1 plasmid pHS1, complete sequence) position: , mismatch: 8, identity: 0.75
aaatcaatc---gcgtcagtatttccacaccctgc CRISPR spacer
---ttcgtcacggcgtcaatatttccacagcctgc Protospacer
*. .** ******.********** *****
89. spacer 2.13|1498646|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to MH479919 (Mycobacterium phage Moose, complete genome) position: , mismatch: 8, identity: 0.75
gtcgacgaactggagcacgccggagcgccgga CRISPR spacer
cgcgacgaactggagcacgccgctgcgcgtat Protospacer
******************** **** .
90. spacer 2.13|1498646|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to MG925342 (Mycobacterium phage Forsytheast, complete genome) position: , mismatch: 8, identity: 0.75
gtcgacgaactggagcacgccggagcgccgga CRISPR spacer
cgcgacgaactggagcacgccgctgcgcgtat Protospacer
******************** **** .
91. spacer 2.13|1498646|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to MT952847 (Mycobacterium phage Topgun, complete genome) position: , mismatch: 8, identity: 0.75
gtcgacgaactggagcacgccggagcgccgga CRISPR spacer
cgcgacgaactggagcacgccgctgcgcgtat Protospacer
******************** **** .
92. spacer 2.13|1498646|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to MH230878 (Mycobacterium phage Oogway, complete genome) position: , mismatch: 8, identity: 0.75
gtcgacgaactggagcacgccggagcgccgga CRISPR spacer
cgcgacgaactggagcacgccgcggcgcgtat Protospacer
******************** .**** .
93. spacer 2.13|1498646|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to AP018478 (Mycobacterium phage A6 DNA, complete sequence) position: , mismatch: 8, identity: 0.75
gtcgacgaactggagcacgccggagcgccgga CRISPR spacer
cgcgacgaactggagcacgccgcggcgcgtat Protospacer
******************** .**** .
94. spacer 2.13|1498646|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to MN585999 (Mycobacterium phage Briton15, complete genome) position: , mismatch: 8, identity: 0.75
gtcgacgaactggagcacgccggagcgccgga CRISPR spacer
cgcgacgaactggagcacgccgcggcgcgtat Protospacer
******************** .**** .
95. spacer 2.13|1498646|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to KX683876 (Mycobacterium phage CactusRose, complete genome) position: , mismatch: 8, identity: 0.75
gtcgacgaactggagcacgccggagcgccgga CRISPR spacer
cgcgacgaactggagcacgccgctgcgcgtat Protospacer
******************** **** .
96. spacer 2.13|1498646|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to MN585985 (Mycobacterium phage Watermelon, complete genome) position: , mismatch: 8, identity: 0.75
gtcgacgaactggagcacgccggagcgccgga CRISPR spacer
cgcgacgaactggagcacgccgctgcgcgtat Protospacer
******************** **** .
97. spacer 2.13|1498646|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to NC_022070 (Mycobacteriophage Wheeler, complete genome) position: , mismatch: 8, identity: 0.75
gtcgacgaactggagcacgccggagcgccgga CRISPR spacer
cgcgacgaactggagcacgccgcggcgcgtat Protospacer
******************** .**** .
98. spacer 2.13|1498646|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to MG944221 (Mycobacterium phage Scowl, complete genome) position: , mismatch: 8, identity: 0.75
gtcgacgaactggagcacgccggagcgccgga CRISPR spacer
cgcgacgaactggagcacgccgctgcgcgtat Protospacer
******************** **** .
99. spacer 2.13|1498646|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to MN062710 (Mycobacterium phage Ajay, complete genome) position: , mismatch: 8, identity: 0.75
gtcgacgaactggagcacgccggagcgccgga CRISPR spacer
cgcgacgaactggagcacgccgctgcgcgtat Protospacer
******************** **** .
100. spacer 2.13|1498646|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to NC_028828 (Mycobacterium phage TheloniousMonk, complete genome) position: , mismatch: 8, identity: 0.75
gtcgacgaactggagcacgccggagcgccgga CRISPR spacer
cgcgacgaactggagcacgccgcggcgcgtat Protospacer
******************** .**** .
101. spacer 2.13|1498646|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to MK524531 (Mycobacterium phage Rutherferd, complete genome) position: , mismatch: 8, identity: 0.75
gtcgacgaactggagcacgccggagcgccgga CRISPR spacer
cgcgacgaactggagcacgccgcggcgcgtat Protospacer
******************** .**** .
102. spacer 2.13|1498646|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to MT776812 (Mycobacterium phage HarryOW, complete genome) position: , mismatch: 8, identity: 0.75
gtcgacgaactggagcacgccggagcgccgga CRISPR spacer
cgcgacgaactggagcacgccgctgcgcgtat Protospacer
******************** **** .
103. spacer 2.13|1498646|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to KX574454 (Mycobacterium phage PacerPaul, complete genome) position: , mismatch: 8, identity: 0.75
gtcgacgaactggagcacgccggagcgccgga CRISPR spacer
cgcgacgaactggagcacgccgctgcgcgtat Protospacer
******************** **** .
104. spacer 2.13|1498646|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to AP018477 (Mycobacterium phage BK1 DNA, complete sequence) position: , mismatch: 8, identity: 0.75
gtcgacgaactggagcacgccggagcgccgga CRISPR spacer
cgcgacgaactggagcacgccgcggcgcgtat Protospacer
******************** .**** .
105. spacer 2.13|1498646|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to JN153085 (Mycobacterium phage Doom, complete genome) position: , mismatch: 8, identity: 0.75
gtcgacgaactggagcacgccggagcgccgga CRISPR spacer
cgcgacgaactggagcacgccgcggcgcgtat Protospacer
******************** .**** .
106. spacer 2.13|1498646|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to KX522649 (Mycobacterium phage Bircsak, complete genome) position: , mismatch: 8, identity: 0.75
gtcgacgaactggagcacgccggagcgccgga CRISPR spacer
cgcgacgaactggagcacgccgctgcgcgtat Protospacer
******************** **** .
107. spacer 2.13|1498646|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to MG962372 (Mycobacterium phage McGuire, complete genome) position: , mismatch: 8, identity: 0.75
gtcgacgaactggagcacgccggagcgccgga CRISPR spacer
cgcgacgaactggagcacgccgcggcgcgtat Protospacer
******************** .**** .
108. spacer 2.13|1498646|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to MK305893 (Mycobacterium phage Beatrix, complete genome) position: , mismatch: 8, identity: 0.75
gtcgacgaactggagcacgccggagcgccgga CRISPR spacer
cgcgacgaactggagcacgccgctgcgcgtat Protospacer
******************** **** .
109. spacer 2.13|1498646|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to NC_023862 (Mycobacterium phage Alsfro, complete genome) position: , mismatch: 8, identity: 0.75
gtcgacgaactggagcacgccggagcgccgga CRISPR spacer
cgcgacgaactggagcacgccgctgcgcgtat Protospacer
******************** **** .
110. spacer 2.13|1498646|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to NC_022324 (Mycobacterium phage SarFire, complete genome) position: , mismatch: 8, identity: 0.75
gtcgacgaactggagcacgccggagcgccgga CRISPR spacer
cgcgacgaactggagcacgccgctgcgcgtat Protospacer
******************** **** .
111. spacer 2.13|1498646|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to KX522943 (Mycobacterium phage Gompeii16, complete genome) position: , mismatch: 8, identity: 0.75
gtcgacgaactggagcacgccggagcgccgga CRISPR spacer
cgcgacgaactggagcacgccgctgcgcgtat Protospacer
******************** **** .
112. spacer 2.13|1498646|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to KF493880 (Mycobacterium phage HanShotFirst, complete genome) position: , mismatch: 8, identity: 0.75
gtcgacgaactggagcacgccggagcgccgga CRISPR spacer
cgcgacgaactggagcacgccgctgcgcgtat Protospacer
******************** **** .
113. spacer 2.13|1498646|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to MN585970 (Mycobacterium phage Killigrew, complete genome) position: , mismatch: 8, identity: 0.75
gtcgacgaactggagcacgccggagcgccgga CRISPR spacer
cgcgacgaactggagcacgccgctgcgcgtat Protospacer
******************** **** .
114. spacer 2.13|1498646|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to MH450133 (Mycobacterium phage SwissCheese, complete genome) position: , mismatch: 8, identity: 0.75
gtcgacgaactggagcacgccggagcgccgga CRISPR spacer
cgcgacgaactggagcacgccgctgcgcgtat Protospacer
******************** **** .
115. spacer 2.13|1498646|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to MN428054 (Mycobacterium phage JackSparrow, complete genome) position: , mismatch: 8, identity: 0.75
gtcgacgaactggagcacgccggagcgccgga CRISPR spacer
cgcgacgaactggagcacgccgcggcgcgtat Protospacer
******************** .**** .
116. spacer 2.13|1498646|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to EU744249 (Mycobacterium phage Lockley, complete genome) position: , mismatch: 8, identity: 0.75
gtcgacgaactggagcacgccggagcgccgga CRISPR spacer
cgcgacgaactggagcacgccgctgcgcgtat Protospacer
******************** **** .
117. spacer 2.13|1498646|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to KF560331 (Mycobacterium phage Graduation, complete genome) position: , mismatch: 8, identity: 0.75
gtcgacgaactggagcacgccggagcgccgga CRISPR spacer
cgcgacgaactggagcacgccgctgcgcgtat Protospacer
******************** **** .
118. spacer 2.13|1498646|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to NC_031067 (Mycobacterium phage Makemake, complete genome) position: , mismatch: 8, identity: 0.75
gtcgacgaactggagcacgccggagcgccgga CRISPR spacer
cgcgacgaactggagcacgccgctgcgcgtat Protospacer
******************** **** .
119. spacer 2.13|1498646|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to NC_023687 (Mycobacterium phage Bruns, complete genome) position: , mismatch: 8, identity: 0.75
gtcgacgaactggagcacgccggagcgccgga CRISPR spacer
cgcgacgaactggagcacgccgctgcgcgtat Protospacer
******************** **** .
120. spacer 2.13|1498646|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to MK310141 (Mycobacterium phage Fenn, complete genome) position: , mismatch: 8, identity: 0.75
gtcgacgaactggagcacgccggagcgccgga CRISPR spacer
cgcgacgaactggagcacgccgctgcgcgtat Protospacer
******************** **** .
121. spacer 2.13|1498646|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to MH697575 (Mycobacterium phage Adahisdi, complete genome) position: , mismatch: 8, identity: 0.75
gtcgacgaactggagcacgccggagcgccgga CRISPR spacer
cgcgacgaactggagcacgccgctgcgcgtat Protospacer
******************** **** .
122. spacer 2.13|1498646|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to MF668283 (Mycobacterium phage Smairt, complete genome) position: , mismatch: 8, identity: 0.75
gtcgacgaactggagcacgccggagcgccgga CRISPR spacer
cgcgacgaactggagcacgccgctgcgcgtat Protospacer
******************** **** .
123. spacer 2.13|1498646|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to KP027204 (Mycobacterium phage Thor, complete genome) position: , mismatch: 8, identity: 0.75
gtcgacgaactggagcacgccggagcgccgga CRISPR spacer
cgcgacgaactggagcacgccgctgcgcgtat Protospacer
******************** **** .
124. spacer 2.13|1498646|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to MH020236 (Mycobacterium phage GageAP, complete genome) position: , mismatch: 8, identity: 0.75
gtcgacgaactggagcacgccggagcgccgga CRISPR spacer
cgcgacgaactggagcacgccgctgcgcgtat Protospacer
******************** **** .
125. spacer 2.13|1498646|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to EU744252 (Mycobacterium phage DD5, complete genome) position: , mismatch: 8, identity: 0.75
gtcgacgaactggagcacgccggagcgccgga CRISPR spacer
cgcgacgaactggagcacgccgctgcgcgtat Protospacer
******************** **** .
126. spacer 2.13|1498646|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to NC_023726 (Mycobacterium phage Euphoria, complete genome) position: , mismatch: 8, identity: 0.75
gtcgacgaactggagcacgccggagcgccgga CRISPR spacer
cgcgacgaactggagcacgccgctgcgcgtat Protospacer
******************** **** .
127. spacer 2.13|1498646|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to MK524497 (Mycobacterium phage Francis47, complete genome) position: , mismatch: 8, identity: 0.75
gtcgacgaactggagcacgccggagcgccgga CRISPR spacer
cgcgacgaactggagcacgccgctgcgcgtat Protospacer
******************** **** .
128. spacer 2.13|1498646|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to MG099951 (Mycobacterium phage Wilkins, complete genome) position: , mismatch: 8, identity: 0.75
gtcgacgaactggagcacgccggagcgccgga CRISPR spacer
cgcgacgaactggagcacgccgcggcgcgtat Protospacer
******************** .**** .
129. spacer 2.13|1498646|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to NC_023748 (Mycobacterium phage SkiPole, complete genome) position: , mismatch: 8, identity: 0.75
gtcgacgaactggagcacgccggagcgccgga CRISPR spacer
cgcgacgaactggagcacgccgctgcgcgtat Protospacer
******************** **** .
130. spacer 2.13|1498646|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to MK359316 (Mycobacterium phage Cueylyss, complete genome) position: , mismatch: 8, identity: 0.75
gtcgacgaactggagcacgccggagcgccgga CRISPR spacer
cgcgacgaactggagcacgccgctgcgcgtat Protospacer
******************** **** .
131. spacer 2.13|1498646|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to EU744248 (Mycobacterium phage KBG, complete genome) position: , mismatch: 8, identity: 0.75
gtcgacgaactggagcacgccggagcgccgga CRISPR spacer
cgcgacgaactggagcacgccgctgcgcgtat Protospacer
******************** **** .
132. spacer 2.13|1498646|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to MH513971 (Mycobacterium phage Hope4ever, complete genome) position: , mismatch: 8, identity: 0.75
gtcgacgaactggagcacgccggagcgccgga CRISPR spacer
cgcgacgaactggagcacgccgctgcgcgtat Protospacer
******************** **** .
133. spacer 2.13|1498646|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to KF024724 (Mycobacterium phage Trouble, complete genome) position: , mismatch: 8, identity: 0.75
gtcgacgaactggagcacgccggagcgccgga CRISPR spacer
cgcgacgaactggagcacgccgctgcgcgtat Protospacer
******************** **** .
134. spacer 2.13|1498646|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP042263 (Litoreibacter sp. LN3S51 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
gtcgacgaactggagcacgccggagcgccgga CRISPR spacer
gtcgatgaactggatcacgccggtttcctgca Protospacer
*****.******** ******** . *.* *
135. spacer 2.14|1498706|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031163 (Deinococcus wulumuqiensis strain NEB 479 plasmid pDrdI, complete sequence) position: , mismatch: 8, identity: 0.75
aacgtaggcgtgaatggcgtcacaggcatttc CRISPR spacer
caggtcggcgtgtatggcgtcacaggccgccc Protospacer
* ** ****** ************** ..*
136. spacer 2.24|1499306|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to NC_022235 (Sphingomonas sp. ERG5 plasmid pCADAB1, complete sequence) position: , mismatch: 8, identity: 0.75
ttcgcggtgatgtggcgcttcgcggaggaata CRISPR spacer
ttcgaggtgatgcggcgcttcgcggccccacg Protospacer
**** *******.************ *..
137. spacer 2.25|1499366|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045074 (Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
gtcagccagctacaccgccgctgatgtgctgg CRISPR spacer
ggtggttcgctacatcgccgatgatgtgctgg Protospacer
* ..*.. ******.***** ***********
138. spacer 2.33|1499846|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033968 (Cupriavidus pauculus strain FDAARGOS_614 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
aagatctggtgcgcttgcattgcttccggtgt CRISPR spacer
catccatggtgtgcttgcattgctcccggtct Protospacer
* . *****.************.***** *
139. spacer 2.33|1499846|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP037902 (Cupriavidus metallidurans strain BS1 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75
aagatctggtgcgcttgcattgcttccggtgt CRISPR spacer
catccatggtgtgcttgcattgctcccggtct Protospacer
* . *****.************.***** *
140. spacer 2.33|1499846|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP043439 (Cupriavidus campinensis strain MJ1 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
aagatctggtgcgcttgcattgcttccggtgt CRISPR spacer
catccatggtgtgcttgcattgctcccggtct Protospacer
* . *****.************.***** *
141. spacer 2.33|1499846|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016462 (Blastomonas sp. RAC04 plasmid pBSY18_1, complete sequence) position: , mismatch: 8, identity: 0.75
aagatctggtgcgcttgcattgcttccggtgt CRISPR spacer
tcgatggcgtgcgcttgcattacttccgttgg Protospacer
*** *************.****** **
142. spacer 2.34|1499906|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015530 (Rhodococcus sp. WB1 plasmid pWB1, complete sequence) position: , mismatch: 8, identity: 0.75
aagccgatgatccgccgcttctacgcgtggat CRISPR spacer
gtgtcggtgatccgccgcttctgcgcgttcag Protospacer
. *.**.***************.***** *
143. spacer 2.38|1500146|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021032 (Rhizobium sp. NXC14 plasmid pRspNXC14b, complete sequence) position: , mismatch: 8, identity: 0.75
attacagtgtcgccagccggtatgcttgctgc CRISPR spacer
attacagcgtcaccagccggtatgtcttcaat Protospacer
*******.***.************..* * ..
144. spacer 2.45|1500566|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP042502 (Enterobacter sp. E76 plasmid pE76_003, complete sequence) position: , mismatch: 8, identity: 0.75
tgtgcaaccaggtgaacaatgcgaacaggttt CRISPR spacer
tgtgcaaccagatgaactatgcgcaatacttc Protospacer
***********.***** ***** * . **.
145. spacer 2.45|1500566|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP042506 (Leclercia adecarboxylata strain E1 plasmid pE1_001, complete sequence) position: , mismatch: 8, identity: 0.75
tgtgcaaccaggtgaacaatgcgaacaggttt CRISPR spacer
tgtgcaaccagatgaactatgcgcaatacttc Protospacer
***********.***** ***** * . **.
146. spacer 2.45|1500566|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040892 (Leclercia adecarboxylata strain Z96-1 plasmid pZ96-1_4, complete sequence) position: , mismatch: 8, identity: 0.75
tgtgcaaccaggtgaacaatgcgaacaggttt CRISPR spacer
tgtgcaaccagatgaactatgcgcaatacttc Protospacer
***********.***** ***** * . **.
147. spacer 2.45|1500566|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP043854 (Enterobacter hormaechei strain EB_P6_L3_02.19 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
tgtgcaaccaggtgaacaatgcgaacaggttt CRISPR spacer
tgtgcaaccagatgaactatgcgcaatacttc Protospacer
***********.***** ***** * . **.
148. spacer 2.45|1500566|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044215 (Klebsiella aerogenes strain KA_P10_L5_03.19 plasmid pIMPIncH12_334kb, complete sequence) position: , mismatch: 8, identity: 0.75
tgtgcaaccaggtgaacaatgcgaacaggttt CRISPR spacer
tgtgcaaccagatgaactatgcgcaatacttc Protospacer
***********.***** ***** * . **.
149. spacer 2.45|1500566|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP042494 (Leclercia adecarboxylata strain E61 plasmid pE61_001, complete sequence) position: , mismatch: 8, identity: 0.75
tgtgcaaccaggtgaacaatgcgaacaggttt CRISPR spacer
tgtgcaaccagatgaactatgcgcaatacttc Protospacer
***********.***** ***** * . **.
150. spacer 2.45|1500566|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP043767 (Enterobacter hormaechei strain EB_P9_L5_03.19 plasmid pIMPIncH12_331kb, complete sequence) position: , mismatch: 8, identity: 0.75
tgtgcaaccaggtgaacaatgcgaacaggttt CRISPR spacer
tgtgcaaccagatgaactatgcgcaatacttc Protospacer
***********.***** ***** * . **.
151. spacer 2.45|1500566|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023489 (Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_02, complete sequence) position: , mismatch: 8, identity: 0.75
tgtgcaaccaggtgaacaatgcgaacaggttt CRISPR spacer
tgtgcaaccagatgaactatgcgcaatacttc Protospacer
***********.***** ***** * . **.
152. spacer 2.45|1500566|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP042525 (Citrobacter freundii strain E11 plasmid pE11_001, complete sequence) position: , mismatch: 8, identity: 0.75
tgtgcaaccaggtgaacaatgcgaacaggttt CRISPR spacer
tgtgcaaccagatgaactatgcgcaatacttc Protospacer
***********.***** ***** * . **.
153. spacer 2.45|1500566|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026716 (Klebsiella oxytoca strain AR_0028 plasmid unitig_1_pilon, complete sequence) position: , mismatch: 8, identity: 0.75
tgtgcaaccaggtgaacaatgcgaacaggttt CRISPR spacer
tgtgcaaccagatgaactatgcgcaatacttc Protospacer
***********.***** ***** * . **.
154. spacer 2.45|1500566|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MG252895 (Escherichia coli strain Esco-36073cz plasmid pEsco-36073cz, complete sequence) position: , mismatch: 8, identity: 0.75
tgtgcaaccaggtgaacaatgcgaacaggttt CRISPR spacer
tgtgcaaccagatgaactatgcgcaatacttc Protospacer
***********.***** ***** * . **.
155. spacer 2.45|1500566|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026371 (Klebsiella quasipneumoniae strain A708 plasmid pA708-3, complete sequence) position: , mismatch: 8, identity: 0.75
tgtgcaaccaggtgaacaatgcgaacaggttt CRISPR spacer
tgtgcaaccagatgaactatgcgcaatacttc Protospacer
***********.***** ***** * . **.
156. spacer 2.45|1500566|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to MH669003 (Mycobacterium phage Girr, complete genome) position: , mismatch: 8, identity: 0.75
tgtgcaaccaggtgaacaatgcgaacaggttt CRISPR spacer
tgatcaaccaggtgaacgatgcgatcaaggac Protospacer
** *************.****** **.* .
157. spacer 2.45|1500566|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to MH051257 (Mycobacterium phage OwlsT2W, complete genome) position: , mismatch: 8, identity: 0.75
tgtgcaaccaggtgaacaatgcgaacaggttt CRISPR spacer
tgatcaaccaggtgaacgatgcgatcaaggac Protospacer
** *************.****** **.* .
158. spacer 2.45|1500566|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to MK359315 (Mycobacterium phage MisterCuddles, complete genome) position: , mismatch: 8, identity: 0.75
tgtgcaaccaggtgaacaatgcgaacaggttt CRISPR spacer
tgatcaaccaggtgaacgatgcgatcaaggac Protospacer
** *************.****** **.* .
159. spacer 2.45|1500566|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to MH651188 (Mycobacterium phage Ruby, complete genome) position: , mismatch: 8, identity: 0.75
tgtgcaaccaggtgaacaatgcgaacaggttt CRISPR spacer
tgatcaaccaggtgaacgatgcgatcaaggac Protospacer
** *************.****** **.* .
160. spacer 2.45|1500566|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to MK016494 (Mycobacterium phage Filuzino, complete genome) position: , mismatch: 8, identity: 0.75
tgtgcaaccaggtgaacaatgcgaacaggttt CRISPR spacer
tgatcaaccaggtgaacgatgcgatcaaggac Protospacer
** *************.****** **.* .
161. spacer 2.45|1500566|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to MT114164 (Mycobacterium phage Veteran, complete genome) position: , mismatch: 8, identity: 0.75
tgtgcaaccaggtgaacaatgcgaacaggttt CRISPR spacer
tgatcaaccaggtgaacgatgcgatcaaggac Protospacer
** *************.****** **.* .
162. spacer 2.45|1500566|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to MF919526 (Mycobacterium phage Phasih, complete genome) position: , mismatch: 8, identity: 0.75
tgtgcaaccaggtgaacaatgcgaacaggttt CRISPR spacer
tgatcaaccaggtgaacgatgcgatcaaggac Protospacer
** *************.****** **.* .
163. spacer 2.45|1500566|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to NC_021301 (Mycobacterium phage SiSi, complete genome) position: , mismatch: 8, identity: 0.75
tgtgcaaccaggtgaacaatgcgaacaggttt CRISPR spacer
tgatcaaccaggtgaacgatgcgatcaaggac Protospacer
** *************.****** **.* .
164. spacer 2.45|1500566|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to NC_011054 (Mycobacterium phage Boomer, complete genome) position: , mismatch: 8, identity: 0.75
tgtgcaaccaggtgaacaatgcgaacaggttt CRISPR spacer
tgatcaaccaggtgaacgatgcgatcaaggac Protospacer
** *************.****** **.* .
165. spacer 2.45|1500566|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to NC_022056 (Mycobacterium phage Hamulus, complete genome) position: , mismatch: 8, identity: 0.75
tgtgcaaccaggtgaacaatgcgaacaggttt CRISPR spacer
tgatcaaccaggtgaacgatgcgatcaaggac Protospacer
** *************.****** **.* .
166. spacer 2.45|1500566|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to KT281795 (Mycobacterium phage XFactor, complete genome) position: , mismatch: 8, identity: 0.75
tgtgcaaccaggtgaacaatgcgaacaggttt CRISPR spacer
tgatcaaccaggtgaacgatgcgatcaaggac Protospacer
** *************.****** **.* .
167. spacer 2.45|1500566|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to JN398368 (Mycobacterium virus GUmbie, complete genome) position: , mismatch: 8, identity: 0.75
tgtgcaaccaggtgaacaatgcgaacaggttt CRISPR spacer
tgatcaaccaggtgaacgatgcgatcaaggac Protospacer
** *************.****** **.* .
168. spacer 2.45|1500566|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to JF937093 (Mycobacterium virus DLane, complete genome) position: , mismatch: 8, identity: 0.75
tgtgcaaccaggtgaacaatgcgaacaggttt CRISPR spacer
tgatcaaccaggtgaacgatgcgatcaaggac Protospacer
** *************.****** **.* .
169. spacer 2.46|1500626|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to MK291445 (Paracoccus phage vB_PyeM_Pyei1, complete genome) position: , mismatch: 8, identity: 0.75
tgctgggcggctggctccgcgctcaaaactag CRISPR spacer
tgctgggaggctggcaccgcgctgtttacgac Protospacer
******* ******* ******* ** *
170. spacer 2.50|1500866|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to MT811961 (Vibrio phage vB_pir03, complete genome) position: , mismatch: 8, identity: 0.75
tttgcaaacaacagagacacaaccaggtgtca CRISPR spacer
aatgcaaacaacacagaaacaaccaactccca Protospacer
*********** *** *******. * .**
171. spacer 2.57|1501286|32|NC_012691|CRISPRCasFinder,CRT matches to AB797215 (Klebsiella phage 0507-KN2-1 DNA, complete genome) position: , mismatch: 8, identity: 0.75
agcggtattgatgcgttgtctggagcgatcgt CRISPR spacer
ggcggtattgatccgtggtctggactgttgga Protospacer
.*********** *** ******* .* * *
172. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to MT884006 (Escherichia phage vb_EcoM_bov9_1, complete genome) position: , mismatch: 8, identity: 0.75
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
actgctgttaatgcaactaaacaaactgctaa Protospacer
.******.********* *******. . **.
173. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to AP018932 (Escherichia phage KIT03 DNA, complete sequence) position: , mismatch: 8, identity: 0.75
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
actgctactaatgcaactaaacaaactgctaa Protospacer
.*****.********** *******. . **.
174. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to MN895438 (Escherichia phage teqdroes, complete genome) position: , mismatch: 8, identity: 0.75
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
actgctactaatgcaactaaacaaactgctaa Protospacer
.*****.********** *******. . **.
175. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to KP869105 (Escherichia coli O157 typing phage 7, partial genome) position: , mismatch: 8, identity: 0.75
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
actgctactaatgcaactaaacaaactgctaa Protospacer
.*****.********** *******. . **.
176. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to MF158046 (Shigella phage Sf23, complete genome) position: , mismatch: 8, identity: 0.75
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
actgctactaatgcaactaaacaaactgctaa Protospacer
.*****.********** *******. . **.
177. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to MT884007 (Escherichia phage vb_EcoM_bov10K1, complete genome) position: , mismatch: 8, identity: 0.75
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
actgctgttaatgcaactaaacaaactgctaa Protospacer
.******.********* *******. . **.
178. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to MF001359 (Escherichia phage EC121, partial genome) position: , mismatch: 8, identity: 0.75
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
actgctactaatgcaactaaacaaactgctaa Protospacer
.*****.********** *******. . **.
179. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to MN781580 (Shigella virus KRT47, complete genome) position: , mismatch: 8, identity: 0.75
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
actgctactaatgcaactaaacaaactgctaa Protospacer
.*****.********** *******. . **.
180. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to MN693103 (Marine virus AFVG_25M539, complete genome) position: , mismatch: 8, identity: 0.75
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
gctgctgctaatgtaacacaacaagcattaac Protospacer
*************.**** *****..* *
181. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to MN994497 (Phage NBEco003, complete genome) position: , mismatch: 8, identity: 0.75
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
actgctactaatgcaactaaacaaactgctaa Protospacer
.*****.********** *******. . **.
182. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to AP011113 (Enterobacteria phage AR1 DNA, complete genome) position: , mismatch: 8, identity: 0.75
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
actgctactaatgcaactaaacaaactgctaa Protospacer
.*****.********** *******. . **.
183. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to MT176424 (Citrobacter phage PhiZZ6, complete genome) position: , mismatch: 8, identity: 0.75
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
actgctactaatgcaactaaacaaactgctaa Protospacer
.*****.********** *******. . **.
184. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to MK962752 (Shigella phage JK23, complete genome) position: , mismatch: 8, identity: 0.75
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
actgctactaatgcaactaaacaaactgctaa Protospacer
.*****.********** *******. . **.
185. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to LC348379 (Escherichia phage PP01 DNA, complete sequence) position: , mismatch: 8, identity: 0.75
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
actgctactaatgcaactaaacaaactgctaa Protospacer
.*****.********** *******. . **.
186. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to LR597660 (Escherichia phage T4_ev151 genome assembly, chromosome: 1) position: , mismatch: 8, identity: 0.75
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
actgctgttaatgcaactaaacaaactgctaa Protospacer
.******.********* *******. . **.
187. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to HM997020 (Escherichia phage wV7, complete genome) position: , mismatch: 8, identity: 0.75
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
actgctactaatgcaactaaacaaactgctaa Protospacer
.*****.********** *******. . **.
188. spacer 2.63|1501647|32|NC_012691|CRISPRCasFinder,CRT matches to MG793454 (Mycobacterium phage SWU2, complete genome) position: , mismatch: 8, identity: 0.75
aactggtgaaacgcattccagcccgaaagcgc CRISPR spacer
tcctggtgcaacgcattccagaccgagtgccg Protospacer
****** ************ ****. **
189. spacer 2.63|1501647|32|NC_012691|CRISPRCasFinder,CRT matches to KC661275 (Mycobacterium phage HINdeR, complete genome) position: , mismatch: 8, identity: 0.75
aactggtgaaacgcattccagcccg-aaagcgc CRISPR spacer
tcctggtgcaacgcattccagaccgcgtggcg- Protospacer
****** ************ *** . .***
190. spacer 2.66|1501827|32|NC_012691|CRISPRCasFinder,CRT matches to LC557520 (Staphylococcus phage vB_SsapH-Golestan101-M DNA, complete genome) position: , mismatch: 8, identity: 0.75
ataaatgaataagataaatattcaagaatagc CRISPR spacer
ataaatgtataagataaatatacataataaaa Protospacer
******* ************* ** .* *.
191. spacer 2.66|1501827|32|NC_012691|CRISPRCasFinder,CRT matches to NC_047948 (Staphylococcus phage phiSA_BS2, complete genome) position: , mismatch: 8, identity: 0.75
ataaatgaataagataaatattcaagaatagc CRISPR spacer
ataaatgtataagataaatatacataataaaa Protospacer
******* ************* ** .* *.
192. spacer 2.66|1501827|32|NC_012691|CRISPRCasFinder,CRT matches to MH078572 (Staphylococcus phage phiSA_BS1, complete genome) position: , mismatch: 8, identity: 0.75
ataaatgaataagataaatattcaagaatagc CRISPR spacer
ataaatgtataagataaatatacataataaaa Protospacer
******* ************* ** .* *.
193. spacer 2.66|1501827|32|NC_012691|CRISPRCasFinder,CRT matches to CP013001 (Bacillus thuringiensis strain XL6 plasmid, complete sequence) position: , mismatch: 8, identity: 0.75
ataaatgaataagataaatattcaagaatagc CRISPR spacer
ttaaatgaaaaagataaatatccacgttttgt Protospacer
******** ***********.** * * *.
194. spacer 2.66|1501827|32|NC_012691|CRISPRCasFinder,CRT matches to NZ_CP027420 (Staphylococcus cohnii strain FDAARGOS_334 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
ataaatgaataagataaatattcaagaatagc CRISPR spacer
aaaaatgaagaagataattattcaaataactc Protospacer
* ******* ******* *******. * *
195. spacer 2.66|1501827|32|NC_012691|CRISPRCasFinder,CRT matches to KM389215 (UNVERIFIED: Staphylococcus phage Phi05_1554 UV clone contig00002 genomic sequence) position: , mismatch: 8, identity: 0.75
ataaatgaataagataaatattcaagaatagc CRISPR spacer
aaacaaaaacaagataaatattcaagagtaag Protospacer
* * * .**.*****************.**.
196. spacer 2.71|1502127|32|NC_012691|CRISPRCasFinder,CRT matches to NC_047854 (Cronobacter phage ESSI-2, complete genome) position: , mismatch: 8, identity: 0.75
cgctgcaattatcgattagcctggca---gaaccg CRISPR spacer
cgctgcaaatttcgattagcctggtgcttgat--- Protospacer
******** * *************.. **
197. spacer 2.86|1503027|32|NC_012691|CRISPRCasFinder,CRT matches to MN693643 (Marine virus AFVG_250M711, complete genome) position: , mismatch: 8, identity: 0.75
tttgtttatcaaaaagagccaataccgagtgc CRISPR spacer
tcggagtatgaaaaagagccaatgccgagcga Protospacer
*. * *** *************.*****.*
198. spacer 2.88|1503147|32|NC_012691|CRISPRCasFinder,CRT matches to AP014206 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C77-MedDCM-OCT-S39-C66, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.75
ttattaatgctcttaatgagtctataacgtta CRISPR spacer
ccattaatgcacttaatgaatctatacccgaa Protospacer
..******** ********.****** * *
199. spacer 2.99|1501467|33|NC_012691|PILER-CR matches to MN895435 (Escherichia phage teqhal, complete genome) position: , mismatch: 8, identity: 0.758
gctgctgctaatgcaacaaaacaaataaatagc CRISPR spacer
actgctgctaatgcaactaaacaaactgctaag Protospacer
.**************** *******. . **.
200. spacer 2.99|1501467|33|NC_012691|PILER-CR matches to MN895437 (Escherichia phage teqskov, complete genome) position: , mismatch: 8, identity: 0.758
gctgctgctaatgcaacaaaacaaataaatagc CRISPR spacer
actgctgctaatgcaactaaacaaactgctaag Protospacer
.**************** *******. . **.
201. spacer 2.99|1501467|33|NC_012691|PILER-CR matches to KU925172 (Escherichia phage PE37, complete genome) position: , mismatch: 8, identity: 0.758
gctgctgctaatgcaacaaaacaaataaatagc CRISPR spacer
actgctgctaatgcaactaaacaaactgctaag Protospacer
.**************** *******. . **.
202. spacer 2.99|1501467|33|NC_012691|PILER-CR matches to NC_042129 (Escherichia phage slur03, complete genome) position: , mismatch: 8, identity: 0.758
gctgctgctaatgcaacaaaacaaataaatagc CRISPR spacer
actgctgctaatgcaactaaacaaactgctaag Protospacer
.**************** *******. . **.
203. spacer 2.99|1501467|33|NC_012691|PILER-CR matches to KY608967 (UNVERIFIED: Escherichia phage CF2, complete genome) position: , mismatch: 8, identity: 0.758
gctgctgctaatgcaacaaaacaaataaatagc CRISPR spacer
actgctgctaatgcaactaaacaaactgctaag Protospacer
.**************** *******. . **.
204. spacer 2.99|1501467|33|NC_012691|PILER-CR matches to MH992121 (UNVERIFIED: Escherichia phage MLF4, partial genome) position: , mismatch: 8, identity: 0.758
gctgctgctaatgcaacaaaacaaataaatagc CRISPR spacer
actgctgctaatgcaactaaacaaactgctaag Protospacer
.**************** *******. . **.
205. spacer 2.99|1501467|33|NC_012691|PILER-CR matches to MT446387 (UNVERIFIED: Escherichia virus TH09, complete genome) position: , mismatch: 8, identity: 0.758
gctgctgctaatgcaacaaaacaaataaatagc CRISPR spacer
actgctgctaatgcaactaaacaaactgctaag Protospacer
.**************** *******. . **.
206. spacer 2.99|1501467|33|NC_012691|PILER-CR matches to MH355584 (Escherichia phage vB_EcoM_JB75, complete genome) position: , mismatch: 8, identity: 0.758
gctgctgctaatgcaacaaaacaaataaatagc CRISPR spacer
actgctgctaatgcaactaaacaaactgctaag Protospacer
.**************** *******. . **.
207. spacer 2.99|1501467|33|NC_012691|PILER-CR matches to LN881733 (Escherichia phage slur08, complete genome) position: , mismatch: 8, identity: 0.758
gctgctgctaatgcaacaaaacaaataaatagc CRISPR spacer
actgctgctaatgcaactaaacaaactgctaag Protospacer
.**************** *******. . **.
208. spacer 2.99|1501467|33|NC_012691|PILER-CR matches to LN881734 (Escherichia phage slur11, complete genome) position: , mismatch: 8, identity: 0.758
gctgctgctaatgcaacaaaacaaataaatagc CRISPR spacer
actgctgctaatgcaactaaacaaactgctaag Protospacer
.**************** *******. . **.
209. spacer 2.99|1501467|33|NC_012691|PILER-CR matches to MG781191 (Escherichia phage vB_EcoM-fHoEco02, complete genome) position: , mismatch: 8, identity: 0.758
gctgctgctaatgcaacaaaacaaataaatagc CRISPR spacer
actgctgctaatgcaactaaacaaactgctaag Protospacer
.**************** *******. . **.
210. spacer 2.99|1501467|33|NC_012691|PILER-CR matches to KY290975 (Escherichia phage YUEEL01, complete genome) position: , mismatch: 8, identity: 0.758
gctgctgctaatgcaacaaaacaaataaatagc CRISPR spacer
actgctgctaatgcaactaaacaaactgctaag Protospacer
.**************** *******. . **.
211. spacer 2.99|1501467|33|NC_012691|PILER-CR matches to NC_019399 (Enterobacteria phage vB_EcoM_ACG-C40, complete genome) position: , mismatch: 8, identity: 0.758
gctgctgctaatgcaacaaaacaaataaatagc CRISPR spacer
actgctgctaatgcaactaaacaaactgctaag Protospacer
.**************** *******. . **.
212. spacer 2.99|1501467|33|NC_012691|PILER-CR matches to LN881736 (Escherichia phage slur14, complete genome) position: , mismatch: 8, identity: 0.758
gctgctgctaatgcaacaaaacaaataaatagc CRISPR spacer
actgctgctaatgcaactaaacaaactgctaag Protospacer
.**************** *******. . **.
213. spacer 2.99|1501467|33|NC_012691|PILER-CR matches to MK327937 (Escherichia phage vB_EcoM_G10400, complete genome) position: , mismatch: 8, identity: 0.758
gctgctgctaatgcaacaaaacaaataaatagc CRISPR spacer
actgctgctaatgcaactaaacaaactgctaag Protospacer
.**************** *******. . **.
214. spacer 2.99|1501467|33|NC_012691|PILER-CR matches to MH809535 (Yersinia phage PYPS2T, complete genome) position: , mismatch: 8, identity: 0.758
gctgctgctaatgcaacaaaacaaataaatagc CRISPR spacer
actgctgctaatgcaactaaacaaactgctaag Protospacer
.**************** *******. . **.
215. spacer 2.99|1501467|33|NC_012691|PILER-CR matches to NC_042077 (Shigella phage Sf21, complete genome) position: , mismatch: 8, identity: 0.758
gctgctgctaatgcaacaaaacaaataaatagc CRISPR spacer
actgctgctaatgcaactaaacaaactgctaag Protospacer
.**************** *******. . **.
216. spacer 2.99|1501467|33|NC_012691|PILER-CR matches to MN508618 (UNVERIFIED: Escherichia phage ES26, complete genome) position: , mismatch: 8, identity: 0.758
gctgctgctaatgcaacaaaacaaataaatagc CRISPR spacer
actgctgctaatgcaactaaacaaactgctaag Protospacer
.**************** *******. . **.
217. spacer 2.99|1501467|33|NC_012691|PILER-CR matches to NC_042039 (Shigella phage Sf22, complete genome) position: , mismatch: 8, identity: 0.758
gctgctgctaatgcaacaaaacaaataaatagc CRISPR spacer
actgctgctaatgcaactaaacaaactgctaag Protospacer
.**************** *******. . **.
218. spacer 2.99|1501467|33|NC_012691|PILER-CR matches to MF327009 (Shigella phage Sf25, complete genome) position: , mismatch: 8, identity: 0.758
gctgctgctaatgcaacaaaacaaataaatagc CRISPR spacer
actgctgctaatgcaactaaacaaactgctaag Protospacer
.**************** *******. . **.
219. spacer 2.99|1501467|33|NC_012691|PILER-CR matches to MK373781 (Escherichia phage vB_EcoM_KAW1E185, complete genome) position: , mismatch: 8, identity: 0.758
gctgctgctaatgcaacaaaacaaataaatagc CRISPR spacer
actgctgctaatgcaactaaacaaactgctaag Protospacer
.**************** *******. . **.
220. spacer 2.99|1501467|33|NC_012691|PILER-CR matches to LN881737 (Escherichia phage slur13, complete genome) position: , mismatch: 8, identity: 0.758
gctgctgctaatgcaacaaaacaaataaatagc CRISPR spacer
actgctgctaatgcaactaaacaaactgctaag Protospacer
.**************** *******. . **.
221. spacer 2.99|1501467|33|NC_012691|PILER-CR matches to MN508614 (UNVERIFIED: Escherichia phage ES12, complete genome) position: , mismatch: 8, identity: 0.758
gctgctgctaatgcaacaaaacaaataaatagc CRISPR spacer
actgctgctaatgcaactaaacaaactgctaag Protospacer
.**************** *******. . **.
222. spacer 2.99|1501467|33|NC_012691|PILER-CR matches to MG781190 (Escherichia phage vB_EcoM-fFiEco06, complete genome) position: , mismatch: 8, identity: 0.758
gctgctgctaatgcaacaaaacaaataaatagc CRISPR spacer
actgctgctaatgcaactaaacaaactgctaag Protospacer
.**************** *******. . **.
223. spacer 2.99|1501467|33|NC_012691|PILER-CR matches to LR215723 (Yersinia phage fPS-90 genome assembly, chromosome: I) position: , mismatch: 8, identity: 0.758
gctgctgctaatgcaacaaaacaaataaatagc CRISPR spacer
actgctgctaatgcaactaaacaaactgctaag Protospacer
.**************** *******. . **.
224. spacer 2.99|1501467|33|NC_012691|PILER-CR matches to KJ668714 (Escherichia phage e11/2, complete genome) position: , mismatch: 8, identity: 0.758
gctgctgctaatgcaacaaaacaaataaatagc CRISPR spacer
actgctgctaatgcaactaaacaaactgctaag Protospacer
.**************** *******. . **.
225. spacer 2.99|1501467|33|NC_012691|PILER-CR matches to MT682714 (Escherichia phage vB_EcoM_Lutter, complete genome) position: , mismatch: 8, identity: 0.758
gctgctgctaatgcaacaaaacaaataaatagc CRISPR spacer
actgctgctaatgcaactaaacaaactgctaag Protospacer
.**************** *******. . **.
226. spacer 2.99|1501467|33|NC_012691|PILER-CR matches to MK962750 (Shigella phage CM8, complete genome) position: , mismatch: 8, identity: 0.758
gctgctgctaatgcaacaaaacaaataaatagc CRISPR spacer
actgctgctaatgcaactaaacaaactgctaag Protospacer
.**************** *******. . **.
227. spacer 2.99|1501467|33|NC_012691|PILER-CR matches to MN895436 (Escherichia phage teqsoen, complete genome) position: , mismatch: 8, identity: 0.758
gctgctgctaatgcaacaaaacaaataaatagc CRISPR spacer
actgctgctaatgcaactaaacaaactgctaag Protospacer
.**************** *******. . **.
228. spacer 2.99|1501467|33|NC_012691|PILER-CR matches to MT682710 (Escherichia phage vB_EcoM_FT, complete genome) position: , mismatch: 8, identity: 0.758
gctgctgctaatgcaacaaaacaaataaatagc CRISPR spacer
actgctgctaatgcaactaaacaaactgctaag Protospacer
.**************** *******. . **.
229. spacer 2.99|1501467|33|NC_012691|PILER-CR matches to MG775043 (Citrobacter phage vB_CroM_CrRp10, complete genome) position: , mismatch: 8, identity: 0.758
gctgctgctaatgcaacaaaacaaataaatagc CRISPR spacer
actgctgctaatgcaactaaacaaactgctaag Protospacer
.**************** *******. . **.
230. spacer 2.99|1501467|33|NC_012691|PILER-CR matches to LN881726 (Escherichia phage slur02, complete genome) position: , mismatch: 8, identity: 0.758
gctgctgctaatgcaacaaaacaaataaatagc CRISPR spacer
actgctgctaatgcaactaaacaaactgctaag Protospacer
.**************** *******. . **.
231. spacer 2.99|1501467|33|NC_012691|PILER-CR matches to MK373785 (Escherichia phage vB_EcoM_OE5505, complete genome) position: , mismatch: 8, identity: 0.758
gctgctgctaatgcaacaaaacaaataaatagc CRISPR spacer
actgctgctaatgcaactaaacaaactgctaag Protospacer
.**************** *******. . **.
232. spacer 2.99|1501467|33|NC_012691|PILER-CR matches to NC_042078 (Shigella phage Sf24, complete genome) position: , mismatch: 8, identity: 0.758
gctgctgctaatgcaacaaaacaaataaatagc CRISPR spacer
actgctgctaatgcaactaaacaaactgctaag Protospacer
.**************** *******. . **.
233. spacer 2.99|1501467|33|NC_012691|PILER-CR matches to MK373779 (Escherichia phage vB_EcoM_G9062, complete genome) position: , mismatch: 8, identity: 0.758
gctgctgctaatgcaacaaaacaaataaatagc CRISPR spacer
actgctgctaatgcaactaaacaaactgctaag Protospacer
.**************** *******. . **.
234. spacer 2.99|1501467|33|NC_012691|PILER-CR matches to MN508616 (UNVERIFIED: Escherichia phage ES19, complete genome) position: , mismatch: 8, identity: 0.758
gctgctgctaatgcaacaaaacaaataaatagc CRISPR spacer
actgctgctaatgcaactaaacaaactgctaag Protospacer
.**************** *******. . **.
235. spacer 2.99|1501467|33|NC_012691|PILER-CR matches to MK327946 (Escherichia phage vB_EcoM_G4507, complete genome) position: , mismatch: 8, identity: 0.758
gctgctgctaatgcaacaaaacaaataaatagc CRISPR spacer
actgctgctaatgcaactaaacaaactgctaag Protospacer
.**************** *******. . **.
236. spacer 2.99|1501467|33|NC_012691|PILER-CR matches to LC465543 (Shigella phage SfPhi01 DNA, complete sequence) position: , mismatch: 8, identity: 0.758
gctgctgctaatgcaacaaaacaaataaatagc CRISPR spacer
actgctgctaatgcaactaaacaaactgctaag Protospacer
.**************** *******. . **.
237. spacer 2.99|1501467|33|NC_012691|PILER-CR matches to MK977694 (Escherichia phage vB_EcoM-Sa45lw, complete genome) position: , mismatch: 8, identity: 0.758
gctgctgctaatgcaacaaaacaaataaatagc CRISPR spacer
actgctgctaatgcaactaaacaaactgctaag Protospacer
.**************** *******. . **.
238. spacer 2.99|1501467|33|NC_012691|PILER-CR matches to LR877332 (Shigella phage vB_SsoM_JK08 genome assembly, chromosome: 1) position: , mismatch: 8, identity: 0.758
gctgctgctaatgcaacaaaacaaataaatagc CRISPR spacer
actgctgctaatgcaactaaacaaactgctaag Protospacer
.**************** *******. . **.
239. spacer 2.99|1501467|33|NC_012691|PILER-CR matches to MK327929 (Escherichia phage D5505, complete genome) position: , mismatch: 8, identity: 0.758
gctgctgctaatgcaacaaaacaaataaatagc CRISPR spacer
actgctgctaatgcaactaaacaaactgctaag Protospacer
.**************** *******. . **.
240. spacer 2.99|1501467|33|NC_012691|PILER-CR matches to MK327936 (Escherichia phage vB_EcoM_G2540, complete genome) position: , mismatch: 8, identity: 0.758
gctgctgctaatgcaacaaaacaaataaatagc CRISPR spacer
actgctgctaatgcaactaaacaaactgctaag Protospacer
.**************** *******. . **.
241. spacer 2.99|1501467|33|NC_012691|PILER-CR matches to MK327939 (Escherichia phage vB_EcoM_G4498, complete genome) position: , mismatch: 8, identity: 0.758
gctgctgctaatgcaacaaaacaaataaatagc CRISPR spacer
actgctgctaatgcaactaaacaaactgctaag Protospacer
.**************** *******. . **.
242. spacer 2.99|1501467|33|NC_012691|PILER-CR matches to MN508617 (UNVERIFIED: Escherichia phage ES21, complete genome) position: , mismatch: 8, identity: 0.758
gctgctgctaatgcaacaaaacaaataaatagc CRISPR spacer
actgctgctaatgcaactaaacaaactgctaag Protospacer
.**************** *******. . **.
243. spacer 2.99|1501467|33|NC_012691|PILER-CR matches to MK962755 (Shigella phage JK38, complete genome) position: , mismatch: 8, identity: 0.758
gctgctgctaatgcaacaaaacaaataaatagc CRISPR spacer
actgctgctaatgcaactaaacaaactgctaag Protospacer
.**************** *******. . **.
244. spacer 2.99|1501467|33|NC_012691|PILER-CR matches to MK327945 (Escherichia phage vB_EcoM_G4500, complete genome) position: , mismatch: 8, identity: 0.758
gctgctgctaatgcaacaaaacaaataaatagc CRISPR spacer
actgctgctaatgcaactaaacaaactgctaag Protospacer
.**************** *******. . **.
245. spacer 2.99|1501467|33|NC_012691|PILER-CR matches to MF001360 (Escherichia phage ECO4, partial genome) position: , mismatch: 8, identity: 0.758
gctgctgctaatgcaacaaaacaaataaatagc CRISPR spacer
actgctgctaatgcaactaaacaaactgctaag Protospacer
.**************** *******. . **.
246. spacer 2.99|1501467|33|NC_012691|PILER-CR matches to KT184311 (Enterobacteria phage GiZh, complete genome) position: , mismatch: 8, identity: 0.758
gctgctgctaatgcaacaaaacaaataaatagc CRISPR spacer
actgctgctaatgcaactaaacaaactgctaag Protospacer
.**************** *******. . **.
247. spacer 2.99|1501467|33|NC_012691|PILER-CR matches to LR215724 (Yersinia phage fPS-65 genome assembly, chromosome: I) position: , mismatch: 8, identity: 0.758
gctgctgctaatgcaacaaaacaaataaatagc CRISPR spacer
actgctgctaatgcaactaaacaaactgctaag Protospacer
.**************** *******. . **.
248. spacer 2.99|1501467|33|NC_012691|PILER-CR matches to MK327940 (Escherichia phage vB_EcoM_G29, complete genome) position: , mismatch: 8, identity: 0.758
gctgctgctaatgcaacaaaacaaataaatagc CRISPR spacer
actgctgctaatgcaactaaacaaactgctaag Protospacer
.**************** *******. . **.
249. spacer 2.99|1501467|33|NC_012691|PILER-CR matches to MK373786 (Escherichia phage vB_EcoM_R5505, complete genome) position: , mismatch: 8, identity: 0.758
gctgctgctaatgcaacaaaacaaataaatagc CRISPR spacer
actgctgctaatgcaactaaacaaactgctaag Protospacer
.**************** *******. . **.
250. spacer 2.99|1501467|33|NC_012691|PILER-CR matches to KT184312 (Enterobacteria phage Kha5h, complete genome) position: , mismatch: 8, identity: 0.758
gctgctgctaatgcaacaaaacaaataaatagc CRISPR spacer
actgctgctaatgcaactaaacaaactgctaag Protospacer
.**************** *******. . **.
251. spacer 2.99|1501467|33|NC_012691|PILER-CR matches to HE956711 (Yersinia phage phiD1 complete genome) position: , mismatch: 8, identity: 0.758
gctgctgctaatgcaacaaaacaaataaatagc CRISPR spacer
actgctgctaatgcaactaaacaaactgctaag Protospacer
.**************** *******. . **.
252. spacer 2.99|1501467|33|NC_012691|PILER-CR matches to NC_031085 (Shigella phage SHBML-50-1, complete genome) position: , mismatch: 8, identity: 0.758
gctgctgctaatgcaacaaaacaaataaatagc CRISPR spacer
actgctgctaatgcaactaaacaaactgctaag Protospacer
.**************** *******. . **.
253. spacer 2.99|1501467|33|NC_012691|PILER-CR matches to KT184308 (Enterobacteria phage Aplg8, complete genome) position: , mismatch: 8, identity: 0.758
gctgctgctaatgcaacaaaacaaataaatagc CRISPR spacer
actgctgctaatgcaactaaacaaactgctaag Protospacer
.**************** *******. . **.
254. spacer 2.99|1501467|33|NC_012691|PILER-CR matches to MH992510 (Escherichia phage vB_EcoM_DalCa, complete genome) position: , mismatch: 8, identity: 0.758
gctgctgctaatgcaacaaaacaaataaatagc CRISPR spacer
actgctgctaatgcaactaaacaaactgctaag Protospacer
.**************** *******. . **.
255. spacer 2.99|1501467|33|NC_012691|PILER-CR matches to LN881729 (Escherichia phage slur04, complete genome) position: , mismatch: 8, identity: 0.758
gctgctgctaatgcaacaaaacaaataaatagc CRISPR spacer
actgctgctaatgcaactaaacaaactgctaag Protospacer
.**************** *******. . **.
256. spacer 2.110|1502127|33|NC_012691|PILER-CR matches to NC_047854 (Cronobacter phage ESSI-2, complete genome) position: , mismatch: 8, identity: 0.758
cgctgcaattatcgattagcctggca---gaaccgc CRISPR spacer
cgctgcaaatttcgattagcctggtgcttgatc--- Protospacer
******** * *************.. ** *
257. spacer 2.127|1503147|33|NC_012691|PILER-CR matches to AP014206 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C77-MedDCM-OCT-S39-C66, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.758
ttattaatgctcttaatgagtctataacgttag CRISPR spacer
ccattaatgcacttaatgaatctatacccgaag Protospacer
..******** ********.****** * **
258. spacer 2.2|1497986|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to MN693549 (Marine virus AFVG_25M89, complete genome) position: , mismatch: 9, identity: 0.719
tattattagaagccattaagctagaaaaagat CRISPR spacer
tttatttaaaagccattaatctagaaaactca Protospacer
* * ***.********** ********
259. spacer 2.3|1498046|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020750 (Bacillus mycoides strain Gnyt1 plasmid unnamed7, complete sequence) position: , mismatch: 9, identity: 0.719
ttgaaaccattctttgaattttgggcttgttg CRISPR spacer
gtgaaaccattcgttaaattttggggagatat Protospacer
*********** **.********* .*
260. spacer 2.9|1498406|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP034999 (Rhizobium acidisoli strain FH23 plasmid pRapFH23a, complete sequence) position: , mismatch: 9, identity: 0.719
aaatcaatcgcgtcagtatttccacaccctgc CRISPR spacer
ccatgcatcgcgtcaggatttccacgcccgct Protospacer
** ********** ********.*** .
261. spacer 2.11|1498526|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to MN453779 (Aeromonas phage PS2, complete genome) position: , mismatch: 9, identity: 0.719
tttacagatagcgttatgttgtaagacttccg CRISPR spacer
aaacgaaatagcgttatcttgtaagtcttcag Protospacer
*.********** ******* **** *
262. spacer 2.12|1498586|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 9, identity: 0.719
atgaagcgccaaaaggccgatgccgcgtggaa CRISPR spacer
cttcagctccaaaaggccgatgccgcggctgg Protospacer
* *** ******************* ..
263. spacer 2.16|1498826|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to NC_015154 (Klebsiella pneumoniae plasmid pc15-k, complete sequence) position: , mismatch: 9, identity: 0.719
tgccgcccggtgcaggtcaatcatcgcggttt CRISPR spacer
aacagcgcggtggaggtcaatcatcgcgacag Protospacer
.* ** ***** ***************..
264. spacer 2.16|1498826|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
tgccgcccggtgcaggtcaatcatcgcggttt CRISPR spacer
ggccgcccggtgcaggtcgaacatccagcgca Protospacer
*****************.* **** * .
265. spacer 2.52|1500986|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022992 (Paraburkholderia aromaticivorans strain BN5 plasmid pBN2, complete sequence) position: , mismatch: 9, identity: 0.719
ataaaagctggaacccacgcccgcagcgtgca CRISPR spacer
tatgaacctgtaacccacgcccgcagcctccc Protospacer
.** *** **************** * *
266. spacer 2.52|1500986|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031163 (Deinococcus wulumuqiensis strain NEB 479 plasmid pDrdI, complete sequence) position: , mismatch: 9, identity: 0.719
ataaaagctggaacccacgcccgcagcgtgca CRISPR spacer
cgaggcgctggagcccacgcccgcatcgtcct Protospacer
*.. ******.************ *** *
267. spacer 2.57|1501286|32|NC_012691|CRISPRCasFinder,CRT matches to MK047642 (Phage NG55, complete genome) position: , mismatch: 9, identity: 0.719
agcggtattgatgcgttgtctggagcgatcgt CRISPR spacer
gcagacgttgatgcgttttctggtgcgatcgc Protospacer
. *...********** ***** *******.
268. spacer 2.58|1501346|32|NC_012691|CRISPRCasFinder,CRT matches to NZ_CP013526 (Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence) position: , mismatch: 9, identity: 0.719
aatgtgcgcattttatcaggatctaattcgac CRISPR spacer
aatttgcgcattttatcaggatctttgcgcgt Protospacer
*** ******************** . ..
269. spacer 2.63|1501647|32|NC_012691|CRISPRCasFinder,CRT matches to JF957060 (Mycobacterium phage Timshel, complete genome) position: , mismatch: 9, identity: 0.719
aactggtgaaacgcattccagcccgaaagcgc CRISPR spacer
tcctggtgcaacgcattccagaccgtgtgccg Protospacer
****** ************ *** . **
270. spacer 2.65|1501767|32|NC_012691|CRISPRCasFinder,CRT matches to CP002494 (Enterococcus faecalis 62 plasmid EF62pC, complete sequence) position: , mismatch: 9, identity: 0.719
agcccggcagtagccataaaatccaaggaaac CRISPR spacer
taatagactgtagccagaaaatccaagtaaac Protospacer
. . *.* ******* ********** ****
271. spacer 2.65|1501767|32|NC_012691|CRISPRCasFinder,CRT matches to NZ_CP036248 (Enterococcus faecalis R712 plasmid pR712_02, complete sequence) position: , mismatch: 9, identity: 0.719
agcccggcagtagccataaaatccaaggaaac CRISPR spacer
taatagactgtagccagaaaatccaagtaaac Protospacer
. . *.* ******* ********** ****
272. spacer 2.65|1501767|32|NC_012691|CRISPRCasFinder,CRT matches to NZ_CP028838 (Enterococcus faecalis strain FC plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719
agcccggcagtagccataaaatccaaggaaac CRISPR spacer
taatagactgtagccagaaaatccaagtaaac Protospacer
. . *.* ******* ********** ****
273. spacer 2.65|1501767|32|NC_012691|CRISPRCasFinder,CRT matches to NZ_CP028721 (Enterococcus faecalis strain CVM N48037F plasmid pN48037F-1, complete sequence) position: , mismatch: 9, identity: 0.719
agcccggcagtagccataaaatccaaggaaac CRISPR spacer
taatagactgtagccagaaaatccaagtaaac Protospacer
. . *.* ******* ********** ****
274. spacer 2.65|1501767|32|NC_012691|CRISPRCasFinder,CRT matches to NZ_CP028722 (Enterococcus faecalis strain CVM N48037F plasmid pN48037F-2, complete sequence) position: , mismatch: 9, identity: 0.719
agcccggcagtagccataaaatccaaggaaac CRISPR spacer
taatagactgtagccagaaaatccaagcaaac Protospacer
. . *.* ******* ********** ****
275. spacer 2.65|1501767|32|NC_012691|CRISPRCasFinder,CRT matches to NZ_CP028286 (Enterococcus faecalis strain FDAARGOS_324 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
agcccggcagtagccataaaatccaaggaaac CRISPR spacer
taatagactgtagccagaaaatccaagtaaac Protospacer
. . *.* ******* ********** ****
276. spacer 2.65|1501767|32|NC_012691|CRISPRCasFinder,CRT matches to NZ_AP018539 (Enterococcus faecalis strain KUB3006 plasmid pKUB3006-1, complete sequence) position: , mismatch: 9, identity: 0.719
agcccggcagtagccataaaatccaaggaaac CRISPR spacer
taatagactgtagccagaaaatccaagtaaac Protospacer
. . *.* ******* ********** ****
277. spacer 2.65|1501767|32|NC_012691|CRISPRCasFinder,CRT matches to NZ_MK140641 (Enterococcus faecalis strain E035 plasmid pE035, complete sequence) position: , mismatch: 9, identity: 0.719
agcccggcagtagccataaaatccaaggaaac CRISPR spacer
taatagactgtagccagaaaatccaagtaaac Protospacer
. . *.* ******* ********** ****
278. spacer 2.65|1501767|32|NC_012691|CRISPRCasFinder,CRT matches to NZ_MK993385 (Enterococcus faecalis strain P010748 plasmid pEF10748, complete sequence) position: , mismatch: 9, identity: 0.719
agcccggcagtagccataaaatccaaggaaac CRISPR spacer
taatagactgtagccagaaaatccaagtaaac Protospacer
. . *.* ******* ********** ****
279. spacer 2.66|1501827|32|NC_012691|CRISPRCasFinder,CRT matches to NZ_LR214939 (Mycoplasma salivarium strain NCTC10113 plasmid 2) position: , mismatch: 9, identity: 0.719
ataaatgaataagataaatattcaagaatagc CRISPR spacer
attgcaaaataataaaaatattcaagaatata Protospacer
** . .***** * ***************
280. spacer 2.66|1501827|32|NC_012691|CRISPRCasFinder,CRT matches to NC_014824 (Ruminococcus albus 7 = DSM 20455 plasmid pRUMAL01, complete sequence) position: , mismatch: 9, identity: 0.719
ataaatg-----aataagataaatattcaagaatagc CRISPR spacer
-----tgcttttaataagataaatattcaattataat Protospacer
** ****************** ***..
281. spacer 2.66|1501827|32|NC_012691|CRISPRCasFinder,CRT matches to NZ_CP042409 (Lactococcus lactis strain CBA3619 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
ataaatgaataagataaatattcaagaatagc CRISPR spacer
attctataattagataaatattcaataataaa Protospacer
** *** ************** ****.
282. spacer 2.82|1502787|32|NC_012691|CRISPRCasFinder,CRT matches to NZ_LR699116 (Aquicella lusitana strain SGT-39 plasmid 3) position: , mismatch: 9, identity: 0.719
accgtaaccagcagggtcacgatatacgttga CRISPR spacer
tttgtaaccagcaaagtcacgatataaaatgg Protospacer
..**********..*********** . **.
283. spacer 2.83|1502847|32|NC_012691|CRISPRCasFinder,CRT matches to NC_002679 (Mesorhizobium japonicum MAFF 303099 plasmid pMLa, complete sequence) position: , mismatch: 9, identity: 0.719
gtggccgcaaacgcgaatacggcactaatgcc CRISPR spacer
ttggccgccagcgcgaatacggcatgaagcag Protospacer
******* *.*************. **
284. spacer 2.85|1502967|32|NC_012691|CRISPRCasFinder,CRT matches to HQ633071 (Synechococcus phage S-SKS1 genomic sequence) position: , mismatch: 9, identity: 0.719
atttgataggtattatggattatttctttgcg CRISPR spacer
tcttgataggtattatggtttacttgagttag Protospacer
.**************** ***.** * *
285. spacer 2.91|1503327|32|NC_012691|CRISPRCasFinder,CRT matches to MT986028 (Arthrobacter phage Thunderclap, complete genome) position: , mismatch: 9, identity: 0.719
ttccttgaaattgtgtggggcaatgttcgcga CRISPR spacer
cgacctgaaattgtgtggcgaaatgttcggac Protospacer
. *.************* * ******** .
286. spacer 2.91|1503327|32|NC_012691|CRISPRCasFinder,CRT matches to KU160639 (Arthrobacter phage Anansi, complete genome) position: , mismatch: 9, identity: 0.719
ttccttgaaattgtgtggggcaatgttcgcga CRISPR spacer
cgacctgaaattgtgtggcgaaatgttcggac Protospacer
. *.************* * ******** .
287. spacer 2.91|1503327|32|NC_012691|CRISPRCasFinder,CRT matches to KU160647 (Arthrobacter phage Gorgeous, complete genome) position: , mismatch: 9, identity: 0.719
ttccttgaaattgtgtggggcaatgttcgcga CRISPR spacer
cgacctgaaattgtgtggcgaaatgttcggac Protospacer
. *.************* * ******** .
288. spacer 2.91|1503327|32|NC_012691|CRISPRCasFinder,CRT matches to KU160666 (Arthrobacter phage SorJuana, complete genome) position: , mismatch: 9, identity: 0.719
ttccttgaaattgtgtggggcaatgttcgcga CRISPR spacer
cgacctgaaattgtgtggcgaaatgttcggac Protospacer
. *.************* * ******** .
289. spacer 2.91|1503327|32|NC_012691|CRISPRCasFinder,CRT matches to KU160663 (Arthrobacter phage Rings, complete genome) position: , mismatch: 9, identity: 0.719
ttccttgaaattgtgtggggcaatgttcgcga CRISPR spacer
cgacctgaaattgtgtggcgaaatgttcggac Protospacer
. *.************* * ******** .
290. spacer 2.99|1501467|33|NC_012691|PILER-CR matches to MN895438 (Escherichia phage teqdroes, complete genome) position: , mismatch: 9, identity: 0.727
gctgctgctaatgcaacaaaacaaataaatagc CRISPR spacer
actgctactaatgcaactaaacaaactgctaag Protospacer
.*****.********** *******. . **.
291. spacer 2.99|1501467|33|NC_012691|PILER-CR matches to MN994497 (Phage NBEco003, complete genome) position: , mismatch: 9, identity: 0.727
gctgctgctaatgcaacaaaacaaataaatagc CRISPR spacer
actgctactaatgcaactaaacaaactgctaag Protospacer
.*****.********** *******. . **.
292. spacer 2.99|1501467|33|NC_012691|PILER-CR matches to MT884006 (Escherichia phage vb_EcoM_bov9_1, complete genome) position: , mismatch: 9, identity: 0.727
gctgctgctaatgcaacaaaacaaataaatagc CRISPR spacer
actgctgttaatgcaactaaacaaactgctaag Protospacer
.******.********* *******. . **.
293. spacer 2.99|1501467|33|NC_012691|PILER-CR matches to AP018932 (Escherichia phage KIT03 DNA, complete sequence) position: , mismatch: 9, identity: 0.727
gctgctgctaatgcaacaaaacaaataaatagc CRISPR spacer
actgctactaatgcaactaaacaaactgctaaa Protospacer
.*****.********** *******. . **.
294. spacer 2.99|1501467|33|NC_012691|PILER-CR matches to KP869105 (Escherichia coli O157 typing phage 7, partial genome) position: , mismatch: 9, identity: 0.727
gctgctgctaatgcaacaaaacaaataaatagc CRISPR spacer
actgctactaatgcaactaaacaaactgctaag Protospacer
.*****.********** *******. . **.
295. spacer 2.99|1501467|33|NC_012691|PILER-CR matches to MF158046 (Shigella phage Sf23, complete genome) position: , mismatch: 9, identity: 0.727
gctgctgctaatgcaacaaaacaaataaatagc CRISPR spacer
actgctactaatgcaactaaacaaactgctaaa Protospacer
.*****.********** *******. . **.
296. spacer 2.99|1501467|33|NC_012691|PILER-CR matches to MT884007 (Escherichia phage vb_EcoM_bov10K1, complete genome) position: , mismatch: 9, identity: 0.727
gctgctgctaatgcaacaaaacaaataaatagc CRISPR spacer
actgctgttaatgcaactaaacaaactgctaag Protospacer
.******.********* *******. . **.
297. spacer 2.99|1501467|33|NC_012691|PILER-CR matches to MF001359 (Escherichia phage EC121, partial genome) position: , mismatch: 9, identity: 0.727
gctgctgctaatgcaacaaaacaaataaatagc CRISPR spacer
actgctactaatgcaactaaacaaactgctaaa Protospacer
.*****.********** *******. . **.
298. spacer 2.99|1501467|33|NC_012691|PILER-CR matches to MN781580 (Shigella virus KRT47, complete genome) position: , mismatch: 9, identity: 0.727
gctgctgctaatgcaacaaaacaaataaatagc CRISPR spacer
actgctactaatgcaactaaacaaactgctaag Protospacer
.*****.********** *******. . **.
299. spacer 2.99|1501467|33|NC_012691|PILER-CR matches to AP011113 (Enterobacteria phage AR1 DNA, complete genome) position: , mismatch: 9, identity: 0.727
gctgctgctaatgcaacaaaacaaataaatagc CRISPR spacer
actgctactaatgcaactaaacaaactgctaag Protospacer
.*****.********** *******. . **.
300. spacer 2.99|1501467|33|NC_012691|PILER-CR matches to MT176424 (Citrobacter phage PhiZZ6, complete genome) position: , mismatch: 9, identity: 0.727
gctgctgctaatgcaacaaaacaaataaatagc CRISPR spacer
actgctactaatgcaactaaacaaactgctaag Protospacer
.*****.********** *******. . **.
301. spacer 2.99|1501467|33|NC_012691|PILER-CR matches to MK962752 (Shigella phage JK23, complete genome) position: , mismatch: 9, identity: 0.727
gctgctgctaatgcaacaaaacaaataaatagc CRISPR spacer
actgctactaatgcaactaaacaaactgctaag Protospacer
.*****.********** *******. . **.
302. spacer 2.99|1501467|33|NC_012691|PILER-CR matches to LC348379 (Escherichia phage PP01 DNA, complete sequence) position: , mismatch: 9, identity: 0.727
gctgctgctaatgcaacaaaacaaataaatagc CRISPR spacer
actgctactaatgcaactaaacaaactgctaag Protospacer
.*****.********** *******. . **.
303. spacer 2.99|1501467|33|NC_012691|PILER-CR matches to LR597660 (Escherichia phage T4_ev151 genome assembly, chromosome: 1) position: , mismatch: 9, identity: 0.727
gctgctgctaatgcaacaaaacaaataaatagc CRISPR spacer
actgctgttaatgcaactaaacaaactgctaag Protospacer
.******.********* *******. . **.
304. spacer 2.99|1501467|33|NC_012691|PILER-CR matches to HM997020 (Escherichia phage wV7, complete genome) position: , mismatch: 9, identity: 0.727
gctgctgctaatgcaacaaaacaaataaatagc CRISPR spacer
actgctactaatgcaactaaacaaactgctaag Protospacer
.*****.********** *******. . **.
305. spacer 2.102|1501647|33|NC_012691|PILER-CR matches to MG793454 (Mycobacterium phage SWU2, complete genome) position: , mismatch: 9, identity: 0.727
aactggtgaaacgcattccagcccgaaagcgcc CRISPR spacer
tcctggtgcaacgcattccagaccgagtgccgg Protospacer
****** ************ ****. **
306. spacer 2.105|1501827|33|NC_012691|PILER-CR matches to LC557520 (Staphylococcus phage vB_SsapH-Golestan101-M DNA, complete genome) position: , mismatch: 9, identity: 0.727
ataaatgaataagataaatattcaagaatagcc CRISPR spacer
ataaatgtataagataaatatacataataaaat Protospacer
******* ************* ** .* *. .
307. spacer 2.105|1501827|33|NC_012691|PILER-CR matches to NC_047948 (Staphylococcus phage phiSA_BS2, complete genome) position: , mismatch: 9, identity: 0.727
ataaatgaataagataaatattcaagaatagcc CRISPR spacer
ataaatgtataagataaatatacataataaaat Protospacer
******* ************* ** .* *. .
308. spacer 2.105|1501827|33|NC_012691|PILER-CR matches to MH078572 (Staphylococcus phage phiSA_BS1, complete genome) position: , mismatch: 9, identity: 0.727
ataaatgaataagataaatattcaagaatagcc CRISPR spacer
ataaatgtataagataaatatacataataaaat Protospacer
******* ************* ** .* *. .
309. spacer 2.12|1498586|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to NC_011368 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence) position: , mismatch: 10, identity: 0.688
atgaagcgccaaaaggccgatgccgcgtggaa CRISPR spacer
ccaaagcgcaaaaatgccgatgccgctcatca Protospacer
..****** **** *********** .. *
310. spacer 2.22|1499186|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to NC_016588 (Azospirillum lipoferum 4B plasmid AZO_p6, complete sequence) position: , mismatch: 10, identity: 0.688
tttggcgatcaggtggcggcgatccaatcctc CRISPR spacer
cagggcgatcaggtggctgcgttccagcacgg Protospacer
. ************** *** ****.. *
311. spacer 2.24|1499306|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 10, identity: 0.688
ttcgcggtgatgtggcgcttcgcggaggaata CRISPR spacer
acgtcggtgatctggcgcttggcggagggccg Protospacer
. ******* ******** *******. ..
312. spacer 2.29|1499606|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to MK257744 (Thermus phage YS40_Isch, complete genome) position: , mismatch: 10, identity: 0.688
taccgaaaacgtctactgctaaaaataggcgc CRISPR spacer
caagaaaaacttttactgctaaaaatagagtg Protospacer
.* .***** *.***************.
313. spacer 2.34|1499906|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to MT241605 (Achromobacter phage AMA1, complete genome) position: , mismatch: 10, identity: 0.688
aagccgatgatccgccgcttctacgcgtggat CRISPR spacer
cctcgcctgatccgccgcggctacgcgtggtg Protospacer
* *********** **********
314. spacer 2.46|1500626|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
tgctgggcggctggctccgcgctcaaaactag CRISPR spacer
gcctgggcggctggcagcgcgctcatgctgaa Protospacer
************* ******** . . *.
315. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to NZ_CP026078 (Staphylococcus aureus strain FDAARGOS_7 plasmid unnamed) position: , mismatch: 10, identity: 0.688
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
agaggggcaaatgcaacaaaacaaaaaaaccc Protospacer
. * ** **************** ***.
316. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to NZ_KT780704 (Staphylococcus aureus subsp. aureus RN4220 plasmid pRM27, complete sequence) position: , mismatch: 10, identity: 0.688
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
agaggggcaaatgcaacaaaacaaaaaaaccc Protospacer
. * ** **************** ***.
317. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to NZ_KT780705 (Staphylococcus aureus subsp. aureus RN4220 plasmid pGO400, complete sequence) position: , mismatch: 10, identity: 0.688
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
agaggggcaaatgcaacaaaacaaaaaaaccc Protospacer
. * ** **************** ***.
318. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to NZ_KT373969 (Staphylococcus pseudintermedius strain HR547/11 plasmid pKM01, complete sequence) position: , mismatch: 10, identity: 0.688
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
agaggggcaaatgcaacaaaacaaaaaaaccc Protospacer
. * ** **************** ***.
319. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to NZ_KU882681 (Staphylococcus lugdunensis strain Tlug15G-4 plasmid pT15G-1, complete sequence) position: , mismatch: 10, identity: 0.688
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
agaggggcaaatgcaacaaaacaaaaaaaccc Protospacer
. * ** **************** ***.
320. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to CP030382 (Staphylococcus aureus strain ER03761.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
agaggggcaaatgcaacaaaacaaaaaaaccc Protospacer
. * ** **************** ***.
321. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to CP030491 (Staphylococcus aureus strain ER02837.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
agaggggcaaatgcaacaaaacaaaaaaaccc Protospacer
. * ** **************** ***.
322. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to CP030606 (Staphylococcus aureus strain ER02693.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
agaggggcaaatgcaacaaaacaaaaaaaccc Protospacer
. * ** **************** ***.
323. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to NC_013653 (Staphylococcus aureus plasmid pPR9, complete sequence) position: , mismatch: 10, identity: 0.688
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
agaggggcaaatgcaacaaaacaaaaaaaccc Protospacer
. * ** **************** ***.
324. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to NZ_CP037443 (Klebsiella sp. PO552 plasmid p2, complete sequence) position: , mismatch: 10, identity: 0.688
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
aaaatggctaatgcaagaaaataaataaaaaa Protospacer
. .. ********** ****.******* *.
325. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to CP030388 (Staphylococcus aureus strain ER01062.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
agaggggcaaatgcaacaaaacaaaaaaaccc Protospacer
. * ** **************** ***.
326. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to NC_007792 (Staphylococcus aureus subsp. aureus USA300_FPR3757 plasmid pUSA03, complete sequence) position: , mismatch: 10, identity: 0.688
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
agaggggcaaatgcaacaaaacaaaaaaaccc Protospacer
. * ** **************** ***.
327. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to CP030522 (Staphylococcus aureus strain ER01564.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
agaggggcaaatgcaacaaaacaaaaaaaccc Protospacer
. * ** **************** ***.
328. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to NC_005054 (Staphylococcus aureus plasmid pLW043, complete sequence) position: , mismatch: 10, identity: 0.688
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
agaggggcaaatgcaacaaaacaaaaaaaccc Protospacer
. * ** **************** ***.
329. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to CP030554 (Staphylococcus aureus strain PS00003.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
agaggggcaaatgcaacaaaacaaaaaaaccc Protospacer
. * ** **************** ***.
330. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to CP030614 (Staphylococcus aureus strain ER01560.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
agaggggcaaatgcaacaaaacaaaaaaaccc Protospacer
. * ** **************** ***.
331. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to NC_013338 (Staphylococcus aureus plasmid SAP068A, complete sequence) position: , mismatch: 10, identity: 0.688
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
agaggggcaaatgcaacaaaacaaaaaaaccc Protospacer
. * ** **************** ***.
332. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to CP030618 (Staphylococcus aureus strain ER04440.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
agaggggcaaatgcaacaaaacaaaaaaaccc Protospacer
. * ** **************** ***.
333. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to CP030671 (Staphylococcus aureus strain ER00951.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
agaggggcaaatgcaacaaaacaaaaaaaccc Protospacer
. * ** **************** ***.
334. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to NC_012547 (Staphylococcus aureus plasmid pGO1, complete sequence) position: , mismatch: 10, identity: 0.688
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
agaggggcaaatgcaacaaaacaaaaaaaccc Protospacer
. * ** **************** ***.
335. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to NC_005024 (Staphylococcus aureus plasmid pSK41, complete sequence) position: , mismatch: 10, identity: 0.688
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
agaggggcaaatgcaacaaaacaaaaaaaccc Protospacer
. * ** **************** ***.
336. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to NC_013320 (Staphylococcus aureus plasmid SAP014A, complete sequence) position: , mismatch: 10, identity: 0.688
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
agaggggcaaatgcaacaaaacaaaaaaaccc Protospacer
. * ** **************** ***.
337. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to NC_013339 (Staphylococcus aureus plasmid SAP069A, complete sequence) position: , mismatch: 10, identity: 0.688
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
agaggggcaaatgcaacaaaacaaaaaaaccc Protospacer
. * ** **************** ***.
338. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to NC_013342 (Staphylococcus aureus plasmid SAP079A, complete sequence) position: , mismatch: 10, identity: 0.688
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
agaggggcaaatgcaacaaaacaaaaaaaccc Protospacer
. * ** **************** ***.
339. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to NC_013343 (Staphylococcus aureus plasmid SAP080A, complete sequence) position: , mismatch: 10, identity: 0.688
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
agaggggcaaatgcaacaaaacaaaaaaaccc Protospacer
. * ** **************** ***.
340. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to NC_013344 (Staphylococcus aureus plasmid SAP082A, complete sequence) position: , mismatch: 10, identity: 0.688
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
agaggggcaaatgcaacaaaacaaaaaaaccc Protospacer
. * ** **************** ***.
341. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to CP030538 (Staphylococcus aureus strain ER02094.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
agaggggcaaatgcaacaaaacaaaaaaaccc Protospacer
. * ** **************** ***.
342. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to CP030556 (Staphylococcus aureus strain ER03750.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
agaggggcaaatgcaacaaaacaaaaaaaccc Protospacer
. * ** **************** ***.
343. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to NC_018967 (Staphylococcus aureus plasmid p18813-P03, complete sequence) position: , mismatch: 10, identity: 0.688
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
agaggggcaaatgcaacaaaacaaaaaaaccc Protospacer
. * ** **************** ***.
344. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to CP030639 (Staphylococcus aureus strain ER04165.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
agaggggcaaatgcaacaaaacaaaaaaaccc Protospacer
. * ** **************** ***.
345. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to CP030435 (Staphylococcus aureus strain ER00610.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
agaggggcaaatgcaacaaaacaaaaaaaccc Protospacer
. * ** **************** ***.
346. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to CP030526 (Staphylococcus aureus strain ER02703.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
agaggggcaaatgcaacaaaacaaaaaaaccc Protospacer
. * ** **************** ***.
347. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to CP030600 (Staphylococcus aureus strain ER00658.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
agaggggcaaatgcaacaaaacaaaaaaaccc Protospacer
. * ** **************** ***.
348. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to NZ_AP017321 (Staphylococcus aureus strain MI plasmid pMI, complete sequence) position: , mismatch: 10, identity: 0.688
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
agaggggcaaatgcaacaaaacaaaaaaaccc Protospacer
. * ** **************** ***.
349. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to AP012550 (Staphylococcus aureus plasmid pN315G DNA, complete sequence, strain: N315G) position: , mismatch: 10, identity: 0.688
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
agaggggcaaatgcaacaaaacaaaaaaaccc Protospacer
. * ** **************** ***.
350. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to NZ_CP026963 (Staphylococcus aureus strain FDAARGOS_6 plasmid unnamed1) position: , mismatch: 10, identity: 0.688
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
agaggggcaaatgcaacaaaacaaaaaaaccc Protospacer
. * ** **************** ***.
351. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to CP030429 (Staphylococcus aureus strain ER03760.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
agaggggcaaatgcaacaaaacaaaaaaaccc Protospacer
. * ** **************** ***.
352. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to CP030648 (Staphylococcus aureus strain ER03556.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
agaggggcaaatgcaacaaaacaaaaaaaccc Protospacer
. * ** **************** ***.
353. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to NC_020535 (Staphylococcus aureus subsp. aureus ST228 plasmid pI5S5, complete sequence) position: , mismatch: 10, identity: 0.688
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
agaggggcaaatgcaacaaaacaaaaaaaccc Protospacer
. * ** **************** ***.
354. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to CP030407 (Staphylococcus aureus strain PS00002.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
agaggggcaaatgcaacaaaacaaaaaaaccc Protospacer
. * ** **************** ***.
355. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to CP030559 (Staphylococcus aureus strain ER01457.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
agaggggcaaatgcaacaaaacaaaaaaaccc Protospacer
. * ** **************** ***.
356. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to NZ_CP040620 (Staphylococcus aureus strain J01 plasmid pJ01-01, complete sequence) position: , mismatch: 10, identity: 0.688
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
agaggggcaaatgcaacaaaacaaaaaaaccc Protospacer
. * ** **************** ***.
357. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to NZ_MH587578 (Staphylococcus aureus strain WG1647 plasmid pWBG615, complete sequence) position: , mismatch: 10, identity: 0.688
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
agaggggcaaatgcaacaaaacaaaaaaaccc Protospacer
. * ** **************** ***.
358. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to CP030591 (Staphylococcus aureus strain ER02989.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
agaggggcaaatgcaacaaaacaaaaaaaccc Protospacer
. * ** **************** ***.
359. spacer 2.60|1501467|32|NC_012691|CRISPRCasFinder,CRT matches to CP030453 (Staphylococcus aureus strain PS00001.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
gctgctgctaatgcaacaaaacaaataaatag CRISPR spacer
agaggggcaaatgcaacaaaacaaaaaaaccc Protospacer
. * ** **************** ***.
360. spacer 2.61|1501527|32|NC_012691|CRISPRCasFinder,CRT matches to NZ_CP017077 (Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence) position: , mismatch: 10, identity: 0.688
ggccgagcgcgtgggaattggcacgcagaaat CRISPR spacer
tctcgagcgcgcgggaagtggcacgctggcga Protospacer
.********.***** ******** *. .
361. spacer 2.71|1502127|32|NC_012691|CRISPRCasFinder,CRT matches to CP024686 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-2-313K, complete sequence) position: , mismatch: 10, identity: 0.688
cgctgcaattatcgattagcctggcagaaccg CRISPR spacer
ttctgcaattgtcgataagcctggctcttact Protospacer
. ********.***** ******** *
362. spacer 2.87|1503087|32|NC_012691|CRISPRCasFinder,CRT matches to MK620899 (Gordonia phage GodonK, complete genome) position: , mismatch: 10, identity: 0.688
attaatgccgagaaatacactggcggaaagtt CRISPR spacer
tctgtgaacgcgaaatacactggcggagagtc Protospacer
.*. . ** ****************.***.
363. spacer 2.96|1501286|33|NC_012691|PILER-CR matches to MK047642 (Phage NG55, complete genome) position: , mismatch: 10, identity: 0.697
agcggtattgatgcgttgtctggagcgatcgtc CRISPR spacer
gcagacgttgatgcgttttctggtgcgatcgct Protospacer
. *...********** ***** *******..
364. spacer 2.130|1503327|33|NC_012691|PILER-CR matches to MT986028 (Arthrobacter phage Thunderclap, complete genome) position: , mismatch: 10, identity: 0.697
ttccttgaaattgtgtggggcaatgttcgcgag CRISPR spacer
cgacctgaaattgtgtggcgaaatgttcggact Protospacer
. *.************* * ******** .
365. spacer 2.130|1503327|33|NC_012691|PILER-CR matches to KU160639 (Arthrobacter phage Anansi, complete genome) position: , mismatch: 10, identity: 0.697
ttccttgaaattgtgtggggcaatgttcgcgag CRISPR spacer
cgacctgaaattgtgtggcgaaatgttcggact Protospacer
. *.************* * ******** .
366. spacer 2.130|1503327|33|NC_012691|PILER-CR matches to KU160647 (Arthrobacter phage Gorgeous, complete genome) position: , mismatch: 10, identity: 0.697
ttccttgaaattgtgtggggcaatgttcgcgag CRISPR spacer
cgacctgaaattgtgtggcgaaatgttcggact Protospacer
. *.************* * ******** .
367. spacer 2.130|1503327|33|NC_012691|PILER-CR matches to KU160666 (Arthrobacter phage SorJuana, complete genome) position: , mismatch: 10, identity: 0.697
ttccttgaaattgtgtggggcaatgttcgcgag CRISPR spacer
cgacctgaaattgtgtggcgaaatgttcggact Protospacer
. *.************* * ******** .
368. spacer 2.130|1503327|33|NC_012691|PILER-CR matches to KU160663 (Arthrobacter phage Rings, complete genome) position: , mismatch: 10, identity: 0.697
ttccttgaaattgtgtggggcaatgttcgcgag CRISPR spacer
cgacctgaaattgtgtggcgaaatgttcggact Protospacer
. *.************* * ******** .
369. spacer 2.12|1498586|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039644 (Azospirillum sp. TSA2s plasmid p2, complete sequence) position: , mismatch: 11, identity: 0.656
atgaagcgccaaaaggccgatgccgcgtggaa CRISPR spacer
ggcaagcgccagaaggccgacgccgccgccgg Protospacer
. ********.********.***** ..
370. spacer 2.15|1498766|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013598 (Rhizobium sp. N741 plasmid pRspN741c, complete sequence) position: , mismatch: 11, identity: 0.656
cgatggcgcgaccgacatagcaaacgcactaa CRISPR spacer
tataggcgaggccgacatagcaaacgccgggt Protospacer
.. **** *.**************** .
371. spacer 2.15|1498766|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013502 (Rhizobium esperanzae strain N561 plasmid pRspN561b, complete sequence) position: , mismatch: 11, identity: 0.656
cgatggcgcgaccgacatagcaaacgcactaa CRISPR spacer
tataggcgaggccgacatagcaaacgccgggt Protospacer
.. **** *.**************** .
372. spacer 2.15|1498766|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013508 (Rhizobium sp. N1341 plasmid pRspN1341c, complete sequence) position: , mismatch: 11, identity: 0.656
cgatggcgcgaccgacatagcaaacgcactaa CRISPR spacer
tataggcgaggccgacatagcaaacgccgggt Protospacer
.. **** *.**************** .
373. spacer 2.15|1498766|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013519 (Rhizobium sp. N113 plasmid pRspN113b, complete sequence) position: , mismatch: 11, identity: 0.656
cgatggcgcgaccgacatagcaaacgcactaa CRISPR spacer
tataggcgaggccgacatagcaaacgccgggt Protospacer
.. **** *.**************** .
374. spacer 2.15|1498766|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013492 (Rhizobium sp. N6212 plasmid pRspN6212b, complete sequence) position: , mismatch: 11, identity: 0.656
cgatggcgcgaccgacatagcaaacgcactaa CRISPR spacer
tataggcgaggccgacatagcaaacgccgggt Protospacer
.. **** *.**************** .
375. spacer 2.15|1498766|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013497 (Rhizobium sp. N621 plasmid pRspN621b, complete sequence) position: , mismatch: 11, identity: 0.656
cgatggcgcgaccgacatagcaaacgcactaa CRISPR spacer
tataggcgaggccgacatagcaaacgccgggt Protospacer
.. **** *.**************** .
376. spacer 2.15|1498766|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013592 (Rhizobium sp. N871 plasmid pRspN871b, complete sequence) position: , mismatch: 11, identity: 0.656
cgatggcgcgaccgacatagcaaacgcactaa CRISPR spacer
tataggcgaggccgacatagcaaacgccgggt Protospacer
.. **** *.**************** .
377. spacer 2.15|1498766|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to NC_010996 (Rhizobium etli CIAT 652 plasmid pB, complete sequence) position: , mismatch: 11, identity: 0.656
cgatggcgcgaccgacatagcaaacgcactaa CRISPR spacer
tataggcgaggccgacatagcaaacgccgggt Protospacer
.. **** *.**************** .
378. spacer 2.24|1499306|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040824 (Paraoceanicella profunda strain D4M1 plasmid pD4M1F, complete sequence) position: , mismatch: 11, identity: 0.656
ttcgcggtgatgtggcgcttcgcggaggaata CRISPR spacer
ctcgcggtgctgtggctcttcgcgcccacgct Protospacer
.******** ****** ******* . ..
379. spacer 2.24|1499306|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040824 (Paraoceanicella profunda strain D4M1 plasmid pD4M1F, complete sequence) position: , mismatch: 11, identity: 0.656
ttcgcggtgatgtggcgcttcgcggaggaata CRISPR spacer
ctcgcggtgctgtggctcttcgcgcccacgct Protospacer
.******** ****** ******* . ..
380. spacer 2.41|1500326|32|NC_012691|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023037 (Komagataeibacter saccharivorans strain CV1 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.656
agcggggcagggatggcgacatggaacgcatg CRISPR spacer
cttagggcagggatcgcgccatggaactttct Protospacer
..********** *** ******** . .
381. spacer 2.86|1503027|32|NC_012691|CRISPRCasFinder,CRT matches to NC_048106 (Synechococcus phage S-CBWM1, complete genome) position: , mismatch: 11, identity: 0.656
tttgtttatcaaaaagagccaataccgagtgc CRISPR spacer
acgcccaatcacaaagagccaataccaagtct Protospacer
. .. **** **************.*** .
