Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_012669 Beutenbergia cavernae DSM 12333, complete sequence 12 crisprs WYL,csa3,cas3,DEDDh,DinG 2 1 0 0

Results visualization

1. NC_012669
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_012669_1 59201-59350 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_012669_2 490490-490593 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_012669_3 497524-497623 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_012669_4 532784-532876 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_012669_5 1723222-1723295 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_012669_6 1738995-1739082 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_012669_7 1750668-1750757 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_012669_8 3649893-3650076 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_012669_10 4451362-4451466 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_012669_9 4449893-4450125 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_012669_11 4631392-4631568 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_012669_12 4641576-4641701 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_012669_2 2.1|490513|18|NC_012669|CRISPRCasFinder 490513-490530 18 NC_012669.1 490585-490602 0 1.0
NC_012669_2 2.2|490554|17|NC_012669|CRISPRCasFinder 490554-490570 17 NC_012669.1 4103529-4103545 0 1.0
NC_012669_2 2.1|490513|18|NC_012669|CRISPRCasFinder 490513-490530 18 NC_012669.1 1977190-1977207 1 0.944
NC_012669_2 2.2|490554|17|NC_012669|CRISPRCasFinder 490554-490570 17 NC_012669.1 764422-764438 1 0.941
NC_012669_2 2.2|490554|17|NC_012669|CRISPRCasFinder 490554-490570 17 NC_012669.1 3470233-3470249 1 0.941

1. spacer 2.1|490513|18|NC_012669|CRISPRCasFinder matches to position: 490585-490602, mismatch: 0, identity: 1.0

ggcggggggtgcgggctg	CRISPR spacer
ggcggggggtgcgggctg	Protospacer
******************

2. spacer 2.2|490554|17|NC_012669|CRISPRCasFinder matches to position: 4103529-4103545, mismatch: 0, identity: 1.0

ccggcgcctgcggtgcg	CRISPR spacer
ccggcgcctgcggtgcg	Protospacer
*****************

3. spacer 2.1|490513|18|NC_012669|CRISPRCasFinder matches to position: 1977190-1977207, mismatch: 1, identity: 0.944

ggcggggggtgcgggctg	CRISPR spacer
ggcggagggtgcgggctg	Protospacer
*****.************

4. spacer 2.2|490554|17|NC_012669|CRISPRCasFinder matches to position: 764422-764438, mismatch: 1, identity: 0.941

ccggcgcctgcggtgcg	CRISPR spacer
ccggcggctgcggtgcg	Protospacer
****** **********

5. spacer 2.2|490554|17|NC_012669|CRISPRCasFinder matches to position: 3470233-3470249, mismatch: 1, identity: 0.941

ccggcgcctgcggtgcg	CRISPR spacer
ccggcgccggcggtgcg	Protospacer
******** ********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_012669_5 5.1|1723246|26|NC_012669|CRISPRCasFinder 1723246-1723271 26 NZ_CP033045 Bacillus foraminis strain Bac44 plasmid unnamed, complete sequence 536798-536823 5 0.808
NC_012669_5 5.1|1723246|26|NC_012669|CRISPRCasFinder 1723246-1723271 26 NZ_CP025584 Paracoccus jeotgali strain CBA4604 plasmid pCBA4604-01, complete sequence 87009-87034 5 0.808

1. spacer 5.1|1723246|26|NC_012669|CRISPRCasFinder matches to NZ_CP033045 (Bacillus foraminis strain Bac44 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

ctcccggagaacacggttcttccgtc	CRISPR spacer
atcccggagaacaaggttcttgcgga	Protospacer
 ************ ******* **  

2. spacer 5.1|1723246|26|NC_012669|CRISPRCasFinder matches to NZ_CP025584 (Paracoccus jeotgali strain CBA4604 plasmid pCBA4604-01, complete sequence) position: , mismatch: 5, identity: 0.808

ctcccggagaacacggttcttccgtc	CRISPR spacer
aatccggataacccggttcttccgtc	Protospacer
  .***** *** *************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage