Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_013037 Dyadobacter fermentans DSM 18053, complete sequence 9 crisprs WYL,DEDDh,csa3,cas3,PD-DExK,Cas9_archaeal 1 1 3 0

Results visualization

1. NC_013037
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_013037_1 563089-563786 Orphan NA
9 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_013037_2 679320-679424 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_013037_3 1176018-1176092 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_013037_4 1446747-1446824 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_013037_5 1681373-1681480 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_013037_6 1722274-1722397 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_013037_7 1919888-1919993 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_013037_8 2517866-2518002 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_013037_9 6620700-6620803 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_013037_7 7.1|1919927|28|NC_013037|CRISPRCasFinder 1919927-1919954 28 NC_013037.1 3226874-3226901 2 0.929
NC_013037_7 7.1|1919927|28|NC_013037|CRISPRCasFinder 1919927-1919954 28 NC_013037.1 3229691-3229718 2 0.929

1. spacer 7.1|1919927|28|NC_013037|CRISPRCasFinder matches to position: 3226874-3226901, mismatch: 2, identity: 0.929

ctttaagcgttaggctttaagctgtaag	CRISPR spacer
ctgtaagcggtaggctttaagctgtaag	Protospacer
** ****** ******************

2. spacer 7.1|1919927|28|NC_013037|CRISPRCasFinder matches to position: 3229691-3229718, mismatch: 2, identity: 0.929

ctttaagcgttaggctttaagctgtaag	CRISPR spacer
ctttaagctttaggctttaagctataag	Protospacer
******** **************.****

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_013037_3 3.1|1176041|29|NC_013037|CRISPRCasFinder 1176041-1176069 29 NC_011887 Methylobacterium nodulans ORS 2060 plasmid pMNOD02, complete sequence 116249-116277 7 0.759

1. spacer 3.1|1176041|29|NC_013037|CRISPRCasFinder matches to NC_011887 (Methylobacterium nodulans ORS 2060 plasmid pMNOD02, complete sequence) position: , mismatch: 7, identity: 0.759

tagcacaaatgtcgaatcgcaccgtttgt	CRISPR spacer
gggcacaaatgtcgaaacgctccgtccgg	Protospacer
 .************** *** ****..* 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1029782 : 1051596 23 Bacillus_phage(33.33%) transposase,integrase attL 1047883:1047897|attR 1059558:1059572
DBSCAN-SWA_2 2318134 : 2388816 58 Acinetobacter_phage(25.0%) transposase NA
DBSCAN-SWA_3 6602078 : 6635582 34 Enterobacter_phage(22.22%) integrase,terminase,portal,head,protease,capsid attL 6594244:6594257|attR 6611144:6611157
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage