Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_012943 Mycobacterium tuberculosis KZN 1435, complete sequence 13 crisprs csa3,c2c9_V-U4,cas6,cas10,csm2gr11,csm3gr7,csm4gr5,csm5gr7,csm6,cas1,cas2,DEDDh,cas4,WYL,DinG,cas3 12 37 2 0

Results visualization

1. NC_012943
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_012943_1 369320-370018 Orphan NA
10 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_012943_2 631543-631680 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_012943_3 692277-692353 TypeV-U4 NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_012943_4 926462-927409 Orphan NA
19 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_012943_5 1290260-1291827 TypeIII II-B,III-A
21 spacers
cas2,cas1,csm6,csm5gr7,csm4gr5,csm3gr7,csm2gr11,cas10,cas6

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_012943_6 1293192-1294472 TypeIII II-B,III-A
17 spacers
cas2,cas1,csm6,csm5gr7,csm4gr5,csm3gr7,csm2gr11,cas10,cas6

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_012943_7 2254040-2254181 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_012943_8 2360615-2361655 Orphan NA
17 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_012943_9 2780020-2780859 Orphan NA
14 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_012943_10 3736468-3737315 Orphan NA
11 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_012943_11 3984005-3984164 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_012943_12 3984233-3984610 Orphan NA
6 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_012943_13 4097393-4097481 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_012943_9 9.1|2780038|27|NC_012943|CRT 2780038-2780064 27 NC_012943.1 2776436-2776462 0 1.0
NC_012943_2 2.1|631561|18|NC_012943|CRT 631561-631578 18 NC_012943.1 22568-22585 1 0.944
NC_012943_2 2.1|631561|18|NC_012943|CRT 631561-631578 18 NC_012943.1 3000208-3000225 1 0.944
NC_012943_2 2.3|631645|18|NC_012943|CRT 631645-631662 18 NC_012943.1 3438722-3438739 1 0.944
NC_012943_8 8.3|2360756|21|NC_012943|CRT 2360756-2360776 21 NC_012943.1 2059190-2059210 1 0.952
NC_012943_8 8.3|2360756|21|NC_012943|CRT 2360756-2360776 21 NC_012943.1 2922781-2922801 1 0.952
NC_012943_12 12.2|3984302|21|NC_012943|CRISPRCasFinder 3984302-3984322 21 NC_012943.1 1490804-1490824 1 0.952
NC_012943_12 12.2|3984302|21|NC_012943|CRISPRCasFinder 3984302-3984322 21 NC_012943.1 3220604-3220624 1 0.952
NC_012943_12 12.3|3984347|21|NC_012943|CRISPRCasFinder 3984347-3984367 21 NC_012943.1 3149351-3149371 1 0.952
NC_012943_1 1.5|369608|42|NC_012943|CRISPRCasFinder 369608-369649 42 NC_012943.1 377669-377710 2 0.952
NC_012943_1 1.6|369683|33|NC_012943|CRISPRCasFinder 369683-369715 33 NC_012943.1 376484-376516 2 0.939
NC_012943_4 4.17|927245|36|NC_012943|CRT 927245-927280 36 NC_012943.1 675345-675380 2 0.944
NC_012943_4 4.17|927245|36|NC_012943|CRT 927245-927280 36 NC_012943.1 1991383-1991418 2 0.944
NC_012943_4 4.17|927245|36|NC_012943|CRT 927245-927280 36 NC_012943.1 3198312-3198347 2 0.944
NC_012943_8 8.3|2360756|21|NC_012943|CRT 2360756-2360776 21 NC_012943.1 2922940-2922960 2 0.905
NC_012943_8 8.3|2360756|21|NC_012943|CRT 2360756-2360776 21 NC_012943.1 3250464-3250484 2 0.905
NC_012943_8 8.5|2360855|21|NC_012943|CRT 2360855-2360875 21 NC_012943.1 3320959-3320979 2 0.905
NC_012943_8 8.5|2360855|21|NC_012943|CRT 2360855-2360875 21 NC_012943.1 3796555-3796575 2 0.905
NC_012943_11 11.1|3984029|21|NC_012943|CRISPRCasFinder 3984029-3984049 21 NC_012943.1 334751-334771 2 0.905
NC_012943_11 11.1|3984029|21|NC_012943|CRISPRCasFinder 3984029-3984049 21 NC_012943.1 339829-339849 2 0.905
NC_012943_11 11.1|3984029|21|NC_012943|CRISPRCasFinder 3984029-3984049 21 NC_012943.1 528472-528492 2 0.905
NC_012943_11 11.1|3984029|21|NC_012943|CRISPRCasFinder 3984029-3984049 21 NC_012943.1 673664-673684 2 0.905
NC_012943_11 11.1|3984029|21|NC_012943|CRISPRCasFinder 3984029-3984049 21 NC_012943.1 837937-837957 2 0.905
NC_012943_11 11.1|3984029|21|NC_012943|CRISPRCasFinder 3984029-3984049 21 NC_012943.1 840681-840701 2 0.905
NC_012943_11 11.1|3984029|21|NC_012943|CRISPRCasFinder 3984029-3984049 21 NC_012943.1 927856-927876 2 0.905
NC_012943_11 11.1|3984029|21|NC_012943|CRISPRCasFinder 3984029-3984049 21 NC_012943.1 1490804-1490824 2 0.905
NC_012943_11 11.1|3984029|21|NC_012943|CRISPRCasFinder 3984029-3984049 21 NC_012943.1 2776574-2776594 2 0.905
NC_012943_11 11.1|3984029|21|NC_012943|CRISPRCasFinder 3984029-3984049 21 NC_012943.1 3220604-3220624 2 0.905
NC_012943_11 11.1|3984029|21|NC_012943|CRISPRCasFinder 3984029-3984049 21 NC_012943.1 3734472-3734492 2 0.905
NC_012943_11 11.1|3984029|21|NC_012943|CRISPRCasFinder 3984029-3984049 21 NC_012943.1 3796888-3796908 2 0.905
NC_012943_11 11.1|3984029|21|NC_012943|CRISPRCasFinder 3984029-3984049 21 NC_012943.1 3931133-3931153 2 0.905
NC_012943_11 11.1|3984029|21|NC_012943|CRISPRCasFinder 3984029-3984049 21 NC_012943.1 3931178-3931198 2 0.905
NC_012943_12 12.1|3984257|21|NC_012943|CRISPRCasFinder 3984257-3984277 21 NC_012943.1 429971-429991 2 0.905
NC_012943_12 12.1|3984257|21|NC_012943|CRISPRCasFinder 3984257-3984277 21 NC_012943.1 430001-430021 2 0.905
NC_012943_12 12.1|3984257|21|NC_012943|CRISPRCasFinder 3984257-3984277 21 NC_012943.1 434285-434305 2 0.905
NC_012943_12 12.2|3984302|21|NC_012943|CRISPRCasFinder 3984302-3984322 21 NC_012943.1 132427-132447 2 0.905
NC_012943_12 12.2|3984302|21|NC_012943|CRISPRCasFinder 3984302-3984322 21 NC_012943.1 336520-336540 2 0.905
NC_012943_12 12.2|3984302|21|NC_012943|CRISPRCasFinder 3984302-3984322 21 NC_012943.1 339505-339525 2 0.905
NC_012943_12 12.2|3984302|21|NC_012943|CRISPRCasFinder 3984302-3984322 21 NC_012943.1 528472-528492 2 0.905
NC_012943_12 12.2|3984302|21|NC_012943|CRISPRCasFinder 3984302-3984322 21 NC_012943.1 673394-673414 2 0.905
NC_012943_12 12.2|3984302|21|NC_012943|CRISPRCasFinder 3984302-3984322 21 NC_012943.1 673403-673423 2 0.905
NC_012943_12 12.2|3984302|21|NC_012943|CRISPRCasFinder 3984302-3984322 21 NC_012943.1 673454-673474 2 0.905
NC_012943_12 12.2|3984302|21|NC_012943|CRISPRCasFinder 3984302-3984322 21 NC_012943.1 673463-673483 2 0.905
NC_012943_12 12.2|3984302|21|NC_012943|CRISPRCasFinder 3984302-3984322 21 NC_012943.1 673574-673594 2 0.905
NC_012943_12 12.2|3984302|21|NC_012943|CRISPRCasFinder 3984302-3984322 21 NC_012943.1 674297-674317 2 0.905
NC_012943_12 12.2|3984302|21|NC_012943|CRISPRCasFinder 3984302-3984322 21 NC_012943.1 837937-837957 2 0.905
NC_012943_12 12.2|3984302|21|NC_012943|CRISPRCasFinder 3984302-3984322 21 NC_012943.1 838945-838965 2 0.905
NC_012943_12 12.2|3984302|21|NC_012943|CRISPRCasFinder 3984302-3984322 21 NC_012943.1 840591-840611 2 0.905
NC_012943_12 12.2|3984302|21|NC_012943|CRISPRCasFinder 3984302-3984322 21 NC_012943.1 841926-841946 2 0.905
NC_012943_12 12.2|3984302|21|NC_012943|CRISPRCasFinder 3984302-3984322 21 NC_012943.1 927856-927876 2 0.905
NC_012943_12 12.2|3984302|21|NC_012943|CRISPRCasFinder 3984302-3984322 21 NC_012943.1 1453546-1453566 2 0.905
NC_012943_12 12.2|3984302|21|NC_012943|CRISPRCasFinder 3984302-3984322 21 NC_012943.1 1490702-1490722 2 0.905
NC_012943_12 12.2|3984302|21|NC_012943|CRISPRCasFinder 3984302-3984322 21 NC_012943.1 1611699-1611719 2 0.905
NC_012943_12 12.2|3984302|21|NC_012943|CRISPRCasFinder 3984302-3984322 21 NC_012943.1 2333812-2333832 2 0.905
NC_012943_12 12.2|3984302|21|NC_012943|CRISPRCasFinder 3984302-3984322 21 NC_012943.1 2334283-2334303 2 0.905
NC_012943_12 12.2|3984302|21|NC_012943|CRISPRCasFinder 3984302-3984322 21 NC_012943.1 2432581-2432601 2 0.905
NC_012943_12 12.2|3984302|21|NC_012943|CRISPRCasFinder 3984302-3984322 21 NC_012943.1 2776574-2776594 2 0.905
NC_012943_12 12.2|3984302|21|NC_012943|CRISPRCasFinder 3984302-3984322 21 NC_012943.1 2795257-2795277 2 0.905
NC_012943_12 12.2|3984302|21|NC_012943|CRISPRCasFinder 3984302-3984322 21 NC_012943.1 3026982-3027002 2 0.905
NC_012943_12 12.2|3984302|21|NC_012943|CRISPRCasFinder 3984302-3984322 21 NC_012943.1 3223369-3223389 2 0.905
NC_012943_12 12.2|3984302|21|NC_012943|CRISPRCasFinder 3984302-3984322 21 NC_012943.1 3223423-3223443 2 0.905
NC_012943_12 12.2|3984302|21|NC_012943|CRISPRCasFinder 3984302-3984322 21 NC_012943.1 3319951-3319971 2 0.905
NC_012943_12 12.2|3984302|21|NC_012943|CRISPRCasFinder 3984302-3984322 21 NC_012943.1 3443325-3443345 2 0.905
NC_012943_12 12.2|3984302|21|NC_012943|CRISPRCasFinder 3984302-3984322 21 NC_012943.1 3733973-3733993 2 0.905
NC_012943_12 12.2|3984302|21|NC_012943|CRISPRCasFinder 3984302-3984322 21 NC_012943.1 3734580-3734600 2 0.905
NC_012943_12 12.2|3984302|21|NC_012943|CRISPRCasFinder 3984302-3984322 21 NC_012943.1 3734598-3734618 2 0.905
NC_012943_12 12.2|3984302|21|NC_012943|CRISPRCasFinder 3984302-3984322 21 NC_012943.1 3734649-3734669 2 0.905
NC_012943_12 12.2|3984302|21|NC_012943|CRISPRCasFinder 3984302-3984322 21 NC_012943.1 3734700-3734720 2 0.905
NC_012943_12 12.2|3984302|21|NC_012943|CRISPRCasFinder 3984302-3984322 21 NC_012943.1 3734844-3734864 2 0.905
NC_012943_12 12.2|3984302|21|NC_012943|CRISPRCasFinder 3984302-3984322 21 NC_012943.1 3735774-3735794 2 0.905
NC_012943_12 12.2|3984302|21|NC_012943|CRISPRCasFinder 3984302-3984322 21 NC_012943.1 3735951-3735971 2 0.905
NC_012943_12 12.2|3984302|21|NC_012943|CRISPRCasFinder 3984302-3984322 21 NC_012943.1 3736341-3736361 2 0.905
NC_012943_12 12.2|3984302|21|NC_012943|CRISPRCasFinder 3984302-3984322 21 NC_012943.1 3775776-3775796 2 0.905
NC_012943_12 12.2|3984302|21|NC_012943|CRISPRCasFinder 3984302-3984322 21 NC_012943.1 3915652-3915672 2 0.905
NC_012943_12 12.2|3984302|21|NC_012943|CRISPRCasFinder 3984302-3984322 21 NC_012943.1 3915748-3915768 2 0.905
NC_012943_12 12.2|3984302|21|NC_012943|CRISPRCasFinder 3984302-3984322 21 NC_012943.1 3916744-3916764 2 0.905
NC_012943_12 12.2|3984302|21|NC_012943|CRISPRCasFinder 3984302-3984322 21 NC_012943.1 3916753-3916773 2 0.905
NC_012943_12 12.2|3984302|21|NC_012943|CRISPRCasFinder 3984302-3984322 21 NC_012943.1 3916762-3916782 2 0.905
NC_012943_12 12.2|3984302|21|NC_012943|CRISPRCasFinder 3984302-3984322 21 NC_012943.1 3916771-3916791 2 0.905
NC_012943_12 12.2|3984302|21|NC_012943|CRISPRCasFinder 3984302-3984322 21 NC_012943.1 3916780-3916800 2 0.905
NC_012943_12 12.2|3984302|21|NC_012943|CRISPRCasFinder 3984302-3984322 21 NC_012943.1 3917551-3917571 2 0.905
NC_012943_12 12.2|3984302|21|NC_012943|CRISPRCasFinder 3984302-3984322 21 NC_012943.1 3917746-3917766 2 0.905
NC_012943_12 12.2|3984302|21|NC_012943|CRISPRCasFinder 3984302-3984322 21 NC_012943.1 3923649-3923669 2 0.905
NC_012943_12 12.2|3984302|21|NC_012943|CRISPRCasFinder 3984302-3984322 21 NC_012943.1 3928499-3928519 2 0.905
NC_012943_12 12.2|3984302|21|NC_012943|CRISPRCasFinder 3984302-3984322 21 NC_012943.1 3929198-3929218 2 0.905
NC_012943_12 12.2|3984302|21|NC_012943|CRISPRCasFinder 3984302-3984322 21 NC_012943.1 3929840-3929860 2 0.905
NC_012943_12 12.2|3984302|21|NC_012943|CRISPRCasFinder 3984302-3984322 21 NC_012943.1 3931061-3931081 2 0.905
NC_012943_12 12.2|3984302|21|NC_012943|CRISPRCasFinder 3984302-3984322 21 NC_012943.1 3931178-3931198 2 0.905
NC_012943_12 12.2|3984302|21|NC_012943|CRISPRCasFinder 3984302-3984322 21 NC_012943.1 3931625-3931645 2 0.905
NC_012943_12 12.2|3984302|21|NC_012943|CRISPRCasFinder 3984302-3984322 21 NC_012943.1 3935404-3935424 2 0.905
NC_012943_12 12.3|3984347|21|NC_012943|CRISPRCasFinder 3984347-3984367 21 NC_012943.1 429971-429991 2 0.905
NC_012943_12 12.3|3984347|21|NC_012943|CRISPRCasFinder 3984347-3984367 21 NC_012943.1 430001-430021 2 0.905
NC_012943_12 12.3|3984347|21|NC_012943|CRISPRCasFinder 3984347-3984367 21 NC_012943.1 434285-434305 2 0.905

1. spacer 9.1|2780038|27|NC_012943|CRT matches to position: 2776436-2776462, mismatch: 0, identity: 1.0

ctgatcagcctgctgggcggccaaggc	CRISPR spacer
ctgatcagcctgctgggcggccaaggc	Protospacer
***************************

2. spacer 2.1|631561|18|NC_012943|CRT matches to position: 22568-22585, mismatch: 1, identity: 0.944

accacgtcggcgacgacg	CRISPR spacer
acgacgtcggcgacgacg	Protospacer
** ***************

3. spacer 2.1|631561|18|NC_012943|CRT matches to position: 3000208-3000225, mismatch: 1, identity: 0.944

accacgtcggcgacgacg	CRISPR spacer
acctcgtcggcgacgacg	Protospacer
*** **************

4. spacer 2.3|631645|18|NC_012943|CRT matches to position: 3438722-3438739, mismatch: 1, identity: 0.944

accacgccgccaacgacg	CRISPR spacer
accacgccgcccacgacg	Protospacer
*********** ******

5. spacer 8.3|2360756|21|NC_012943|CRT matches to position: 2059190-2059210, mismatch: 1, identity: 0.952

gccggcgggctgctctacggc	CRISPR spacer
gccggcgggctgctgtacggc	Protospacer
************** ******

6. spacer 8.3|2360756|21|NC_012943|CRT matches to position: 2922781-2922801, mismatch: 1, identity: 0.952

gccggcgggctgctctacggc	CRISPR spacer
gccggcgggctgctgtacggc	Protospacer
************** ******

7. spacer 12.2|3984302|21|NC_012943|CRISPRCasFinder matches to position: 1490804-1490824, mismatch: 1, identity: 0.952

ggcggcaacaccggcaacggc	CRISPR spacer
ggcggcaacgccggcaacggc	Protospacer
*********.***********

8. spacer 12.2|3984302|21|NC_012943|CRISPRCasFinder matches to position: 3220604-3220624, mismatch: 1, identity: 0.952

ggcggcaacaccggcaacggc	CRISPR spacer
ggcggcaacgccggcaacggc	Protospacer
*********.***********

9. spacer 12.3|3984347|21|NC_012943|CRISPRCasFinder matches to position: 3149351-3149371, mismatch: 1, identity: 0.952

aacaacaacttcggcttcggc	CRISPR spacer
aacaacaacttcgggttcggc	Protospacer
************** ******

10. spacer 1.5|369608|42|NC_012943|CRISPRCasFinder matches to position: 377669-377710, mismatch: 2, identity: 0.952

ccggtgcccgagttgaagaacccgatgtttccgctgccggag	CRISPR spacer
ccggtgcccgagttgaacaacccgacgtttccgctgccggag	Protospacer
***************** *******.****************

11. spacer 1.6|369683|33|NC_012943|CRISPRCasFinder matches to position: 376484-376516, mismatch: 2, identity: 0.939

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
aggctgccgaacccgatctggccgctgccggtg	Protospacer
********** *************.********

12. spacer 4.17|927245|36|NC_012943|CRT matches to position: 675345-675380, mismatch: 2, identity: 0.944

gctgatcggcaacggcggtaacggcggggccggcgg	CRISPR spacer
gctgatgggcaacggcggcaacggcggggccggcgg	Protospacer
****** ***********.*****************

13. spacer 4.17|927245|36|NC_012943|CRT matches to position: 1991383-1991418, mismatch: 2, identity: 0.944

gctgatcggcaacggcggtaacggcggggccggcgg	CRISPR spacer
gctgatcggcaacggcggcaacggcggtgccggcgg	Protospacer
******************.******** ********

14. spacer 4.17|927245|36|NC_012943|CRT matches to position: 3198312-3198347, mismatch: 2, identity: 0.944

gctgatcggcaacggcggtaacggcggggccggcgg	CRISPR spacer
gctgatcggcaacggcggccacggcggggccggcgg	Protospacer
******************. ****************

15. spacer 8.3|2360756|21|NC_012943|CRT matches to position: 2922940-2922960, mismatch: 2, identity: 0.905

gccggcgggctgctctacggc	CRISPR spacer
gccggcgggctgctgttcggc	Protospacer
************** * ****

16. spacer 8.3|2360756|21|NC_012943|CRT matches to position: 3250464-3250484, mismatch: 2, identity: 0.905

gccggcgggctgctctacggc	CRISPR spacer
gccggcggcctggtctacggc	Protospacer
******** *** ********

17. spacer 8.5|2360855|21|NC_012943|CRT matches to position: 3320959-3320979, mismatch: 2, identity: 0.905

aatggcgggctgctgttcggc	CRISPR spacer
aacggcgggctgctattcggc	Protospacer
**.***********.******

18. spacer 8.5|2360855|21|NC_012943|CRT matches to position: 3796555-3796575, mismatch: 2, identity: 0.905

aatggcgggctgctgttcggc	CRISPR spacer
aacggcggcctgctgttcggc	Protospacer
**.***** ************

19. spacer 11.1|3984029|21|NC_012943|CRISPRCasFinder matches to position: 334751-334771, mismatch: 2, identity: 0.905

ggcggcaacaccggcagcggc	CRISPR spacer
ggcggcaacggcggcagcggc	Protospacer
*********. **********

20. spacer 11.1|3984029|21|NC_012943|CRISPRCasFinder matches to position: 339829-339849, mismatch: 2, identity: 0.905

ggcggcaacaccggcagcggc	CRISPR spacer
ggcggcaacggcggcagcggc	Protospacer
*********. **********

21. spacer 11.1|3984029|21|NC_012943|CRISPRCasFinder matches to position: 528472-528492, mismatch: 2, identity: 0.905

ggcggcaacaccggcagcggc	CRISPR spacer
ggcgccaacaccggcatcggc	Protospacer
**** *********** ****

22. spacer 11.1|3984029|21|NC_012943|CRISPRCasFinder matches to position: 673664-673684, mismatch: 2, identity: 0.905

ggcggcaacaccggcagcggc	CRISPR spacer
ggcggcaacggcggcagcggc	Protospacer
*********. **********

23. spacer 11.1|3984029|21|NC_012943|CRISPRCasFinder matches to position: 837937-837957, mismatch: 2, identity: 0.905

ggcggcaacaccggcagcggc	CRISPR spacer
ggcggcaacgccggcatcggc	Protospacer
*********.****** ****

24. spacer 11.1|3984029|21|NC_012943|CRISPRCasFinder matches to position: 840681-840701, mismatch: 2, identity: 0.905

ggcggcaacaccggcagcggc	CRISPR spacer
ggcggcaacggcggcagcggc	Protospacer
*********. **********

25. spacer 11.1|3984029|21|NC_012943|CRISPRCasFinder matches to position: 927856-927876, mismatch: 2, identity: 0.905

ggcggcaacaccggcagcggc	CRISPR spacer
ggcggcaacgccggcaccggc	Protospacer
*********.****** ****

26. spacer 11.1|3984029|21|NC_012943|CRISPRCasFinder matches to position: 1490804-1490824, mismatch: 2, identity: 0.905

ggcggcaacaccggcagcggc	CRISPR spacer
ggcggcaacgccggcaacggc	Protospacer
*********.******.****

27. spacer 11.1|3984029|21|NC_012943|CRISPRCasFinder matches to position: 2776574-2776594, mismatch: 2, identity: 0.905

ggcggcaacaccggcagcggc	CRISPR spacer
ggcggcaaccccggcaccggc	Protospacer
********* ****** ****

28. spacer 11.1|3984029|21|NC_012943|CRISPRCasFinder matches to position: 3220604-3220624, mismatch: 2, identity: 0.905

ggcggcaacaccggcagcggc	CRISPR spacer
ggcggcaacgccggcaacggc	Protospacer
*********.******.****

29. spacer 11.1|3984029|21|NC_012943|CRISPRCasFinder matches to position: 3734472-3734492, mismatch: 2, identity: 0.905

ggcggcaacaccggcagcggc	CRISPR spacer
ggcggcaacggcggcagcggc	Protospacer
*********. **********

30. spacer 11.1|3984029|21|NC_012943|CRISPRCasFinder matches to position: 3796888-3796908, mismatch: 2, identity: 0.905

ggcggcaacaccggcagcggc	CRISPR spacer
ggcggcaacggcggcagcggc	Protospacer
*********. **********

31. spacer 11.1|3984029|21|NC_012943|CRISPRCasFinder matches to position: 3931133-3931153, mismatch: 2, identity: 0.905

ggcggcaacaccggcagcggc	CRISPR spacer
ggcggcaacggcggcagcggc	Protospacer
*********. **********

32. spacer 11.1|3984029|21|NC_012943|CRISPRCasFinder matches to position: 3931178-3931198, mismatch: 2, identity: 0.905

ggcggcaacaccggcagcggc	CRISPR spacer
ggcggcaacagcggcaccggc	Protospacer
********** ***** ****

33. spacer 12.1|3984257|21|NC_012943|CRISPRCasFinder matches to position: 429971-429991, mismatch: 2, identity: 0.905

aacaacaacatgggcttcggc	CRISPR spacer
aacaacaacatcggcatcggc	Protospacer
*********** *** *****

34. spacer 12.1|3984257|21|NC_012943|CRISPRCasFinder matches to position: 430001-430021, mismatch: 2, identity: 0.905

aacaacaacatgggcttcggc	CRISPR spacer
aactacaacatcggcttcggc	Protospacer
*** ******* *********

35. spacer 12.1|3984257|21|NC_012943|CRISPRCasFinder matches to position: 434285-434305, mismatch: 2, identity: 0.905

aacaacaacatgggcttcggc	CRISPR spacer
aactacaacatcggcttcggc	Protospacer
*** ******* *********

36. spacer 12.2|3984302|21|NC_012943|CRISPRCasFinder matches to position: 132427-132447, mismatch: 2, identity: 0.905

ggcggcaacaccggcaacggc	CRISPR spacer
ggcggaaacgccggcaacggc	Protospacer
***** ***.***********

37. spacer 12.2|3984302|21|NC_012943|CRISPRCasFinder matches to position: 336520-336540, mismatch: 2, identity: 0.905

ggcggcaacaccggcaacggc	CRISPR spacer
ggcggcaacggcggcaacggc	Protospacer
*********. **********

38. spacer 12.2|3984302|21|NC_012943|CRISPRCasFinder matches to position: 339505-339525, mismatch: 2, identity: 0.905

ggcggcaacaccggcaacggc	CRISPR spacer
ggcggcaacggcggcaacggc	Protospacer
*********. **********

39. spacer 12.2|3984302|21|NC_012943|CRISPRCasFinder matches to position: 528472-528492, mismatch: 2, identity: 0.905

ggcggcaacaccggcaacggc	CRISPR spacer
ggcgccaacaccggcatcggc	Protospacer
**** *********** ****

40. spacer 12.2|3984302|21|NC_012943|CRISPRCasFinder matches to position: 673394-673414, mismatch: 2, identity: 0.905

ggcggcaacaccggcaacggc	CRISPR spacer
ggcggcaacggcggcaacggc	Protospacer
*********. **********

41. spacer 12.2|3984302|21|NC_012943|CRISPRCasFinder matches to position: 673403-673423, mismatch: 2, identity: 0.905

ggcggcaacaccggcaacggc	CRISPR spacer
ggcggcaacggcggcaacggc	Protospacer
*********. **********

42. spacer 12.2|3984302|21|NC_012943|CRISPRCasFinder matches to position: 673454-673474, mismatch: 2, identity: 0.905

ggcggcaacaccggcaacggc	CRISPR spacer
ggcggcaacggcggcaacggc	Protospacer
*********. **********

43. spacer 12.2|3984302|21|NC_012943|CRISPRCasFinder matches to position: 673463-673483, mismatch: 2, identity: 0.905

ggcggcaacaccggcaacggc	CRISPR spacer
ggcggcaacggcggcaacggc	Protospacer
*********. **********

44. spacer 12.2|3984302|21|NC_012943|CRISPRCasFinder matches to position: 673574-673594, mismatch: 2, identity: 0.905

ggcggcaacaccggcaacggc	CRISPR spacer
ggcggcaacggcggcaacggc	Protospacer
*********. **********

45. spacer 12.2|3984302|21|NC_012943|CRISPRCasFinder matches to position: 674297-674317, mismatch: 2, identity: 0.905

ggcggcaacaccggcaacggc	CRISPR spacer
ggcggcaacggcggcaacggc	Protospacer
*********. **********

46. spacer 12.2|3984302|21|NC_012943|CRISPRCasFinder matches to position: 837937-837957, mismatch: 2, identity: 0.905

ggcggcaacaccggcaacggc	CRISPR spacer
ggcggcaacgccggcatcggc	Protospacer
*********.****** ****

47. spacer 12.2|3984302|21|NC_012943|CRISPRCasFinder matches to position: 838945-838965, mismatch: 2, identity: 0.905

ggcggcaacaccggcaacggc	CRISPR spacer
ggcggcaacggcggcaacggc	Protospacer
*********. **********

48. spacer 12.2|3984302|21|NC_012943|CRISPRCasFinder matches to position: 840591-840611, mismatch: 2, identity: 0.905

ggcggcaacaccggcaacggc	CRISPR spacer
ggcggcaacggcggcaacggc	Protospacer
*********. **********

49. spacer 12.2|3984302|21|NC_012943|CRISPRCasFinder matches to position: 841926-841946, mismatch: 2, identity: 0.905

ggcggcaacaccggcaacggc	CRISPR spacer
ggcggcaacggcggcaacggc	Protospacer
*********. **********

50. spacer 12.2|3984302|21|NC_012943|CRISPRCasFinder matches to position: 927856-927876, mismatch: 2, identity: 0.905

ggcggcaacaccggcaacggc	CRISPR spacer
ggcggcaacgccggcaccggc	Protospacer
*********.****** ****

51. spacer 12.2|3984302|21|NC_012943|CRISPRCasFinder matches to position: 1453546-1453566, mismatch: 2, identity: 0.905

ggcggcaacaccggcaacggc	CRISPR spacer
ggcggcaacggcggcaacggc	Protospacer
*********. **********

52. spacer 12.2|3984302|21|NC_012943|CRISPRCasFinder matches to position: 1490702-1490722, mismatch: 2, identity: 0.905

ggcggcaacaccggcaacggc	CRISPR spacer
ggcggcaacggcggcaacggc	Protospacer
*********. **********

53. spacer 12.2|3984302|21|NC_012943|CRISPRCasFinder matches to position: 1611699-1611719, mismatch: 2, identity: 0.905

ggcggcaacaccggcaacggc	CRISPR spacer
ggcggcgacagcggcaacggc	Protospacer
******.*** **********

54. spacer 12.2|3984302|21|NC_012943|CRISPRCasFinder matches to position: 2333812-2333832, mismatch: 2, identity: 0.905

ggcggcaacaccggcaacggc	CRISPR spacer
ggcggcaacggcggcaacggc	Protospacer
*********. **********

55. spacer 12.2|3984302|21|NC_012943|CRISPRCasFinder matches to position: 2334283-2334303, mismatch: 2, identity: 0.905

ggcggcaacaccggcaacggc	CRISPR spacer
ggcggcaacggcggcaacggc	Protospacer
*********. **********

56. spacer 12.2|3984302|21|NC_012943|CRISPRCasFinder matches to position: 2432581-2432601, mismatch: 2, identity: 0.905

ggcggcaacaccggcaacggc	CRISPR spacer
ggcggcaacggcggcaacggc	Protospacer
*********. **********

57. spacer 12.2|3984302|21|NC_012943|CRISPRCasFinder matches to position: 2776574-2776594, mismatch: 2, identity: 0.905

ggcggcaacaccggcaacggc	CRISPR spacer
ggcggcaaccccggcaccggc	Protospacer
********* ****** ****

58. spacer 12.2|3984302|21|NC_012943|CRISPRCasFinder matches to position: 2795257-2795277, mismatch: 2, identity: 0.905

ggcggcaacaccggcaacggc	CRISPR spacer
ggcggcaacggcggcaacggc	Protospacer
*********. **********

59. spacer 12.2|3984302|21|NC_012943|CRISPRCasFinder matches to position: 3026982-3027002, mismatch: 2, identity: 0.905

ggcggcaacaccggcaacggc	CRISPR spacer
ggcggcaacggcggcaacggc	Protospacer
*********. **********

60. spacer 12.2|3984302|21|NC_012943|CRISPRCasFinder matches to position: 3223369-3223389, mismatch: 2, identity: 0.905

ggcggcaacaccggcaacggc	CRISPR spacer
ggcggcaacggcggcaacggc	Protospacer
*********. **********

61. spacer 12.2|3984302|21|NC_012943|CRISPRCasFinder matches to position: 3223423-3223443, mismatch: 2, identity: 0.905

ggcggcaacaccggcaacggc	CRISPR spacer
ggcggcaacggcggcaacggc	Protospacer
*********. **********

62. spacer 12.2|3984302|21|NC_012943|CRISPRCasFinder matches to position: 3319951-3319971, mismatch: 2, identity: 0.905

ggcggcaacaccggcaacggc	CRISPR spacer
ggcggcaacgccggccacggc	Protospacer
*********.***** *****

63. spacer 12.2|3984302|21|NC_012943|CRISPRCasFinder matches to position: 3443325-3443345, mismatch: 2, identity: 0.905

ggcggcaacaccggcaacggc	CRISPR spacer
ggcggcaacggcggcaacggc	Protospacer
*********. **********

64. spacer 12.2|3984302|21|NC_012943|CRISPRCasFinder matches to position: 3733973-3733993, mismatch: 2, identity: 0.905

ggcggcaacaccggcaacggc	CRISPR spacer
ggcggcaacggcggcaacggc	Protospacer
*********. **********

65. spacer 12.2|3984302|21|NC_012943|CRISPRCasFinder matches to position: 3734580-3734600, mismatch: 2, identity: 0.905

ggcggcaacaccggcaacggc	CRISPR spacer
ggcggcaactccggcaacagc	Protospacer
********* ********.**

66. spacer 12.2|3984302|21|NC_012943|CRISPRCasFinder matches to position: 3734598-3734618, mismatch: 2, identity: 0.905

ggcggcaacaccggcaacggc	CRISPR spacer
ggcggcaacggcggcaacggc	Protospacer
*********. **********

67. spacer 12.2|3984302|21|NC_012943|CRISPRCasFinder matches to position: 3734649-3734669, mismatch: 2, identity: 0.905

ggcggcaacaccggcaacggc	CRISPR spacer
ggcggcagcgccggcaacggc	Protospacer
*******.*.***********

68. spacer 12.2|3984302|21|NC_012943|CRISPRCasFinder matches to position: 3734700-3734720, mismatch: 2, identity: 0.905

ggcggcaacaccggcaacggc	CRISPR spacer
ggcggcaacggcggcaacggc	Protospacer
*********. **********

69. spacer 12.2|3984302|21|NC_012943|CRISPRCasFinder matches to position: 3734844-3734864, mismatch: 2, identity: 0.905

ggcggcaacaccggcaacggc	CRISPR spacer
ggcggcaacggcggcaacggc	Protospacer
*********. **********

70. spacer 12.2|3984302|21|NC_012943|CRISPRCasFinder matches to position: 3735774-3735794, mismatch: 2, identity: 0.905

ggcggcaacaccggcaacggc	CRISPR spacer
ggcggcaacggcggcaacggc	Protospacer
*********. **********

71. spacer 12.2|3984302|21|NC_012943|CRISPRCasFinder matches to position: 3735951-3735971, mismatch: 2, identity: 0.905

ggcggcaacaccggcaacggc	CRISPR spacer
ggcggcaacggcggcaacggc	Protospacer
*********. **********

72. spacer 12.2|3984302|21|NC_012943|CRISPRCasFinder matches to position: 3736341-3736361, mismatch: 2, identity: 0.905

ggcggcaacaccggcaacggc	CRISPR spacer
ggcggcaacggcggcaacggc	Protospacer
*********. **********

73. spacer 12.2|3984302|21|NC_012943|CRISPRCasFinder matches to position: 3775776-3775796, mismatch: 2, identity: 0.905

ggcggcaacaccggcaacggc	CRISPR spacer
ggcggcaacggcggcaacggc	Protospacer
*********. **********

74. spacer 12.2|3984302|21|NC_012943|CRISPRCasFinder matches to position: 3915652-3915672, mismatch: 2, identity: 0.905

ggcggcaacaccggcaacggc	CRISPR spacer
ggcggcaacggcggcaacggc	Protospacer
*********. **********

75. spacer 12.2|3984302|21|NC_012943|CRISPRCasFinder matches to position: 3915748-3915768, mismatch: 2, identity: 0.905

ggcggcaacaccggcaacggc	CRISPR spacer
ggcggcaacggcggcaacggc	Protospacer
*********. **********

76. spacer 12.2|3984302|21|NC_012943|CRISPRCasFinder matches to position: 3916744-3916764, mismatch: 2, identity: 0.905

ggcggcaacaccggcaacggc	CRISPR spacer
ggcggcaacggcggcaacggc	Protospacer
*********. **********

77. spacer 12.2|3984302|21|NC_012943|CRISPRCasFinder matches to position: 3916753-3916773, mismatch: 2, identity: 0.905

ggcggcaacaccggcaacggc	CRISPR spacer
ggcggcaacggcggcaacggc	Protospacer
*********. **********

78. spacer 12.2|3984302|21|NC_012943|CRISPRCasFinder matches to position: 3916762-3916782, mismatch: 2, identity: 0.905

ggcggcaacaccggcaacggc	CRISPR spacer
ggcggcaacggcggcaacggc	Protospacer
*********. **********

79. spacer 12.2|3984302|21|NC_012943|CRISPRCasFinder matches to position: 3916771-3916791, mismatch: 2, identity: 0.905

ggcggcaacaccggcaacggc	CRISPR spacer
ggcggcaacggcggcaacggc	Protospacer
*********. **********

80. spacer 12.2|3984302|21|NC_012943|CRISPRCasFinder matches to position: 3916780-3916800, mismatch: 2, identity: 0.905

ggcggcaacaccggcaacggc	CRISPR spacer
ggcggcaacggcggcaacggc	Protospacer
*********. **********

81. spacer 12.2|3984302|21|NC_012943|CRISPRCasFinder matches to position: 3917551-3917571, mismatch: 2, identity: 0.905

ggcggcaacaccggcaacggc	CRISPR spacer
ggcggcaacgccggcgacggc	Protospacer
*********.*****.*****

82. spacer 12.2|3984302|21|NC_012943|CRISPRCasFinder matches to position: 3917746-3917766, mismatch: 2, identity: 0.905

ggcggcaacaccggcaacggc	CRISPR spacer
ggcggcaacggcggcaacggc	Protospacer
*********. **********

83. spacer 12.2|3984302|21|NC_012943|CRISPRCasFinder matches to position: 3923649-3923669, mismatch: 2, identity: 0.905

ggcggcaacaccggcaacggc	CRISPR spacer
ggcggcaccaacggcaacggc	Protospacer
******* ** **********

84. spacer 12.2|3984302|21|NC_012943|CRISPRCasFinder matches to position: 3928499-3928519, mismatch: 2, identity: 0.905

ggcggcaacaccggcaacggc	CRISPR spacer
ggcggcaacggcggcaacggc	Protospacer
*********. **********

85. spacer 12.2|3984302|21|NC_012943|CRISPRCasFinder matches to position: 3929198-3929218, mismatch: 2, identity: 0.905

ggcggcaacaccggcaacggc	CRISPR spacer
ggcggcaacggcggcaacggc	Protospacer
*********. **********

86. spacer 12.2|3984302|21|NC_012943|CRISPRCasFinder matches to position: 3929840-3929860, mismatch: 2, identity: 0.905

ggcggcaacaccggcaacggc	CRISPR spacer
ggcggcaacggcggcaacggc	Protospacer
*********. **********

87. spacer 12.2|3984302|21|NC_012943|CRISPRCasFinder matches to position: 3931061-3931081, mismatch: 2, identity: 0.905

ggcggcaacaccggcaacggc	CRISPR spacer
ggcggcaacggcggcaacggc	Protospacer
*********. **********

88. spacer 12.2|3984302|21|NC_012943|CRISPRCasFinder matches to position: 3931178-3931198, mismatch: 2, identity: 0.905

ggcggcaacaccggcaacggc	CRISPR spacer
ggcggcaacagcggcaccggc	Protospacer
********** ***** ****

89. spacer 12.2|3984302|21|NC_012943|CRISPRCasFinder matches to position: 3931625-3931645, mismatch: 2, identity: 0.905

ggcggcaacaccggcaacggc	CRISPR spacer
ggcggcaacggcggcaacggc	Protospacer
*********. **********

90. spacer 12.2|3984302|21|NC_012943|CRISPRCasFinder matches to position: 3935404-3935424, mismatch: 2, identity: 0.905

ggcggcaacaccggcaacggc	CRISPR spacer
ggcggcaccaacggcaacggc	Protospacer
******* ** **********

91. spacer 12.3|3984347|21|NC_012943|CRISPRCasFinder matches to position: 429971-429991, mismatch: 2, identity: 0.905

aacaacaacttcggcttcggc	CRISPR spacer
aacaacaacatcggcatcggc	Protospacer
********* ***** *****

92. spacer 12.3|3984347|21|NC_012943|CRISPRCasFinder matches to position: 430001-430021, mismatch: 2, identity: 0.905

aacaacaacttcggcttcggc	CRISPR spacer
aactacaacatcggcttcggc	Protospacer
*** ***** ***********

93. spacer 12.3|3984347|21|NC_012943|CRISPRCasFinder matches to position: 434285-434305, mismatch: 2, identity: 0.905

aacaacaacttcggcttcggc	CRISPR spacer
aactacaacatcggcttcggc	Protospacer
*** ***** ***********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_012943_11 11.1|3984029|21|NC_012943|CRISPRCasFinder 3984029-3984049 21 NZ_CP021914 Sagittula sp. P11 plasmid unnamed1, complete sequence 200082-200102 0 1.0
NC_012943_11 11.1|3984029|21|NC_012943|CRISPRCasFinder 3984029-3984049 21 NZ_CP039644 Azospirillum sp. TSA2s plasmid p2, complete sequence 205709-205729 0 1.0
NC_012943_8 8.9|2361029|21|NC_012943|CRT 2361029-2361049 21 NZ_CP028348 Novosphingobium sp. THN1 plasmid pTHN, complete sequence 60334-60354 1 0.952
NC_012943_11 11.1|3984029|21|NC_012943|CRISPRCasFinder 3984029-3984049 21 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 16061-16081 1 0.952
NC_012943_11 11.1|3984029|21|NC_012943|CRISPRCasFinder 3984029-3984049 21 NZ_CP053709 Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed1, complete sequence 278106-278126 1 0.952
NC_012943_11 11.1|3984029|21|NC_012943|CRISPRCasFinder 3984029-3984049 21 NZ_CP006993 Methylobacterium sp. AMS5 plasmid pAMS5a, complete sequence 71625-71645 1 0.952
NC_012943_11 11.1|3984029|21|NC_012943|CRISPRCasFinder 3984029-3984049 21 KR053194 Gordonia phage GAL1, complete genome 13539-13559 1 0.952
NC_012943_11 11.1|3984029|21|NC_012943|CRISPRCasFinder 3984029-3984049 21 NZ_CP011809 Pandoraea faecigallinarum strain DSM 23572 plasmid pPF72-2, complete sequence 5131-5151 1 0.952
NC_012943_11 11.1|3984029|21|NC_012943|CRISPRCasFinder 3984029-3984049 21 NZ_CP022727 Erwinia persicina strain B64 plasmid pEP2, complete sequence 87588-87608 1 0.952
NC_012943_11 11.1|3984029|21|NC_012943|CRISPRCasFinder 3984029-3984049 21 NZ_CP039965 Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence 1495154-1495174 1 0.952
NC_012943_11 11.1|3984029|21|NC_012943|CRISPRCasFinder 3984029-3984049 21 NZ_CP010865 Marinovum algicola DG 898 plasmid pMaD10, complete sequence 51349-51369 1 0.952
NC_012943_11 11.2|3984074|21|NC_012943|CRISPRCasFinder 3984074-3984094 21 NC_010608 Exiguobacterium arabatum pEspB plasmid 36860-36880 1 0.952
NC_012943_12 12.2|3984302|21|NC_012943|CRISPRCasFinder 3984302-3984322 21 NZ_KU254577 Pseudomonas aeruginosa strain HN39 plasmid pHN39-SIM, complete sequence 30285-30305 1 0.952
NC_012943_12 12.2|3984302|21|NC_012943|CRISPRCasFinder 3984302-3984322 21 NZ_CP021914 Sagittula sp. P11 plasmid unnamed1, complete sequence 200082-200102 1 0.952
NC_012943_12 12.2|3984302|21|NC_012943|CRISPRCasFinder 3984302-3984322 21 NZ_AP015031 Pseudomonas putida strain KF715 plasmid pKF715B, complete sequence 50608-50628 1 0.952
NC_012943_12 12.2|3984302|21|NC_012943|CRISPRCasFinder 3984302-3984322 21 NZ_CP039644 Azospirillum sp. TSA2s plasmid p2, complete sequence 205709-205729 1 0.952
NC_012943_12 12.2|3984302|21|NC_012943|CRISPRCasFinder 3984302-3984322 21 NC_009620 Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence 978022-978042 1 0.952
NC_012943_12 12.2|3984302|21|NC_012943|CRISPRCasFinder 3984302-3984322 21 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 985548-985568 1 0.952
NC_012943_11 11.1|3984029|21|NC_012943|CRISPRCasFinder 3984029-3984049 21 NZ_LR134465 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence 72145-72165 2 0.905
NC_012943_11 11.1|3984029|21|NC_012943|CRISPRCasFinder 3984029-3984049 21 NC_016586 Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence 466290-466310 2 0.905
NC_012943_11 11.3|3984119|21|NC_012943|CRISPRCasFinder 3984119-3984139 21 NZ_CP032828 Sphingomonas sp. YZ-8 plasmid unnamed1, complete sequence 695167-695187 2 0.905
NC_012943_12 12.2|3984302|21|NC_012943|CRISPRCasFinder 3984302-3984322 21 NZ_AP014579 Burkholderia sp. RPE67 plasmid p1, complete sequence 55287-55307 2 0.905
NC_012943_12 12.2|3984302|21|NC_012943|CRISPRCasFinder 3984302-3984322 21 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 1345337-1345357 2 0.905
NC_012943_12 12.2|3984302|21|NC_012943|CRISPRCasFinder 3984302-3984322 21 MH153804 Rhodococcus phage Jace, complete genome 20827-20847 2 0.905
NC_012943_4 4.16|927203|24|NC_012943|CRT 927203-927226 24 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4024254-4024277 3 0.875
NC_012943_4 4.16|927203|24|NC_012943|CRT 927203-927226 24 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4460576-4460599 3 0.875
NC_012943_4 4.16|927203|24|NC_012943|CRT 927203-927226 24 NZ_CP034768 Enterobacter sp. N18-03635 plasmid pFRI-6, complete sequence 122201-122224 3 0.875
NC_012943_4 4.16|927203|24|NC_012943|CRT 927203-927226 24 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 37773-37796 3 0.875
NC_012943_4 4.16|927203|24|NC_012943|CRT 927203-927226 24 NZ_AP019631 Enterobacter asburiae strain 17Nkhm-UP2 plasmid pEAS17Nkhm-UP2-1, complete sequence 116652-116675 3 0.875
NC_012943_4 4.16|927203|24|NC_012943|CRT 927203-927226 24 NZ_AP019631 Enterobacter asburiae strain 17Nkhm-UP2 plasmid pEAS17Nkhm-UP2-1, complete sequence 72348-72371 3 0.875
NC_012943_4 4.16|927203|24|NC_012943|CRT 927203-927226 24 KU716094 Mycobacterium phage Eidsmoe, complete genome 5649-5672 3 0.875
NC_012943_4 4.16|927203|24|NC_012943|CRT 927203-927226 24 MH371122 Mycobacterium phage Priya, complete genome 5650-5673 3 0.875
NC_012943_4 4.16|927203|24|NC_012943|CRT 927203-927226 24 MK016502 Mycobacterium phage Pat3, complete genome 22827-22850 3 0.875
NC_012943_4 4.16|927203|24|NC_012943|CRT 927203-927226 24 MK937593 Mycobacterium phage Flypotenuse, complete genome 23717-23740 3 0.875
NC_012943_4 4.16|927203|24|NC_012943|CRT 927203-927226 24 MG872835 Mycobacterium phage Conquerage, complete genome 5649-5672 3 0.875
NC_012943_4 4.16|927203|24|NC_012943|CRT 927203-927226 24 MH536820 Mycobacterium phage Glexan, complete genome 23717-23740 3 0.875
NC_012943_4 4.16|927203|24|NC_012943|CRT 927203-927226 24 NC_010510 Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence 91001-91024 3 0.875
NC_012943_4 4.16|927203|24|NC_012943|CRT 927203-927226 24 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 44795-44818 3 0.875
NC_012943_4 4.16|927203|24|NC_012943|CRT 927203-927226 24 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1701753-1701776 3 0.875
NC_012943_4 4.16|927203|24|NC_012943|CRT 927203-927226 24 MH271298 Microbacterium phage Floof, complete genome 37939-37962 3 0.875
NC_012943_8 8.8|2360987|24|NC_012943|CRT 2360987-2361010 24 NZ_CP014599 Yangia sp. CCB-MM3 plasmid unnamed3, complete sequence 110878-110901 3 0.875
NC_012943_8 8.8|2360987|24|NC_012943|CRT 2360987-2361010 24 NZ_CP028945 Vibrio sp. dhg plasmid unnamed1, complete sequence 122425-122448 3 0.875
NC_012943_9 9.4|2780173|27|NC_012943|CRT 2780173-2780199 27 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 1634425-1634451 3 0.889
NC_012943_9 9.4|2780173|27|NC_012943|CRT 2780173-2780199 27 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 93210-93236 3 0.889
NC_012943_9 9.4|2780173|27|NC_012943|CRT 2780173-2780199 27 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 632350-632376 3 0.889
NC_012943_9 9.4|2780173|27|NC_012943|CRT 2780173-2780199 27 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 1031129-1031155 3 0.889
NC_012943_9 9.4|2780173|27|NC_012943|CRT 2780173-2780199 27 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 1500024-1500050 3 0.889
NC_012943_1 1.1|369353|27|NC_012943|CRISPRCasFinder 369353-369379 27 NC_023591 Mycobacterium phage Adler, complete genome 61249-61275 4 0.852
NC_012943_1 1.1|369353|27|NC_012943|CRISPRCasFinder 369353-369379 27 KF981876 UNVERIFIED: Mycobacterium phage ADLER F1725, complete genome 61247-61273 4 0.852
NC_012943_1 1.7|369749|27|NC_012943|CRISPRCasFinder 369749-369775 27 NZ_CP022363 Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence 10066-10092 4 0.852
NC_012943_1 1.10|369959|27|NC_012943|CRISPRCasFinder 369959-369985 27 NZ_CP030864 Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence 460464-460490 4 0.852
NC_012943_1 1.10|369959|27|NC_012943|CRISPRCasFinder 369959-369985 27 NC_016652 Rhodococcus phage REQ2, complete genome 36035-36061 4 0.852
NC_012943_2 2.2|631597|30|NC_012943|CRT 631597-631626 30 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 603744-603773 4 0.867
NC_012943_4 4.6|926762|27|NC_012943|CRT 926762-926788 27 NZ_CP010326 Pantoea sp. PSNIH1 plasmid pPSP-3a9, complete sequence 242875-242901 4 0.852
NC_012943_4 4.6|926762|27|NC_012943|CRT 926762-926788 27 NZ_CP021045 Phaeobacter gallaeciensis strain P129 plasmid pP129_e, complete sequence 30409-30435 4 0.852
NC_012943_4 4.6|926762|27|NC_012943|CRT 926762-926788 27 NZ_CP010678 Phaeobacter gallaeciensis strain P75 plasmid pP75_e, complete sequence 30478-30504 4 0.852
NC_012943_4 4.6|926762|27|NC_012943|CRT 926762-926788 27 NC_023142 Phaeobacter gallaeciensis DSM 26640 plasmid pGal_F69, complete sequence 30507-30533 4 0.852
NC_012943_4 4.6|926762|27|NC_012943|CRT 926762-926788 27 NZ_CP010789 Phaeobacter gallaeciensis strain P63 plasmid pP63_e, complete sequence 30472-30498 4 0.852
NC_012943_4 4.6|926762|27|NC_012943|CRT 926762-926788 27 NZ_CP010642 Phaeobacter gallaeciensis strain P73 plasmid pP73_f, complete sequence 30478-30504 4 0.852
NC_012943_4 4.6|926762|27|NC_012943|CRT 926762-926788 27 NZ_CP010593 Phaeobacter gallaeciensis strain P11 plasmid pP11_e, complete sequence 30504-30530 4 0.852
NC_012943_4 4.6|926762|27|NC_012943|CRT 926762-926788 27 AM419438 Archaeal BJ1 virus complete genome 36975-37001 4 0.852
NC_012943_4 4.6|926762|27|NC_012943|CRT 926762-926788 27 NC_008695 Archaeal BJ1 virus, complete genome 36975-37001 4 0.852
NC_012943_4 4.10|926918|27|NC_012943|CRT 926918-926944 27 KY945355 Mycobacterium phage Shandong1, complete genome 25634-25660 4 0.852
NC_012943_4 4.10|926918|27|NC_012943|CRT 926918-926944 27 NZ_CP015095 Pelagibaca abyssi strain JLT2014 plasmid pPABY4, complete sequence 106725-106751 4 0.852
NC_012943_4 4.10|926918|27|NC_012943|CRT 926918-926944 27 NC_041888 Mycobacterium phage Tortellini, complete genome 37216-37242 4 0.852
NC_012943_4 4.15|927155|30|NC_012943|CRT 927155-927184 30 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 1096460-1096489 4 0.867
NC_012943_4 4.16|927203|24|NC_012943|CRT 927203-927226 24 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 1898211-1898234 4 0.833
NC_012943_4 4.16|927203|24|NC_012943|CRT 927203-927226 24 NZ_CP025431 Paracoccus zhejiangensis strain J6 plasmid pPZ01, complete sequence 261506-261529 4 0.833
NC_012943_4 4.16|927203|24|NC_012943|CRT 927203-927226 24 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 673134-673157 4 0.833
NC_012943_4 4.16|927203|24|NC_012943|CRT 927203-927226 24 NZ_CP016822 Rhodococcus sp. p52 plasmid pDF03, complete sequence 60076-60099 4 0.833
NC_012943_4 4.16|927203|24|NC_012943|CRT 927203-927226 24 MN582086 Siphoviridae sp. ctdEk19, complete genome 33324-33347 4 0.833
NC_012943_4 4.16|927203|24|NC_012943|CRT 927203-927226 24 MF919502 Mycobacterium phage Demsculpinboyz, complete genome 21980-22003 4 0.833
NC_012943_4 4.16|927203|24|NC_012943|CRT 927203-927226 24 MT889380 Mycobacterium phage Coco12, complete genome 22623-22646 4 0.833
NC_012943_4 4.16|927203|24|NC_012943|CRT 927203-927226 24 NC_023698 Mycobacterium phage Avani, complete genome 21987-22010 4 0.833
NC_012943_4 4.16|927203|24|NC_012943|CRT 927203-927226 24 MT114167 Mycobacterium phage Phanphagia, complete genome 22278-22301 4 0.833
NC_012943_4 4.16|927203|24|NC_012943|CRT 927203-927226 24 NZ_CP050953 Rhodococcus sp. DMU1 plasmid unnamed 558871-558894 4 0.833
NC_012943_4 4.16|927203|24|NC_012943|CRT 927203-927226 24 NZ_CP015881 Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence 1500559-1500582 4 0.833
NC_012943_4 4.16|927203|24|NC_012943|CRT 927203-927226 24 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 295932-295955 4 0.833
NC_012943_4 4.16|927203|24|NC_012943|CRT 927203-927226 24 NC_015583 Novosphingobium sp. PP1Y plasmid Mpl, complete sequence 1116335-1116358 4 0.833
NC_012943_4 4.16|927203|24|NC_012943|CRT 927203-927226 24 MN096355 Mycobacterium phage Purky, complete genome 48975-48998 4 0.833
NC_012943_4 4.16|927203|24|NC_012943|CRT 927203-927226 24 MK279853 Gordonia phage Gray, complete genome 68404-68427 4 0.833
NC_012943_8 8.6|2360894|27|NC_012943|CRT 2360894-2360920 27 NZ_CP022566 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK02, complete sequence 524261-524287 4 0.852
NC_012943_9 9.1|2780038|27|NC_012943|CRT 2780038-2780064 27 NZ_CP045329 Labrenzia sp. THAF191b plasmid pTHAF191b_a, complete sequence 435563-435589 4 0.852
NC_012943_9 9.1|2780038|27|NC_012943|CRT 2780038-2780064 27 NZ_CP045345 Labrenzia sp. THAF187b plasmid pTHAF187b_a, complete sequence 508494-508520 4 0.852
NC_012943_9 9.1|2780038|27|NC_012943|CRT 2780038-2780064 27 NZ_CP045335 Labrenzia sp. THAF191a plasmid pTHAF191a_b, complete sequence 187743-187769 4 0.852
NC_012943_9 9.1|2780038|27|NC_012943|CRT 2780038-2780064 27 NZ_CP045381 Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence 402796-402822 4 0.852
NC_012943_9 9.1|2780038|27|NC_012943|CRT 2780038-2780064 27 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 1667642-1667668 4 0.852
NC_012943_9 9.1|2780038|27|NC_012943|CRT 2780038-2780064 27 NZ_CP019631 Labrenzia aggregata strain RMAR6-6 plasmid unnamed1, complete sequence 70684-70710 4 0.852
NC_012943_9 9.2|2780083|27|NC_012943|CRT 2780083-2780109 27 NZ_CP010408 Streptomyces vietnamensis strain GIMV4.0001 plasmid pSVL1, complete sequence 248256-248282 4 0.852
NC_012943_9 9.2|2780083|27|NC_012943|CRT 2780083-2780109 27 NZ_CP011665 Streptomyces sp. Mg1 plasmid pSMg1-1, complete sequence 451195-451221 4 0.852
NC_012943_9 9.2|2780083|27|NC_012943|CRT 2780083-2780109 27 NZ_CP020331 Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence 412934-412960 4 0.852
NC_012943_9 9.2|2780083|27|NC_012943|CRT 2780083-2780109 27 NZ_AP022338 Mameliella alba strain KU6B plasmid pKUB257, complete sequence 35645-35671 4 0.852
NC_012943_9 9.2|2780083|27|NC_012943|CRT 2780083-2780109 27 MH155876 Mycobacterium phage Priamo, complete genome 23761-23787 4 0.852
NC_012943_9 9.2|2780083|27|NC_012943|CRT 2780083-2780109 27 MN586039 Mycobacterium phage Blinn1, complete genome 23784-23810 4 0.852
NC_012943_9 9.2|2780083|27|NC_012943|CRT 2780083-2780109 27 NZ_LR134459 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence 83371-83397 4 0.852
NC_012943_9 9.2|2780083|27|NC_012943|CRT 2780083-2780109 27 NZ_CP024423 Paracoccus yeei strain TT13 plasmid pTT13-1, complete sequence 4940-4966 4 0.852
NC_012943_9 9.2|2780083|27|NC_012943|CRT 2780083-2780109 27 NZ_CP020441 Paracoccus yeei strain FDAARGOS_252 plasmid unnamed1, complete sequence 20275-20301 4 0.852
NC_012943_9 9.2|2780083|27|NC_012943|CRT 2780083-2780109 27 NZ_CP053345 Herbiconiux sp. SALV-R1 plasmid unnamed1, complete sequence 66075-66101 4 0.852
NC_012943_9 9.2|2780083|27|NC_012943|CRT 2780083-2780109 27 NC_006362 Nocardia farcinica IFM 10152 plasmid pNF1, complete sequence 141538-141564 4 0.852
NC_012943_9 9.4|2780173|27|NC_012943|CRT 2780173-2780199 27 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 712437-712463 4 0.852
NC_012943_9 9.4|2780173|27|NC_012943|CRT 2780173-2780199 27 NZ_CP046258 Gordonia sp. 135 plasmid pG135, complete sequence 119037-119063 4 0.852
NC_012943_9 9.4|2780173|27|NC_012943|CRT 2780173-2780199 27 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 1100693-1100719 4 0.852
NC_012943_9 9.4|2780173|27|NC_012943|CRT 2780173-2780199 27 NC_013859 Azospirillum sp. B510 plasmid pAB510e, complete sequence 525264-525290 4 0.852
NC_012943_9 9.4|2780173|27|NC_012943|CRT 2780173-2780199 27 NZ_CP021356 Rhodococcus sp. S2-17 plasmid pRB29, complete sequence 5370-5396 4 0.852
NC_012943_9 9.4|2780173|27|NC_012943|CRT 2780173-2780199 27 NZ_CP015739 Shinella sp. HZN7 plasmid pShin-03, complete sequence 50672-50698 4 0.852
NC_012943_9 9.4|2780173|27|NC_012943|CRT 2780173-2780199 27 NZ_CP030264 Ensifer adhaerens strain Corn53 plasmid AB, complete sequence 5180-5206 4 0.852
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 1163847-1163873 4 0.852
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 649691-649717 4 0.852
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP042572 Enterobacter hormaechei strain E5 plasmid pE5_001, complete sequence 164526-164552 4 0.852
NC_012943_1 1.1|369353|27|NC_012943|CRISPRCasFinder 369353-369379 27 LR794124 Vibrio phage vB_Vc_SrVc9 genome assembly, chromosome: 1 34861-34887 5 0.815
NC_012943_1 1.1|369353|27|NC_012943|CRISPRCasFinder 369353-369379 27 NC_012662 Vibrio phage VP93, complete genome 35301-35327 5 0.815
NC_012943_1 1.7|369749|27|NC_012943|CRISPRCasFinder 369749-369775 27 NZ_CP016084 Streptomyces sp. SAT1 plasmid unnamed4, complete sequence 2189-2215 5 0.815
NC_012943_1 1.7|369749|27|NC_012943|CRISPRCasFinder 369749-369775 27 MN693945 Marine virus AFVG_250M952, complete genome 34909-34935 5 0.815
NC_012943_1 1.10|369959|27|NC_012943|CRISPRCasFinder 369959-369985 27 NZ_CP020899 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence 369429-369455 5 0.815
NC_012943_1 1.10|369959|27|NC_012943|CRISPRCasFinder 369959-369985 27 NZ_CP013525 Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence 338832-338858 5 0.815
NC_012943_1 1.10|369959|27|NC_012943|CRISPRCasFinder 369959-369985 27 NZ_CP013554 Rhizobium phaseoli strain N931 plasmid pRphaN931b, complete sequence 363377-363403 5 0.815
NC_012943_1 1.10|369959|27|NC_012943|CRISPRCasFinder 369959-369985 27 NZ_CP015368 Methylobacterium phyllosphaerae strain CBMB27 plasmid CBMB27-p1, complete sequence 104717-104743 5 0.815
NC_012943_1 1.10|369959|27|NC_012943|CRISPRCasFinder 369959-369985 27 NZ_CP013588 Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence 338543-338569 5 0.815
NC_012943_1 1.10|369959|27|NC_012943|CRISPRCasFinder 369959-369985 27 NZ_CP013560 Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence 340811-340837 5 0.815
NC_012943_1 1.10|369959|27|NC_012943|CRISPRCasFinder 369959-369985 27 NZ_CP013577 Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence 342690-342716 5 0.815
NC_012943_1 1.10|369959|27|NC_012943|CRISPRCasFinder 369959-369985 27 NZ_CP013549 Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence 343060-343086 5 0.815
NC_012943_1 1.10|369959|27|NC_012943|CRISPRCasFinder 369959-369985 27 NZ_CP013529 Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence 355714-355740 5 0.815
NC_012943_1 1.10|369959|27|NC_012943|CRISPRCasFinder 369959-369985 27 NZ_CP013534 Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence 343060-343086 5 0.815
NC_012943_1 1.10|369959|27|NC_012943|CRISPRCasFinder 369959-369985 27 NZ_CP013539 Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence 348335-348361 5 0.815
NC_012943_1 1.10|369959|27|NC_012943|CRISPRCasFinder 369959-369985 27 NZ_CP013545 Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence 343052-343078 5 0.815
NC_012943_1 1.10|369959|27|NC_012943|CRISPRCasFinder 369959-369985 27 NZ_CP020444 Paracoccus yeei strain FDAARGOS_252 plasmid unnamed4, complete sequence 69464-69490 5 0.815
NC_012943_1 1.10|369959|27|NC_012943|CRISPRCasFinder 369959-369985 27 NZ_CP013565 Rhizobium phaseoli strain N831 plasmid pRphaN831b, complete sequence 363377-363403 5 0.815
NC_012943_1 1.10|369959|27|NC_012943|CRISPRCasFinder 369959-369985 27 NZ_CP013582 Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence 355714-355740 5 0.815
NC_012943_1 1.10|369959|27|NC_012943|CRISPRCasFinder 369959-369985 27 NZ_CP013571 Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence 342690-342716 5 0.815
NC_012943_1 1.10|369959|27|NC_012943|CRISPRCasFinder 369959-369985 27 NZ_CP044078 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed1, complete sequence 10340-10366 5 0.815
NC_012943_1 1.10|369959|27|NC_012943|CRISPRCasFinder 369959-369985 27 NZ_CP031081 Paracoccus yeei strain CCUG 32053 plasmid pYEE3, complete sequence 19365-19391 5 0.815
NC_012943_1 1.10|369959|27|NC_012943|CRISPRCasFinder 369959-369985 27 MN586031 Gordonia phage Gambino, complete genome 3053-3079 5 0.815
NC_012943_1 1.10|369959|27|NC_012943|CRISPRCasFinder 369959-369985 27 KU998236 Gordonia phage Blueberry, complete genome 3053-3079 5 0.815
NC_012943_1 1.10|369959|27|NC_012943|CRISPRCasFinder 369959-369985 27 MN062704 Gordonia phage JuJu, complete genome 3063-3089 5 0.815
NC_012943_1 1.10|369959|27|NC_012943|CRISPRCasFinder 369959-369985 27 MK501729 Gordonia phage Walrus, complete genome 3053-3079 5 0.815
NC_012943_1 1.10|369959|27|NC_012943|CRISPRCasFinder 369959-369985 27 NC_031226 Gordonia phage BaxterFox, complete genome 2982-3008 5 0.815
NC_012943_1 1.10|369959|27|NC_012943|CRISPRCasFinder 369959-369985 27 MK967393 Rhodococcus phage Whack, complete genome 3063-3089 5 0.815
NC_012943_1 1.10|369959|27|NC_012943|CRISPRCasFinder 369959-369985 27 MT723935 Gordonia phage Azula, complete genome 3053-3079 5 0.815
NC_012943_1 1.10|369959|27|NC_012943|CRISPRCasFinder 369959-369985 27 KU963249 Gordonia phage Yeezy, complete genome 2982-3008 5 0.815
NC_012943_1 1.10|369959|27|NC_012943|CRISPRCasFinder 369959-369985 27 MH153808 Gordonia phage Petra, complete genome 3053-3079 5 0.815
NC_012943_1 1.10|369959|27|NC_012943|CRISPRCasFinder 369959-369985 27 MT639650 Gordonia phage Ohgeesy, complete genome 2982-3008 5 0.815
NC_012943_1 1.10|369959|27|NC_012943|CRISPRCasFinder 369959-369985 27 MH536818 Gordonia phage Frokostdame, complete genome 3055-3081 5 0.815
NC_012943_1 1.10|369959|27|NC_012943|CRISPRCasFinder 369959-369985 27 KX557275 Gordonia phage CarolAnn, complete genome 3052-3078 5 0.815
NC_012943_4 4.6|926762|27|NC_012943|CRT 926762-926788 27 CP009871 Pantoea sp. PSNIH2 plasmid pPSP-cd6, complete sequence 29372-29398 5 0.815
NC_012943_4 4.6|926762|27|NC_012943|CRT 926762-926788 27 NZ_CP030354 Novosphingobium sp. P6W plasmid pP6W1, complete sequence 406756-406782 5 0.815
NC_012943_4 4.6|926762|27|NC_012943|CRT 926762-926788 27 NZ_CP045223 Achromobacter xylosoxidans strain DN002 plasmid unnamed 110954-110980 5 0.815
NC_012943_4 4.6|926762|27|NC_012943|CRT 926762-926788 27 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 274700-274726 5 0.815
NC_012943_4 4.6|926762|27|NC_012943|CRT 926762-926788 27 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 1370465-1370491 5 0.815
NC_012943_4 4.6|926762|27|NC_012943|CRT 926762-926788 27 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 761910-761936 5 0.815
NC_012943_4 4.6|926762|27|NC_012943|CRT 926762-926788 27 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1027970-1027996 5 0.815
NC_012943_4 4.10|926918|27|NC_012943|CRT 926918-926944 27 NZ_CP022264 Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plA, complete sequence 1800-1826 5 0.815
NC_012943_4 4.10|926918|27|NC_012943|CRT 926918-926944 27 NZ_CP022264 Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plA, complete sequence 136919-136945 5 0.815
NC_012943_4 4.10|926918|27|NC_012943|CRT 926918-926944 27 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 658056-658082 5 0.815
NC_012943_4 4.10|926918|27|NC_012943|CRT 926918-926944 27 NZ_CP015881 Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence 1514868-1514894 5 0.815
NC_012943_4 4.10|926918|27|NC_012943|CRT 926918-926944 27 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 5852040-5852066 5 0.815
NC_012943_4 4.10|926918|27|NC_012943|CRT 926918-926944 27 NZ_CP049908 Hymenobacter sp. HDW8 plasmid p_unnamed1, complete sequence 235006-235032 5 0.815
NC_012943_4 4.10|926918|27|NC_012943|CRT 926918-926944 27 NZ_CP049700 Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2a, complete sequence 263243-263269 5 0.815
NC_012943_4 4.10|926918|27|NC_012943|CRT 926918-926944 27 MH576962 Streptomyces phage Satis, complete genome 95306-95332 5 0.815
NC_012943_4 4.10|926918|27|NC_012943|CRT 926918-926944 27 MK620894 Streptomyces phage Kradal, complete genome 95310-95336 5 0.815
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 1068923-1068952 5 0.833
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP024314 Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence 1739900-1739929 5 0.833
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP013631 Rhizobium sp. N324 plasmid pRspN324a, complete sequence 233389-233418 5 0.833
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP031193 Humibacter sp. BT305 plasmid unnamed1 44938-44967 5 0.833
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP050092 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence 137673-137702 5 0.833
NC_012943_4 4.15|927155|30|NC_012943|CRT 927155-927184 30 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 984252-984281 5 0.833
NC_012943_4 4.15|927155|30|NC_012943|CRT 927155-927184 30 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 1598936-1598965 5 0.833
NC_012943_4 4.15|927155|30|NC_012943|CRT 927155-927184 30 NZ_CP013631 Rhizobium sp. N324 plasmid pRspN324a, complete sequence 233398-233427 5 0.833
NC_012943_4 4.15|927155|30|NC_012943|CRT 927155-927184 30 NZ_CP046705 Nostoc sp. ATCC 53789 plasmid pNsp_b, complete sequence 292905-292934 5 0.833
NC_012943_4 4.15|927155|30|NC_012943|CRT 927155-927184 30 AY950802 Haloarcula phage SH1, complete genome 16104-16133 5 0.833
NC_012943_4 4.16|927203|24|NC_012943|CRT 927203-927226 24 NC_006911 Streptomyces sp. F11 plasmid pFP11, complete sequence 11649-11672 5 0.792
NC_012943_8 8.6|2360894|27|NC_012943|CRT 2360894-2360920 27 NZ_CP048282 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248d, complete sequence 292199-292225 5 0.815
NC_012943_8 8.6|2360894|27|NC_012943|CRT 2360894-2360920 27 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 273510-273536 5 0.815
NC_012943_8 8.6|2360894|27|NC_012943|CRT 2360894-2360920 27 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 1214894-1214920 5 0.815
NC_012943_8 8.6|2360894|27|NC_012943|CRT 2360894-2360920 27 NZ_CP021355 Rhodococcus sp. S2-17 plasmid pRB98, complete sequence 759448-759474 5 0.815
NC_012943_8 8.7|2360939|30|NC_012943|CRT 2360939-2360968 30 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 1425504-1425533 5 0.833
NC_012943_8 8.7|2360939|30|NC_012943|CRT 2360939-2360968 30 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 1378155-1378184 5 0.833
NC_012943_9 9.1|2780038|27|NC_012943|CRT 2780038-2780064 27 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 2084834-2084860 5 0.815
NC_012943_9 9.1|2780038|27|NC_012943|CRT 2780038-2780064 27 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 1644177-1644203 5 0.815
NC_012943_9 9.1|2780038|27|NC_012943|CRT 2780038-2780064 27 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 650568-650594 5 0.815
NC_012943_9 9.1|2780038|27|NC_012943|CRT 2780038-2780064 27 NZ_AP022623 Mycobacteroides abscessus strain JCM 30620 plasmid pJCM30620_2 4050-4076 5 0.815
NC_012943_9 9.1|2780038|27|NC_012943|CRT 2780038-2780064 27 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 1727174-1727200 5 0.815
NC_012943_9 9.1|2780038|27|NC_012943|CRT 2780038-2780064 27 NZ_CP030127 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence 942011-942037 5 0.815
NC_012943_9 9.1|2780038|27|NC_012943|CRT 2780038-2780064 27 NC_021278 Mycobacteroides abscessus subsp. bolletii 50594 plasmid 1, complete sequence 155956-155982 5 0.815
NC_012943_9 9.2|2780083|27|NC_012943|CRT 2780083-2780109 27 NZ_CP020568 Kitasatospora aureofaciens strain DM-1 plasmid unnamed1, complete sequence 44599-44625 5 0.815
NC_012943_9 9.2|2780083|27|NC_012943|CRT 2780083-2780109 27 NZ_CP044283 Rhodococcus erythropolis strain X5 plasmid pRhX5, complete sequence 412999-413025 5 0.815
NC_012943_9 9.2|2780083|27|NC_012943|CRT 2780083-2780109 27 NZ_CP018229 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence 946410-946436 5 0.815
NC_012943_9 9.2|2780083|27|NC_012943|CRT 2780083-2780109 27 NZ_CP022999 Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence 1417137-1417163 5 0.815
NC_012943_9 9.2|2780083|27|NC_012943|CRT 2780083-2780109 27 NZ_CP019316 Tateyamaria omphalii strain DOK1-4 plasmid pDOK1-4-4, complete sequence 37037-37063 5 0.815
NC_012943_9 9.2|2780083|27|NC_012943|CRT 2780083-2780109 27 NZ_CP025513 Neorhizobium sp. SOG26 plasmid unnamed2, complete sequence 308034-308060 5 0.815
NC_012943_9 9.2|2780083|27|NC_012943|CRT 2780083-2780109 27 NC_048097 Arthrobacter phage Yang, complete genome 9617-9643 5 0.815
NC_012943_9 9.2|2780083|27|NC_012943|CRT 2780083-2780109 27 MH910037 Arthrobacter phage Isolde, complete genome 17208-17234 5 0.815
NC_012943_9 9.2|2780083|27|NC_012943|CRT 2780083-2780109 27 MN693489 Marine virus AFVG_25M400, complete genome 18248-18274 5 0.815
NC_012943_9 9.2|2780083|27|NC_012943|CRT 2780083-2780109 27 NZ_AP022607 Mycobacterium branderi strain JCM 12687 plasmid pJCM12687 776135-776161 5 0.815
NC_012943_9 9.2|2780083|27|NC_012943|CRT 2780083-2780109 27 NZ_CP012399 Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence 514954-514980 5 0.815
NC_012943_9 9.2|2780083|27|NC_012943|CRT 2780083-2780109 27 MN693270 Marine virus AFVG_25M401, complete genome 16061-16087 5 0.815
NC_012943_9 9.2|2780083|27|NC_012943|CRT 2780083-2780109 27 MN096376 Mycobacterium phage Lucyedi, complete genome 24676-24702 5 0.815
NC_012943_9 9.2|2780083|27|NC_012943|CRT 2780083-2780109 27 NC_023564 Mycobacterium phage EagleEye, complete genome 24676-24702 5 0.815
NC_012943_9 9.2|2780083|27|NC_012943|CRT 2780083-2780109 27 NZ_CP030864 Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence 295627-295653 5 0.815
NC_012943_9 9.2|2780083|27|NC_012943|CRT 2780083-2780109 27 NZ_CP024986 Streptomyces lavendulae subsp. lavendulae strain CCM 3239 plasmid pSA3239, complete sequence 203933-203959 5 0.815
NC_012943_9 9.2|2780083|27|NC_012943|CRT 2780083-2780109 27 NZ_CP038636 Cupriavidus oxalaticus strain X32 plasmid unnamed1, complete sequence 847804-847830 5 0.815
NC_012943_9 9.2|2780083|27|NC_012943|CRT 2780083-2780109 27 NZ_FO538766 Magnetospira sp. QH-2 plasmid MGMAQ_p, complete sequence 21533-21559 5 0.815
NC_012943_9 9.2|2780083|27|NC_012943|CRT 2780083-2780109 27 MN734439 Sphingomonas phage Kharn, complete genome 40095-40121 5 0.815
NC_012943_9 9.2|2780083|27|NC_012943|CRT 2780083-2780109 27 NC_024970 Streptomyces aureofaciens strain CCM3239 plasmid pSA3239, complete sequence 37123-37149 5 0.815
NC_012943_9 9.2|2780083|27|NC_012943|CRT 2780083-2780109 27 NZ_KJ396772 Streptomyces lavendulae subsp. lavendulae strain CCM3239 plasmid pSA3239, complete sequence 37123-37149 5 0.815
NC_012943_9 9.2|2780083|27|NC_012943|CRT 2780083-2780109 27 NC_015314 Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence 121230-121256 5 0.815
NC_012943_9 9.2|2780083|27|NC_012943|CRT 2780083-2780109 27 JN699011 Mycobacterium phage Stinger, complete genome 32280-32306 5 0.815
NC_012943_9 9.2|2780083|27|NC_012943|CRT 2780083-2780109 27 MN234184 Mycobacterium phage IdentityCrisis, complete genome 19769-19795 5 0.815
NC_012943_9 9.2|2780083|27|NC_012943|CRT 2780083-2780109 27 KR080200 Mycobacterium phage AlanGrant, complete genome 34424-34450 5 0.815
NC_012943_9 9.2|2780083|27|NC_012943|CRT 2780083-2780109 27 KR080194 Mycobacterium phage Vincenzo, complete genome 34424-34450 5 0.815
NC_012943_9 9.3|2780128|27|NC_012943|CRT 2780128-2780154 27 NZ_CP012185 Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence 614863-614889 5 0.815
NC_012943_9 9.3|2780128|27|NC_012943|CRT 2780128-2780154 27 NZ_CP030832 Neorhizobium sp. NCHU2750 plasmid pNCHU2750d, complete sequence 190341-190367 5 0.815
NC_012943_9 9.3|2780128|27|NC_012943|CRT 2780128-2780154 27 NZ_CP012182 Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence 433676-433702 5 0.815
NC_012943_9 9.4|2780173|27|NC_012943|CRT 2780173-2780199 27 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 544886-544912 5 0.815
NC_012943_9 9.4|2780173|27|NC_012943|CRT 2780173-2780199 27 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 719444-719470 5 0.815
NC_012943_9 9.4|2780173|27|NC_012943|CRT 2780173-2780199 27 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 1412931-1412957 5 0.815
NC_012943_9 9.4|2780173|27|NC_012943|CRT 2780173-2780199 27 NC_018583 Gordonia sp. KTR9 plasmid pGKT3, complete sequence 45628-45654 5 0.815
NC_012943_9 9.4|2780173|27|NC_012943|CRT 2780173-2780199 27 NC_012523 Rhodococcus opacus B4 plasmid pKNR, complete sequence 58180-58206 5 0.815
NC_012943_9 9.4|2780173|27|NC_012943|CRT 2780173-2780199 27 NC_011143 Phenylobacterium zucineum HLK1 plasmid, complete sequence 153039-153065 5 0.815
NC_012943_9 9.4|2780173|27|NC_012943|CRT 2780173-2780199 27 MK967392 Gordonia phage GrandSlam, complete genome 24284-24310 5 0.815
NC_012943_9 9.4|2780173|27|NC_012943|CRT 2780173-2780199 27 NZ_CP015867 Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence 108334-108360 5 0.815
NC_012943_9 9.4|2780173|27|NC_012943|CRT 2780173-2780199 27 NZ_CP022363 Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence 571073-571099 5 0.815
NC_012943_9 9.4|2780173|27|NC_012943|CRT 2780173-2780199 27 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 645790-645816 5 0.815
NC_012943_9 9.4|2780173|27|NC_012943|CRT 2780173-2780199 27 NZ_CP021082 Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence 615153-615179 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP017077 Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence 53066-53092 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NC_009479 Clavibacter michiganensis subsp. michiganensis NCPPB 382 plasmid pCM2, complete sequence 23720-23746 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 MF417867 Uncultured Caudovirales phage clone 3F_7, partial genome 15846-15872 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 64622-64648 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 544282-544308 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 557307-557333 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 1414393-1414419 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NC_009427 Novosphingobium aromaticivorans DSM 12444 plasmid pNL2, complete sequence 89457-89483 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 1518016-1518042 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 1153836-1153862 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 1359635-1359661 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP028348 Novosphingobium sp. THN1 plasmid pTHN, complete sequence 352793-352819 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 560419-560445 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP007130 Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence 1354-1380 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP007130 Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence 1039303-1039329 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 384990-385016 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP013631 Rhizobium sp. N324 plasmid pRspN324a, complete sequence 235671-235697 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 659595-659621 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 719680-719706 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 216796-216822 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 935312-935338 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 565411-565437 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 91197-91223 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 1647848-1647874 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 800976-801002 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 562872-562898 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 1617624-1617650 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP032520 Cupriavidus oxalaticus strain T2 plasmid unnamed1, complete sequence 103818-103844 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP029357 Azospirillum sp. CFH 70021 plasmid unnamed2 313646-313672 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NC_013858 Azospirillum sp. B510 plasmid pAB510d, complete sequence 547225-547251 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP022773 Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence 573141-573167 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 558820-558846 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 475767-475793 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 CP000662 Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence 477764-477790 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 557903-557929 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 578687-578713 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 1065447-1065473 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 509890-509916 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 481588-481614 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 561749-561775 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 1430625-1430651 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 562877-562903 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 578687-578713 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 621870-621896 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 566315-566341 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 578685-578711 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 555822-555848 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 621870-621896 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 566315-566341 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP054617 Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence 600065-600091 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 578687-578713 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 621870-621896 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 555850-555876 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 621874-621900 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 566315-566341 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 566315-566341 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 566315-566341 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 578687-578713 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 1296777-1296803 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 1536165-1536191 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 1650808-1650834 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 578687-578713 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 555850-555876 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 573124-573150 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 573076-573102 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 607530-607556 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 564889-564915 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 564826-564852 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 578687-578713 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 555850-555876 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 621870-621896 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 655087-655113 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 578684-578710 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 555850-555876 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 555850-555876 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 578687-578713 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 566317-566343 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 1507914-1507940 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 578687-578713 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 578687-578713 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 1507914-1507940 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 MK359341 Mycobacterium phage GingkoMaracino, complete genome 3247-3273 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 MH536825 Mycobacterium phage Ollie, complete genome 3247-3273 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 MG252615 Escherichia phage vB_EcoS_HSE2, complete genome 38017-38043 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NC_021535 Mycobacterium phage Jobu08, complete genome 3400-3426 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 MN062718 Mycobacterium phage SoilDragon, complete genome 3010-3036 5 0.815
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 KF279418 Mycobacterium phage Anubis, complete genome 3247-3273 5 0.815
NC_012943_10 10.7|3736956|31|NC_012943|CRT 3736956-3736986 31 NC_010850 Rhodococcus sp. NS1 plasmid pNSL1, complete sequence 92901-92931 5 0.839
NC_012943_1 1.1|369353|27|NC_012943|CRISPRCasFinder 369353-369379 27 NZ_CP045917 Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence 207335-207361 6 0.778
NC_012943_1 1.6|369683|33|NC_012943|CRISPRCasFinder 369683-369715 33 NZ_CP010410 Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence 435770-435802 6 0.818
NC_012943_1 1.7|369749|27|NC_012943|CRISPRCasFinder 369749-369775 27 NZ_CP022542 Antarctobacter heliothermus strain SMS3 plasmid pSMS3-2, complete sequence 32942-32968 6 0.778
NC_012943_1 1.9|369899|27|NC_012943|CRISPRCasFinder 369899-369925 27 NC_009959 Dinoroseobacter shibae DFL 12 = DSM 16493 plasmid pDSHI05, complete sequence 50750-50776 6 0.778
NC_012943_1 1.10|369959|27|NC_012943|CRISPRCasFinder 369959-369985 27 NZ_CP009112 Rhodococcus opacus strain 1CP plasmid pR1CP1, complete sequence 179708-179734 6 0.778
NC_012943_1 1.10|369959|27|NC_012943|CRISPRCasFinder 369959-369985 27 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4846911-4846937 6 0.778
NC_012943_1 1.10|369959|27|NC_012943|CRISPRCasFinder 369959-369985 27 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 78863-78889 6 0.778
NC_012943_1 1.10|369959|27|NC_012943|CRISPRCasFinder 369959-369985 27 MK494099 Mycobacterium phage Typha, complete genome 33831-33857 6 0.778
NC_012943_2 2.2|631597|30|NC_012943|CRT 631597-631626 30 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1565268-1565297 6 0.8
NC_012943_2 2.2|631597|30|NC_012943|CRT 631597-631626 30 KX620751 Propionibacterium phage Doucette, complete genome 8876-8905 6 0.8
NC_012943_2 2.2|631597|30|NC_012943|CRT 631597-631626 30 NC_041891 Propionibacterium phage B22, complete genome 8817-8846 6 0.8
NC_012943_2 2.2|631597|30|NC_012943|CRT 631597-631626 30 NC_041894 Propionibacterium phage E6, complete genome 8927-8956 6 0.8
NC_012943_2 2.2|631597|30|NC_012943|CRT 631597-631626 30 KX620754 Propionibacterium phage G4, complete genome 8865-8894 6 0.8
NC_012943_2 2.2|631597|30|NC_012943|CRT 631597-631626 30 NZ_CP030127 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence 575683-575712 6 0.8
NC_012943_2 2.2|631597|30|NC_012943|CRT 631597-631626 30 NC_020062 Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence 1829167-1829196 6 0.8
NC_012943_2 2.2|631597|30|NC_012943|CRT 631597-631626 30 MT818419 Mycobacterium phage Lolalove, complete genome 27446-27475 6 0.8
NC_012943_2 2.2|631597|30|NC_012943|CRT 631597-631626 30 MN428050 Mycobacterium phage Apex, complete genome 27615-27644 6 0.8
NC_012943_2 2.2|631597|30|NC_012943|CRT 631597-631626 30 MN234171 Mycobacterium phage Magpie, complete genome 27275-27304 6 0.8
NC_012943_2 2.2|631597|30|NC_012943|CRT 631597-631626 30 KX589269 Mycobacterium phage Fortunato, complete genome 27431-27460 6 0.8
NC_012943_2 2.2|631597|30|NC_012943|CRT 631597-631626 30 NC_042035 Mycobacterium phage Zemanar, complete sequence 27435-27464 6 0.8
NC_012943_2 2.2|631597|30|NC_012943|CRT 631597-631626 30 NC_022331 Mycobacterium phage Bane1, complete genome 27108-27137 6 0.8
NC_012943_2 2.2|631597|30|NC_012943|CRT 631597-631626 30 KF279413 Mycobacterium phage Bane2, complete genome 27087-27116 6 0.8
NC_012943_2 2.2|631597|30|NC_012943|CRT 631597-631626 30 MT310870 Mycobacterium phage RawrgerThat, complete genome 27434-27463 6 0.8
NC_012943_3 3.1|692300|31|NC_012943|CRISPRCasFinder 692300-692330 31 GQ141189 Bifidobacterium phage Bbif-1, complete sequence 38062-38092 6 0.806
NC_012943_4 4.6|926762|27|NC_012943|CRT 926762-926788 27 NZ_LN907829 Erwinia gerundensis isolate E_g_EM595 plasmid pEM02, complete sequence 65197-65223 6 0.778
NC_012943_4 4.6|926762|27|NC_012943|CRT 926762-926788 27 NZ_CP041653 Streptomyces sp. RLB1-9 plasmid pRLB1-9.1, complete sequence 99569-99595 6 0.778
NC_012943_4 4.6|926762|27|NC_012943|CRT 926762-926788 27 NZ_CP010826 Thermus aquaticus Y51MC23 plasmid pTA78, complete sequence 43689-43715 6 0.778
NC_012943_4 4.6|926762|27|NC_012943|CRT 926762-926788 27 NZ_CP054620 Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence 122394-122420 6 0.778
NC_012943_4 4.10|926918|27|NC_012943|CRT 926918-926944 27 NZ_AP021845 Azospira sp. I09 plasmid pAZI09, complete sequence 147990-148016 6 0.778
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP040820 Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence 508-537 6 0.8
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP040820 Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence 280809-280838 6 0.8
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 561652-561681 6 0.8
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP050083 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence 554428-554457 6 0.8
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP049733 Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence 542116-542145 6 0.8
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 610786-610815 6 0.8
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP053207 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence 571170-571199 6 0.8
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP015881 Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence 1563589-1563618 6 0.8
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP030127 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence 421135-421164 6 0.8
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 1217050-1217079 6 0.8
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 1265979-1266008 6 0.8
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 1135414-1135443 6 0.8
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP037868 Hydrogenophaga pseudoflava strain DSM 1084 plasmid pDSM1084, complete sequence 5790-5819 6 0.8
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 1195134-1195163 6 0.8
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 1134511-1134540 6 0.8
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP023549 Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence 762260-762289 6 0.8
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 1168711-1168740 6 0.8
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 1168700-1168729 6 0.8
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 1135406-1135435 6 0.8
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 1134762-1134791 6 0.8
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 1135397-1135426 6 0.8
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 1217165-1217194 6 0.8
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 1217149-1217178 6 0.8
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 1217142-1217171 6 0.8
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NC_019408 Caulobacter phage CcrRogue, complete genome 180466-180495 6 0.8
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 174181-174210 6 0.8
NC_012943_4 4.15|927155|30|NC_012943|CRT 927155-927184 30 NZ_CP017941 Phyllobacterium zundukense strain Tri-48 plasmid unnamed1, complete sequence 270228-270257 6 0.8
NC_012943_4 4.15|927155|30|NC_012943|CRT 927155-927184 30 MK937608 Microbacterium phage Cressida, complete genome 54022-54051 6 0.8
NC_012943_4 4.15|927155|30|NC_012943|CRT 927155-927184 30 NZ_CP050083 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence 554437-554466 6 0.8
NC_012943_4 4.15|927155|30|NC_012943|CRT 927155-927184 30 NZ_CP049733 Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence 542125-542154 6 0.8
NC_012943_4 4.15|927155|30|NC_012943|CRT 927155-927184 30 NZ_CP017592 Pantoea stewartii subsp. stewartii DC283 plasmid ppDSJ01, complete sequence 7337-7366 6 0.8
NC_012943_4 4.15|927155|30|NC_012943|CRT 927155-927184 30 NZ_CP008898 Enterobacter hormaechei subsp. hoffmannii ECNIH3 plasmid pENT-576, complete sequence 43955-43984 6 0.8
NC_012943_4 4.15|927155|30|NC_012943|CRT 927155-927184 30 NZ_CP023489 Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_02, complete sequence 73653-73682 6 0.8
NC_012943_4 4.15|927155|30|NC_012943|CRT 927155-927184 30 NZ_CP043515 Enterobacter kobei strain EB_P8_L5_01.19 plasmid unnamed4, complete sequence 36331-36360 6 0.8
NC_012943_4 4.15|927155|30|NC_012943|CRT 927155-927184 30 NZ_CP053207 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence 571179-571208 6 0.8
NC_012943_4 4.15|927155|30|NC_012943|CRT 927155-927184 30 NZ_LT984809 Cupriavidus taiwanensis isolate Cupriavidus taiwanensis STM 8555 plasmid I, complete sequence 317155-317184 6 0.8
NC_012943_4 4.15|927155|30|NC_012943|CRT 927155-927184 30 NZ_CP026371 Klebsiella quasipneumoniae strain A708 plasmid pA708-3, complete sequence 116386-116415 6 0.8
NC_012943_4 4.15|927155|30|NC_012943|CRT 927155-927184 30 NZ_CP050069 Klebsiella aerogenes strain 035 plasmid p035_A-VIM-1, complete sequence 79588-79617 6 0.8
NC_012943_4 4.15|927155|30|NC_012943|CRT 927155-927184 30 NZ_CP039425 Citricoccus sp. SGAir0253 plasmid unnamed1, complete sequence 132572-132601 6 0.8
NC_012943_4 4.15|927155|30|NC_012943|CRT 927155-927184 30 NZ_CP009856 UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH5 plasmid pENT-784, complete sequence 26128-26157 6 0.8
NC_012943_4 4.15|927155|30|NC_012943|CRT 927155-927184 30 NZ_CP039430 Citricoccus sp. SGAir0453 plasmid unnamed1, complete sequence 132570-132599 6 0.8
NC_012943_4 4.15|927155|30|NC_012943|CRT 927155-927184 30 NZ_CP040937 Hymenobacter sp. DG01 plasmid unnamed, complete sequence 32030-32059 6 0.8
NC_012943_4 4.15|927155|30|NC_012943|CRT 927155-927184 30 NZ_CP024310 Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence 14031-14060 6 0.8
NC_012943_4 4.15|927155|30|NC_012943|CRT 927155-927184 30 NZ_CP023064 Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence 17715-17744 6 0.8
NC_012943_4 4.15|927155|30|NC_012943|CRT 927155-927184 30 NZ_CP006588 Hymenobacter sp. APR13 plasmid pHA, complete sequence 19031-19060 6 0.8
NC_012943_4 4.15|927155|30|NC_012943|CRT 927155-927184 30 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1930897-1930926 6 0.8
NC_012943_4 4.15|927155|30|NC_012943|CRT 927155-927184 30 NZ_AP022333 Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence 190353-190382 6 0.8
NC_012943_4 4.15|927155|30|NC_012943|CRT 927155-927184 30 MH029534 Myoviridae environmental samples clone NHS-Seq2, complete sequence 34123-34152 6 0.8
NC_012943_4 4.17|927245|36|NC_012943|CRT 927245-927280 36 MT723940 Mycobacterium phage Ellie, complete genome 24126-24161 6 0.833
NC_012943_8 8.6|2360894|27|NC_012943|CRT 2360894-2360920 27 NZ_AP022566 Mycolicibacterium alvei strain JCM 12272 plasmid pJCM12272, complete sequence 1478-1504 6 0.778
NC_012943_8 8.6|2360894|27|NC_012943|CRT 2360894-2360920 27 NZ_AP014706 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_2p, complete sequence 94030-94056 6 0.778
NC_012943_8 8.7|2360939|30|NC_012943|CRT 2360939-2360968 30 NZ_CP021082 Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence 262130-262159 6 0.8
NC_012943_8 8.7|2360939|30|NC_012943|CRT 2360939-2360968 30 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 1624787-1624816 6 0.8
NC_012943_8 8.7|2360939|30|NC_012943|CRT 2360939-2360968 30 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 1624922-1624951 6 0.8
NC_012943_9 9.1|2780038|27|NC_012943|CRT 2780038-2780064 27 NZ_LR594691 Variovorax sp. WDL1 plasmid 3 515294-515320 6 0.778
NC_012943_9 9.1|2780038|27|NC_012943|CRT 2780038-2780064 27 NZ_CP024310 Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence 618909-618935 6 0.778
NC_012943_9 9.1|2780038|27|NC_012943|CRT 2780038-2780064 27 NZ_CP034811 Paracoccus sp. Arc7-R13 plasmid unnamed1, complete sequence 147528-147554 6 0.778
NC_012943_9 9.1|2780038|27|NC_012943|CRT 2780038-2780064 27 NZ_CP054617 Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence 147701-147727 6 0.778
NC_012943_9 9.1|2780038|27|NC_012943|CRT 2780038-2780064 27 NZ_CP016452 Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence 1028358-1028384 6 0.778
NC_012943_9 9.2|2780083|27|NC_012943|CRT 2780083-2780109 27 NZ_CP011274 Planctomyces sp. SH-PL62 plasmid pPL62-1, complete sequence 91913-91939 6 0.778
NC_012943_9 9.2|2780083|27|NC_012943|CRT 2780083-2780109 27 NZ_CP032676 Rhodococcus rhodochrous strain ATCC BAA870 plasmid pNit, complete sequence 231328-231354 6 0.778
NC_012943_9 9.2|2780083|27|NC_012943|CRT 2780083-2780109 27 NZ_AP022580 Mycolicibacterium boenickei strain JCM 15653 plasmid pJCM15653, complete sequence 21442-21468 6 0.778
NC_012943_9 9.2|2780083|27|NC_012943|CRT 2780083-2780109 27 NZ_CP038238 Leisingera sp. NJS201 plasmid unnamed4, complete sequence 43056-43082 6 0.778
NC_012943_9 9.2|2780083|27|NC_012943|CRT 2780083-2780109 27 NZ_CP033823 Klebsiella sp. FDAARGOS_511 plasmid unnamed1, complete sequence 105524-105550 6 0.778
NC_012943_9 9.2|2780083|27|NC_012943|CRT 2780083-2780109 27 NC_023285 Streptomyces sp. F8 plasmid pFRL5, complete sequence 9721-9747 6 0.778
NC_012943_9 9.2|2780083|27|NC_012943|CRT 2780083-2780109 27 NZ_CP011633 Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-150, complete sequence 10964-10990 6 0.778
NC_012943_9 9.2|2780083|27|NC_012943|CRT 2780083-2780109 27 NZ_CP009030 Xanthomonas citri pv. citri strain AW13 plasmid pXCAW58, complete sequence 45466-45492 6 0.778
NC_012943_9 9.2|2780083|27|NC_012943|CRT 2780083-2780109 27 NZ_CP009039 Xanthomonas citri pv. citri strain AW16 plasmid pXCAW58, complete sequence 45466-45492 6 0.778
NC_012943_9 9.2|2780083|27|NC_012943|CRT 2780083-2780109 27 NZ_CP032053 Streptomyces clavuligerus strain F1D-5 plasmid pSCL2, complete sequence 32539-32565 6 0.778
NC_012943_9 9.2|2780083|27|NC_012943|CRT 2780083-2780109 27 NZ_CP025552 Streptomyces rimosus strain WT5260 plasmid unnamed, complete sequence 55799-55825 6 0.778
NC_012943_9 9.2|2780083|27|NC_012943|CRT 2780083-2780109 27 NC_009620 Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence 1134631-1134657 6 0.778
NC_012943_9 9.3|2780128|27|NC_012943|CRT 2780128-2780154 27 NZ_CP029357 Azospirillum sp. CFH 70021 plasmid unnamed2 85851-85877 6 0.778
NC_012943_9 9.4|2780173|27|NC_012943|CRT 2780173-2780199 27 NZ_CP014514 Frondihabitans sp. PAMC 28766 strain SR6 plasmid 1, complete sequence 6679-6705 6 0.778
NC_012943_9 9.4|2780173|27|NC_012943|CRT 2780173-2780199 27 NZ_CP023524 Burkholderia gladioli pv. gladioli strain FDAARGOS_389 plasmid unnamed, complete sequence 100885-100911 6 0.778
NC_012943_9 9.4|2780173|27|NC_012943|CRT 2780173-2780199 27 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 602593-602619 6 0.778
NC_012943_9 9.4|2780173|27|NC_012943|CRT 2780173-2780199 27 NZ_CP015095 Pelagibaca abyssi strain JLT2014 plasmid pPABY4, complete sequence 35341-35367 6 0.778
NC_012943_9 9.4|2780173|27|NC_012943|CRT 2780173-2780199 27 NZ_CP054842 Acidovorax sp. 16-35-5 plasmid unnamed2, complete sequence 100776-100802 6 0.778
NC_012943_9 9.4|2780173|27|NC_012943|CRT 2780173-2780199 27 NZ_CP023152 Mycobacterium chimaera strain FLAC0070 plasmid pFLAC0070_1, complete sequence 164457-164483 6 0.778
NC_012943_9 9.4|2780173|27|NC_012943|CRT 2780173-2780199 27 NZ_AP022607 Mycobacterium branderi strain JCM 12687 plasmid pJCM12687 686592-686618 6 0.778
NC_012943_9 9.4|2780173|27|NC_012943|CRT 2780173-2780199 27 NZ_CP046573 Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence 468876-468902 6 0.778
NC_012943_9 9.4|2780173|27|NC_012943|CRT 2780173-2780199 27 MH697582 Mycobacterium phage Ejimix, complete genome 58621-58647 6 0.778
NC_012943_9 9.4|2780173|27|NC_012943|CRT 2780173-2780199 27 MK967402 Mycobacterium phage NihilNomen, complete genome 58981-59007 6 0.778
NC_012943_9 9.4|2780173|27|NC_012943|CRT 2780173-2780199 27 MN586029 Mycobacterium phage Hannaconda, complete genome 51837-51863 6 0.778
NC_012943_9 9.4|2780173|27|NC_012943|CRT 2780173-2780199 27 MH697583 Mycobacterium phage EricMillard, complete genome 57962-57988 6 0.778
NC_012943_9 9.4|2780173|27|NC_012943|CRT 2780173-2780199 27 MH727551 Mycobacterium phage Kalah2, complete genome 58188-58214 6 0.778
NC_012943_9 9.4|2780173|27|NC_012943|CRT 2780173-2780199 27 MF919504 Mycobacterium phage DmpstrDiver, complete genome 58327-58353 6 0.778
NC_012943_9 9.4|2780173|27|NC_012943|CRT 2780173-2780199 27 MH399772 Mycobacterium phage Constella, complete genome 53063-53089 6 0.778
NC_012943_9 9.4|2780173|27|NC_012943|CRT 2780173-2780199 27 MH077579 Mycobacterium phage Halley, complete genome 58895-58921 6 0.778
NC_012943_9 9.4|2780173|27|NC_012943|CRT 2780173-2780199 27 JF937090 Mycobacterium virus BAKA, complete genome 59167-59193 6 0.778
NC_012943_9 9.4|2780173|27|NC_012943|CRT 2780173-2780199 27 MH669017 Mycobacterium phage Zelink, complete genome 59367-59393 6 0.778
NC_012943_9 9.4|2780173|27|NC_012943|CRT 2780173-2780199 27 MK524521 Mycobacterium phage Schatzie, complete genome 57771-57797 6 0.778
NC_012943_9 9.4|2780173|27|NC_012943|CRT 2780173-2780199 27 NC_004688 Mycobacterium phage Omega, complete genome 58734-58760 6 0.778
NC_012943_9 9.4|2780173|27|NC_012943|CRT 2780173-2780199 27 MF133445 Mycobacterium phage Lucky2013, complete genome 53281-53307 6 0.778
NC_012943_9 9.4|2780173|27|NC_012943|CRT 2780173-2780199 27 MK524516 Mycobacterium phage Bobby, complete genome 57260-57286 6 0.778
NC_012943_9 9.4|2780173|27|NC_012943|CRT 2780173-2780199 27 MF072690 Mycobacterium phage Porcelain, complete genome 53937-53963 6 0.778
NC_012943_9 9.4|2780173|27|NC_012943|CRT 2780173-2780199 27 MN062701 Mycobacterium phage Dallas, complete genome 58902-58928 6 0.778
NC_012943_9 9.4|2780173|27|NC_012943|CRT 2780173-2780199 27 AY129338 Mycobacterium virus Omega, complete genome 58734-58760 6 0.778
NC_012943_9 9.4|2780173|27|NC_012943|CRT 2780173-2780199 27 NC_041844 Mycobacterium phage Optimus, complete genome 57516-57542 6 0.778
NC_012943_9 9.4|2780173|27|NC_012943|CRT 2780173-2780199 27 MK524527 Mycobacterium phage ThreeRngTarjay, complete genome 59056-59082 6 0.778
NC_012943_9 9.4|2780173|27|NC_012943|CRT 2780173-2780199 27 MK279849 Mycobacterium phage Duke13, complete genome 56834-56860 6 0.778
NC_012943_9 9.4|2780173|27|NC_012943|CRT 2780173-2780199 27 JF937101 Mycobacterium virus LittleE, complete genome 56961-56987 6 0.778
NC_012943_9 9.4|2780173|27|NC_012943|CRT 2780173-2780199 27 MN183286 Mycobacteriophage Yeet, complete genome 57273-57299 6 0.778
NC_012943_9 9.4|2780173|27|NC_012943|CRT 2780173-2780199 27 MK524529 Mycobacterium phage Phoebus, complete genome 60164-60190 6 0.778
NC_012943_9 9.4|2780173|27|NC_012943|CRT 2780173-2780199 27 KM400683 Mycobacterium phage Ariel, complete genome 53265-53291 6 0.778
NC_012943_9 9.4|2780173|27|NC_012943|CRT 2780173-2780199 27 JN201525 Mycobacterium phage Thibault, complete genome 53680-53706 6 0.778
NC_012943_9 9.4|2780173|27|NC_012943|CRT 2780173-2780199 27 MF919512 Mycobacterium phage Klein, complete genome 57895-57921 6 0.778
NC_012943_9 9.4|2780173|27|NC_012943|CRT 2780173-2780199 27 MF919534 Mycobacterium phage Superphikiman, complete genome 53147-53173 6 0.778
NC_012943_9 9.4|2780173|27|NC_012943|CRT 2780173-2780199 27 NC_023690 Mycobacterium phage Courthouse, complete genome 52865-52891 6 0.778
NC_012943_9 9.4|2780173|27|NC_012943|CRT 2780173-2780199 27 KF114875 Mycobacterium phage Redno2, complete genome 54715-54741 6 0.778
NC_012943_9 9.4|2780173|27|NC_012943|CRT 2780173-2780199 27 NC_022067 Mycobacterium phage Wanda, complete genome 58173-58199 6 0.778
NC_012943_9 9.4|2780173|27|NC_012943|CRT 2780173-2780199 27 MK524504 Mycobacterium phage Hughesyang, complete genome 58853-58879 6 0.778
NC_012943_9 9.4|2780173|27|NC_012943|CRT 2780173-2780199 27 MK967379 Mycobacterium phage HokkenD, complete genome 57164-57190 6 0.778
NC_012943_9 9.4|2780173|27|NC_012943|CRT 2780173-2780199 27 NC_028953 Mycobacterium phage MiaZeal, complete genome 53937-53963 6 0.778
NC_012943_9 9.4|2780173|27|NC_012943|CRT 2780173-2780199 27 MF668284 Mycobacterium phage Squint, complete genome 54056-54082 6 0.778
NC_012943_9 9.4|2780173|27|NC_012943|CRT 2780173-2780199 27 NC_023285 Streptomyces sp. F8 plasmid pFRL5, complete sequence 304743-304769 6 0.778
NC_012943_9 9.13|2780767|30|NC_012943|CRT 2780767-2780796 30 KF692088 Arthrobacter phage vB_ArS-ArV2, complete genome 13409-13438 6 0.8
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP050092 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence 238324-238350 6 0.778
NC_012943_10 10.7|3736956|31|NC_012943|CRT 3736956-3736986 31 NC_009478 Clavibacter michiganensis subsp. michiganensis NCPPB 382 plasmid pCM1, complete sequence 8328-8358 6 0.806
NC_012943_1 1.4|369548|27|NC_012943|CRISPRCasFinder 369548-369574 27 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 48081-48107 7 0.741
NC_012943_2 2.2|631597|30|NC_012943|CRT 631597-631626 30 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 2600082-2600111 7 0.767
NC_012943_2 2.2|631597|30|NC_012943|CRT 631597-631626 30 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 2593965-2593994 7 0.767
NC_012943_2 2.2|631597|30|NC_012943|CRT 631597-631626 30 LR134127 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7 110413-110442 7 0.767
NC_012943_2 2.2|631597|30|NC_012943|CRT 631597-631626 30 NC_005241 Cupriavidus necator H16 megaplasmid pHG1, complete sequence 444400-444429 7 0.767
NC_012943_2 2.2|631597|30|NC_012943|CRT 631597-631626 30 NZ_CP012477 Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence 741115-741144 7 0.767
NC_012943_2 2.2|631597|30|NC_012943|CRT 631597-631626 30 NZ_CP012478 Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed1, complete sequence 144936-144965 7 0.767
NC_012943_2 2.2|631597|30|NC_012943|CRT 631597-631626 30 NZ_CP039289 Cupriavidus necator H16 plasmid pHG1, complete sequence 444383-444412 7 0.767
NC_012943_2 2.2|631597|30|NC_012943|CRT 631597-631626 30 NZ_CP014600 Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence 66483-66512 7 0.767
NC_012943_2 2.2|631597|30|NC_012943|CRT 631597-631626 30 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 320484-320513 7 0.767
NC_012943_2 2.2|631597|30|NC_012943|CRT 631597-631626 30 NC_042034 Mycobacterium phage ChrisnMich, complete sequence 26400-26429 7 0.767
NC_012943_3 3.1|692300|31|NC_012943|CRISPRCasFinder 692300-692330 31 MK977708 Mycobacterium phage Fulbright, complete genome 10281-10311 7 0.774
NC_012943_3 3.1|692300|31|NC_012943|CRISPRCasFinder 692300-692330 31 MG099948 Mycobacterium phage Philonius, complete genome 10281-10311 7 0.774
NC_012943_3 3.1|692300|31|NC_012943|CRISPRCasFinder 692300-692330 31 MH926055 Mycobacterium phage Chewbacca, complete genome 10281-10311 7 0.774
NC_012943_3 3.1|692300|31|NC_012943|CRISPRCasFinder 692300-692330 31 MT723932 Mycobacterium phage Schnauzer, complete genome 10281-10311 7 0.774
NC_012943_3 3.1|692300|31|NC_012943|CRISPRCasFinder 692300-692330 31 KU935726 Mycobacterium phage Xerxes, complete genome 10281-10311 7 0.774
NC_012943_3 3.1|692300|31|NC_012943|CRISPRCasFinder 692300-692330 31 KU935730 Mycobacterium phage Pipsqueaks, complete genome 10281-10311 7 0.774
NC_012943_3 3.1|692300|31|NC_012943|CRISPRCasFinder 692300-692330 31 MH316570 Mycobacterium phage Silvafighter, complete genome 10281-10311 7 0.774
NC_012943_3 3.1|692300|31|NC_012943|CRISPRCasFinder 692300-692330 31 MK524518 Mycobacterium phage Smurph, complete genome 10281-10311 7 0.774
NC_012943_3 3.1|692300|31|NC_012943|CRISPRCasFinder 692300-692330 31 MK524515 Mycobacterium phage Parmesanjohn, complete genome 10281-10311 7 0.774
NC_012943_3 3.1|692300|31|NC_012943|CRISPRCasFinder 692300-692330 31 MH697585 Mycobacterium phage Gex, complete genome 10280-10310 7 0.774
NC_012943_3 3.1|692300|31|NC_012943|CRISPRCasFinder 692300-692330 31 KM588359 Mycobacterium phage Carcharodon, complete genome 10281-10311 7 0.774
NC_012943_3 3.1|692300|31|NC_012943|CRISPRCasFinder 692300-692330 31 MH697576 Mycobacterium phage Aggie, complete genome 10282-10312 7 0.774
NC_012943_3 3.1|692300|31|NC_012943|CRISPRCasFinder 692300-692330 31 MH697593 Mycobacterium phage Tapioca, complete genome 10281-10311 7 0.774
NC_012943_3 3.1|692300|31|NC_012943|CRISPRCasFinder 692300-692330 31 MG099936 Mycobacterium phage Andies, complete genome 10281-10311 7 0.774
NC_012943_3 3.1|692300|31|NC_012943|CRISPRCasFinder 692300-692330 31 NC_031243 Mycobacterium phage Xeno, complete genome 10281-10311 7 0.774
NC_012943_3 3.1|692300|31|NC_012943|CRISPRCasFinder 692300-692330 31 JN256079 Mycobacterium phage Charlie, complete genome 10281-10311 7 0.774
NC_012943_4 4.6|926762|27|NC_012943|CRT 926762-926788 27 NZ_CP010614 Phaeobacter inhibens strain P92 plasmid pP92_d, complete sequence 8847-8873 7 0.741
NC_012943_4 4.6|926762|27|NC_012943|CRT 926762-926788 27 NZ_CP010626 Phaeobacter inhibens strain P51 plasmid pP51_c, complete sequence 8847-8873 7 0.741
NC_012943_4 4.6|926762|27|NC_012943|CRT 926762-926788 27 NZ_CP010671 Phaeobacter inhibens strain P57 plasmid pP57_c, complete sequence 8847-8873 7 0.741
NC_012943_4 4.6|926762|27|NC_012943|CRT 926762-926788 27 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 191833-191859 7 0.741
NC_012943_4 4.6|926762|27|NC_012943|CRT 926762-926788 27 NZ_CP010598 Phaeobacter inhibens strain P10 plasmid pP10_c, complete sequence 8865-8891 7 0.741
NC_012943_4 4.6|926762|27|NC_012943|CRT 926762-926788 27 NC_018288 Phaeobacter inhibens DSM 17395 plasmid pPGA1_65, complete sequence 57481-57507 7 0.741
NC_012943_4 4.6|926762|27|NC_012943|CRT 926762-926788 27 NZ_CP031955 Phaeobacter inhibens strain 2.10 plasmid unnamed3, complete sequence 62982-63008 7 0.741
NC_012943_4 4.6|926762|27|NC_012943|CRT 926762-926788 27 NZ_CP016368 Phaeobacter porticola strain P97 plasmid pP97_d, complete sequence 8876-8902 7 0.741
NC_012943_4 4.6|926762|27|NC_012943|CRT 926762-926788 27 NC_018422 Phaeobacter inhibens 2.10 plasmid pPGA2_71, complete sequence 62746-62772 7 0.741
NC_012943_4 4.6|926762|27|NC_012943|CRT 926762-926788 27 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 195710-195736 7 0.741
NC_012943_4 4.6|926762|27|NC_012943|CRT 926762-926788 27 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 195702-195728 7 0.741
NC_012943_4 4.6|926762|27|NC_012943|CRT 926762-926788 27 NZ_CP010605 Phaeobacter inhibens strain P83 plasmid pP83_f, complete sequence 8848-8874 7 0.741
NC_012943_4 4.6|926762|27|NC_012943|CRT 926762-926788 27 NZ_CP010744 Phaeobacter inhibens strain P59 plasmid pP59_c, complete sequence 8847-8873 7 0.741
NC_012943_4 4.6|926762|27|NC_012943|CRT 926762-926788 27 NZ_CP010622 Phaeobacter inhibens strain P30 isolate M4-3.1A plasmid pP30_e, complete sequence 8847-8873 7 0.741
NC_012943_4 4.6|926762|27|NC_012943|CRT 926762-926788 27 NZ_CP010732 Phaeobacter inhibens strain P88 plasmid pP88_g, complete sequence 8836-8862 7 0.741
NC_012943_4 4.6|926762|27|NC_012943|CRT 926762-926788 27 NZ_CP010655 Phaeobacter inhibens strain P54 plasmid pP54_e, complete sequence 8835-8861 7 0.741
NC_012943_4 4.6|926762|27|NC_012943|CRT 926762-926788 27 NZ_CP010711 Phaeobacter inhibens strain P66 plasmid pP66_f, complete sequence 8848-8874 7 0.741
NC_012943_4 4.6|926762|27|NC_012943|CRT 926762-926788 27 NZ_CP010702 Phaeobacter inhibens strain P24 plasmid pP24_f, complete sequence 8847-8873 7 0.741
NC_012943_4 4.6|926762|27|NC_012943|CRT 926762-926788 27 NZ_CP010748 Phaeobacter inhibens strain P48 isolate M21-2.3 plasmid pP48_c, complete sequence 8847-8873 7 0.741
NC_012943_4 4.6|926762|27|NC_012943|CRT 926762-926788 27 NZ_CP010739 Phaeobacter inhibens strain P72 plasmid pP72_d, complete sequence 8824-8850 7 0.741
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NC_012811 Methylorubrum extorquens AM1 megaplasmid, complete sequence 943873-943902 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 392100-392129 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 1838430-1838459 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 616186-616215 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 397449-397478 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 1703655-1703684 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP022363 Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence 212329-212358 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 679499-679528 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 1744018-1744047 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 1760732-1760761 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 178925-178954 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 75369-75398 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 153012-153041 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NC_013856 Azospirillum sp. B510 plasmid pAB510b, complete sequence 589998-590027 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP010410 Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence 81538-81567 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 845884-845913 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 258296-258325 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 1723933-1723962 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 1859622-1859651 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 1841724-1841753 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 1841724-1841753 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 137321-137350 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 258496-258525 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 257917-257946 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 234345-234374 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 461507-461536 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 254201-254230 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 236985-237014 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 298368-298397 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 258487-258516 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 461579-461608 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 390422-390451 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 1964821-1964850 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 461516-461545 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 237930-237959 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 849014-849043 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 1227007-1227036 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 238244-238273 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP022773 Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence 245279-245308 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 235437-235466 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 126762-126791 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 234570-234599 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 251053-251082 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 258309-258338 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 231309-231338 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 235690-235719 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 238261-238290 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 251053-251082 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 252665-252694 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 236955-236984 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 251052-251081 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 298440-298469 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 230351-230380 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 252665-252694 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 236955-236984 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 461938-461967 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 251053-251082 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 252665-252694 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 CP047137 Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence 438995-439024 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 230352-230381 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 252665-252694 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 236955-236984 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 236955-236984 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 236955-236984 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 251053-251082 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 251053-251082 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 230352-230381 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 245262-245291 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 245236-245265 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 241864-241893 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 240004-240033 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 235466-235495 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 251053-251082 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 230352-230381 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 252665-252694 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 280525-280554 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 251050-251079 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 230352-230381 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 230352-230381 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 251053-251082 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 236955-236984 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 251053-251082 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 251053-251082 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 HM560026 Uncultured bacterium plasmid pTRACA45, complete sequence 1764-1793 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NC_010867 Neisseria lactamica plasmid pNL3.1, complete sequence 3216-3245 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP020471 Rhodobacter blasticus strain 28/5 plasmid pRsa, complete sequence 121720-121749 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 535160-535189 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP032349 Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence 326858-326887 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP035710 Sphaerotilus natans subsp. sulfidivorans strain D-507 plasmid pSna507_unt10, complete sequence 121664-121693 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 KT997827 Uncultured Mediterranean phage uvDeep-CGR0-KM15-C219, complete genome 28429-28458 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 AP021850 Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome 235977-236006 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NC_020062 Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence 1424992-1425021 7 0.767
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 KT997829 Uncultured Mediterranean phage uvDeep-CGR0-KM22-C158, complete genome 24686-24715 7 0.767
NC_012943_4 4.15|927155|30|NC_012943|CRT 927155-927184 30 NZ_CP013634 Rhizobium sp. N324 plasmid pRspN324d, complete sequence 278785-278814 7 0.767
NC_012943_4 4.15|927155|30|NC_012943|CRT 927155-927184 30 NZ_CP035001 Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence 113824-113853 7 0.767
NC_012943_4 4.15|927155|30|NC_012943|CRT 927155-927184 30 NZ_CP040820 Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence 158849-158878 7 0.767
NC_012943_4 4.15|927155|30|NC_012943|CRT 927155-927184 30 NC_007765 Rhizobium etli CFN 42 plasmid p42e, complete sequence 384914-384943 7 0.767
NC_012943_4 4.15|927155|30|NC_012943|CRT 927155-927184 30 NZ_CP006989 Rhizobium sp. IE4771 plasmid pRetIE4771c, complete sequence 317121-317150 7 0.767
NC_012943_4 4.15|927155|30|NC_012943|CRT 927155-927184 30 NZ_CP020909 Rhizobium etli strain NXC12 plasmid pRetNXC12c, complete sequence 385410-385439 7 0.767
NC_012943_4 4.15|927155|30|NC_012943|CRT 927155-927184 30 NZ_CP024423 Paracoccus yeei strain TT13 plasmid pTT13-1, complete sequence 260932-260961 7 0.767
NC_012943_4 4.15|927155|30|NC_012943|CRT 927155-927184 30 NZ_CP020951 Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence 329309-329338 7 0.767
NC_012943_4 4.15|927155|30|NC_012943|CRT 927155-927184 30 NC_021908 Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1d, complete sequence 391416-391445 7 0.767
NC_012943_4 4.15|927155|30|NC_012943|CRT 927155-927184 30 NZ_CP020441 Paracoccus yeei strain FDAARGOS_252 plasmid unnamed1, complete sequence 243975-244004 7 0.767
NC_012943_4 4.15|927155|30|NC_012943|CRT 927155-927184 30 CP007642 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803a, complete sequence 301676-301705 7 0.767
NC_012943_4 4.15|927155|30|NC_012943|CRT 927155-927184 30 NZ_CP044080 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence 201076-201105 7 0.767
NC_012943_4 4.15|927155|30|NC_012943|CRT 927155-927184 30 NZ_CP019484 Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence 635292-635321 7 0.767
NC_012943_4 4.15|927155|30|NC_012943|CRT 927155-927184 30 NZ_CP019487 Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence 422833-422862 7 0.767
NC_012943_4 4.15|927155|30|NC_012943|CRT 927155-927184 30 LN997843 Streptomyces reticuli genome assembly TUE45, plasmid : II 494408-494437 7 0.767
NC_012943_4 4.15|927155|30|NC_012943|CRT 927155-927184 30 MN582086 Siphoviridae sp. ctdEk19, complete genome 33318-33347 7 0.767
NC_012943_4 4.15|927155|30|NC_012943|CRT 927155-927184 30 NC_017323 Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence 864583-864612 7 0.767
NC_012943_4 4.15|927155|30|NC_012943|CRT 927155-927184 30 NZ_CP022700 Acetobacter tropicalis strain BDGP1 plasmid pAtBDGP1A, complete sequence 61493-61522 7 0.767
NC_012943_4 4.15|927155|30|NC_012943|CRT 927155-927184 30 NZ_CP009146 Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence 1238691-1238720 7 0.767
NC_012943_4 4.15|927155|30|NC_012943|CRT 927155-927184 30 NZ_CP021831 Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence 1484042-1484071 7 0.767
NC_012943_4 4.15|927155|30|NC_012943|CRT 927155-927184 30 NZ_CP021218 Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence 1466967-1466996 7 0.767
NC_012943_4 4.15|927155|30|NC_012943|CRT 927155-927184 30 NZ_CP031082 Paracoccus yeei strain CCUG 32053 plasmid pYEE4, complete sequence 119508-119537 7 0.767
NC_012943_4 4.17|927245|36|NC_012943|CRT 927245-927280 36 NC_022087 Mycobacterium phage AnnaL29, complete genome 5558-5593 7 0.806
NC_012943_8 8.6|2360894|27|NC_012943|CRT 2360894-2360920 27 NZ_CP015006 Aminobacter aminovorans strain KCTC 2477 plasmid pAA01, complete sequence 22155-22181 7 0.741
NC_012943_9 9.1|2780038|27|NC_012943|CRT 2780038-2780064 27 NZ_CP025409 Paracoccus sp. BM15 plasmid pBM151, complete sequence 15924-15950 7 0.741
NC_012943_9 9.1|2780038|27|NC_012943|CRT 2780038-2780064 27 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 1579881-1579907 7 0.741
NC_012943_9 9.2|2780083|27|NC_012943|CRT 2780083-2780109 27 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 1430238-1430264 7 0.741
NC_012943_9 9.2|2780083|27|NC_012943|CRT 2780083-2780109 27 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 1411752-1411778 7 0.741
NC_012943_9 9.2|2780083|27|NC_012943|CRT 2780083-2780109 27 LN997844 Streptomyces reticuli genome assembly TUE45, plasmid : III 26193-26219 7 0.741
NC_012943_9 9.3|2780128|27|NC_012943|CRT 2780128-2780154 27 NZ_CP048637 Rhizobium oryzihabitans strain M15 plasmid p5, complete sequence 280931-280957 7 0.741
NC_012943_9 9.13|2780767|30|NC_012943|CRT 2780767-2780796 30 NZ_CP045361 Roseivivax sp. THAF40 plasmid pTHAF40_a, complete sequence 40675-40704 7 0.767
NC_012943_9 9.13|2780767|30|NC_012943|CRT 2780767-2780796 30 NZ_CP045319 Roseivivax sp. THAF197b plasmid pTHAF197b_a, complete sequence 158775-158804 7 0.767
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP029833 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence 159749-159775 7 0.741
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NC_013858 Azospirillum sp. B510 plasmid pAB510d, complete sequence 158448-158474 7 0.741
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 1490254-1490280 7 0.741
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP054617 Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence 727957-727983 7 0.741
NC_012943_9 9.14|2780815|27|NC_012943|CRT 2780815-2780841 27 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 642120-642146 7 0.741
NC_012943_10 10.7|3736956|31|NC_012943|CRT 3736956-3736986 31 NZ_CP010990 Pseudonocardia sp. EC080625-04 plasmid pFRP1-1, complete sequence 147567-147597 7 0.774
NC_012943_10 10.7|3736956|31|NC_012943|CRT 3736956-3736986 31 NZ_CP012186 Pseudonocardia sp. EC080619-01 plasmid pBCI1-1, complete sequence 36995-37025 7 0.774
NC_012943_10 10.7|3736956|31|NC_012943|CRT 3736956-3736986 31 NZ_CP042263 Litoreibacter sp. LN3S51 plasmid unnamed2, complete sequence 372247-372277 7 0.774
NC_012943_1 1.6|369683|33|NC_012943|CRISPRCasFinder 369683-369715 33 NZ_CP017105 Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence 1386736-1386768 8 0.758
NC_012943_1 1.6|369683|33|NC_012943|CRISPRCasFinder 369683-369715 33 NC_016624 Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence 35126-35158 8 0.758
NC_012943_1 1.6|369683|33|NC_012943|CRISPRCasFinder 369683-369715 33 NZ_CP039965 Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence 1241611-1241643 8 0.758
NC_012943_1 1.6|369683|33|NC_012943|CRISPRCasFinder 369683-369715 33 CP007644 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence 275839-275871 8 0.758
NC_012943_1 1.6|369683|33|NC_012943|CRISPRCasFinder 369683-369715 33 NZ_CP029834 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence 310597-310629 8 0.758
NC_012943_2 2.2|631597|30|NC_012943|CRT 631597-631626 30 NZ_CP045074 Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence 437642-437671 8 0.733
NC_012943_2 2.2|631597|30|NC_012943|CRT 631597-631626 30 NZ_CP015269 Mycobacterium chimaera strain ZUERICH-2 plasmid unnamed 2, complete sequence 9052-9081 8 0.733
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2714450-2714479 8 0.733
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 837910-837939 8 0.733
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 424702-424731 8 0.733
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 975216-975245 8 0.733
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 1013021-1013050 8 0.733
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_KY126370 Enterobacter cloacae subsp. cloacae strain MN201516 plasmid pOP-I, complete sequence 93253-93282 8 0.733
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP054625 Cupriavidus gilardii strain FDAARGOS_639 plasmid unnamed1, complete sequence 22400-22429 8 0.733
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 1889334-1889363 8 0.733
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_LT960615 Hartmannibacter diazotrophicus strain E19T plasmid HDIAp1, complete sequence 21202-21231 8 0.733
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP046347 Citrobacter portucalensis strain FDAARGOS_738 plasmid unnamed1, complete sequence 30108-30137 8 0.733
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP044100 Citrobacter werkmanii strain FDAARGOS_616 plasmid unnamed1, complete sequence 32856-32885 8 0.733
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP032156 Mycobacterium sp. ELW1 plasmid pELW1-1, complete sequence 111116-111145 8 0.733
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 KY555144 Caulobacter phage Ccr5, complete genome 178242-178271 8 0.733
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_KP873172 Pseudomonas aeruginosa PAO1 plasmid pAMBL1, complete sequence 21059-21088 8 0.733
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP045203 Citrobacter sp. NMI7904_11 plasmid pCTEL-2, complete sequence 159096-159125 8 0.733
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NC_021492 Enterobacter sp. R4-368 plasmid pENT01, complete sequence 50097-50126 8 0.733
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP022156 Escherichia coli strain ABWA45 plasmid pABWA45_2, complete sequence 15249-15278 8 0.733
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP024682 Citrobacter freundii strain UMH14 plasmid pUMH14_2, complete sequence 41943-41972 8 0.733
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 242723-242752 8 0.733
NC_012943_4 4.15|927155|30|NC_012943|CRT 927155-927184 30 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 28649-28678 8 0.733
NC_012943_4 4.15|927155|30|NC_012943|CRT 927155-927184 30 NZ_CP020899 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence 310870-310899 8 0.733
NC_012943_4 4.15|927155|30|NC_012943|CRT 927155-927184 30 NZ_CP022369 Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence 462801-462830 8 0.733
NC_012943_4 4.15|927155|30|NC_012943|CRT 927155-927184 30 NZ_CP013525 Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence 292109-292138 8 0.733
NC_012943_4 4.15|927155|30|NC_012943|CRT 927155-927184 30 NZ_CP013588 Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence 287383-287412 8 0.733
NC_012943_4 4.15|927155|30|NC_012943|CRT 927155-927184 30 NZ_CP013577 Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence 292305-292334 8 0.733
NC_012943_4 4.15|927155|30|NC_012943|CRT 927155-927184 30 NZ_CP013549 Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence 292675-292704 8 0.733
NC_012943_4 4.15|927155|30|NC_012943|CRT 927155-927184 30 NZ_CP013529 Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence 306458-306487 8 0.733
NC_012943_4 4.15|927155|30|NC_012943|CRT 927155-927184 30 NZ_CP013534 Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence 292675-292704 8 0.733
NC_012943_4 4.15|927155|30|NC_012943|CRT 927155-927184 30 NZ_CP013539 Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence 295900-295929 8 0.733
NC_012943_4 4.15|927155|30|NC_012943|CRT 927155-927184 30 NZ_CP013545 Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence 292670-292699 8 0.733
NC_012943_4 4.15|927155|30|NC_012943|CRT 927155-927184 30 NZ_CP013582 Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence 306458-306487 8 0.733
NC_012943_4 4.15|927155|30|NC_012943|CRT 927155-927184 30 NZ_CP013571 Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence 292305-292334 8 0.733
NC_012943_4 4.15|927155|30|NC_012943|CRT 927155-927184 30 NC_010998 Rhizobium etli CIAT 652 plasmid pA, complete sequence 298287-298316 8 0.733
NC_012943_4 4.15|927155|30|NC_012943|CRT 927155-927184 30 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1682210-1682239 8 0.733
NC_012943_4 4.15|927155|30|NC_012943|CRT 927155-927184 30 NZ_CP017076 Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence 294530-294559 8 0.733
NC_012943_4 4.15|927155|30|NC_012943|CRT 927155-927184 30 NZ_LR134452 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence 375826-375855 8 0.733
NC_012943_4 4.15|927155|30|NC_012943|CRT 927155-927184 30 NZ_AP014706 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_2p, complete sequence 112972-113001 8 0.733
NC_012943_4 4.17|927245|36|NC_012943|CRT 927245-927280 36 MG770216 Mycobacterium phage Rem711, complete genome 26292-26327 8 0.778
NC_012943_4 4.17|927245|36|NC_012943|CRT 927245-927280 36 KY087993 Mycobacterium phage Hammy, complete genome 24359-24394 8 0.778
NC_012943_4 4.17|927245|36|NC_012943|CRT 927245-927280 36 MF140406 Mycobacterium phage DarthP, complete genome 24368-24403 8 0.778
NC_012943_5 5.16|1291401|29|NC_012943|PILER-CR 1291401-1291429 29 MK599315 Pseudomonas phage PA1C, complete genome 299172-299200 8 0.724
NC_012943_10 10.7|3736956|31|NC_012943|CRT 3736956-3736986 31 CP033373 Lactobacillus fermentum strain DR9 plasmid unnamed2, complete sequence 12237-12267 8 0.742
NC_012943_10 10.7|3736956|31|NC_012943|CRT 3736956-3736986 31 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 1260343-1260373 8 0.742
NC_012943_10 10.7|3736956|31|NC_012943|CRT 3736956-3736986 31 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 1009358-1009388 8 0.742
NC_012943_10 10.7|3736956|31|NC_012943|CRT 3736956-3736986 31 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 1260501-1260531 8 0.742
NC_012943_10 10.7|3736956|31|NC_012943|CRT 3736956-3736986 31 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 1009351-1009381 8 0.742
NC_012943_10 10.7|3736956|31|NC_012943|CRT 3736956-3736986 31 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 756669-756699 8 0.742
NC_012943_10 10.7|3736956|31|NC_012943|CRT 3736956-3736986 31 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 1137767-1137797 8 0.742
NC_012943_10 10.7|3736956|31|NC_012943|CRT 3736956-3736986 31 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 1009365-1009395 8 0.742
NC_012943_10 10.7|3736956|31|NC_012943|CRT 3736956-3736986 31 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 1260057-1260087 8 0.742
NC_012943_10 10.7|3736956|31|NC_012943|CRT 3736956-3736986 31 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 1260001-1260031 8 0.742
NC_012943_10 10.7|3736956|31|NC_012943|CRT 3736956-3736986 31 NZ_CP054621 Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence 981946-981976 8 0.742
NC_012943_10 10.7|3736956|31|NC_012943|CRT 3736956-3736986 31 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 938267-938297 8 0.742
NC_012943_10 10.7|3736956|31|NC_012943|CRT 3736956-3736986 31 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 748414-748444 8 0.742
NC_012943_10 10.7|3736956|31|NC_012943|CRT 3736956-3736986 31 CP047137 Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence 896022-896052 8 0.742
NC_012943_10 10.7|3736956|31|NC_012943|CRT 3736956-3736986 31 NZ_CP027299 Streptomyces sp. SGAir0924 plasmid unnamed_5 215713-215743 8 0.742
NC_012943_10 10.7|3736956|31|NC_012943|CRT 3736956-3736986 31 NC_014213 Meiothermus silvanus DSM 9946 plasmid pMESIL01, complete sequence 111748-111778 8 0.742
NC_012943_12 12.5|3984467|36|NC_012943|CRISPRCasFinder 3984467-3984502 36 NC_016585 Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence 826111-826146 8 0.778
NC_012943_1 1.6|369683|33|NC_012943|CRISPRCasFinder 369683-369715 33 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 91175-91207 9 0.727
NC_012943_1 1.6|369683|33|NC_012943|CRISPRCasFinder 369683-369715 33 NZ_CP016287 Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence 668963-668995 9 0.727
NC_012943_1 1.6|369683|33|NC_012943|CRISPRCasFinder 369683-369715 33 NZ_CP022565 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence 789706-789738 9 0.727
NC_012943_1 1.6|369683|33|NC_012943|CRISPRCasFinder 369683-369715 33 NZ_CP048281 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence 625853-625885 9 0.727
NC_012943_2 2.2|631597|30|NC_012943|CRT 631597-631626 30 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1695112-1695141 9 0.7
NC_012943_3 3.1|692300|31|NC_012943|CRISPRCasFinder 692300-692330 31 NZ_CP014964 Geobacter anodireducens strain SD-1 plasmid pSD, complete sequence 13698-13728 9 0.71
NC_012943_3 3.1|692300|31|NC_012943|CRISPRCasFinder 692300-692330 31 NC_015974 Sphingobium sp. SYK-6 plasmid pSLPG, complete sequence 20960-20990 9 0.71
NC_012943_3 3.1|692300|31|NC_012943|CRISPRCasFinder 692300-692330 31 NZ_CP005085 Sphingobium sp. TKS plasmid pTK1, complete sequence 15390-15420 9 0.71
NC_012943_4 4.13|927059|30|NC_012943|CRT 927059-927088 30 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 5046041-5046070 9 0.7
NC_012943_4 4.15|927155|30|NC_012943|CRT 927155-927184 30 NC_005241 Cupriavidus necator H16 megaplasmid pHG1, complete sequence 65937-65966 9 0.7
NC_012943_4 4.15|927155|30|NC_012943|CRT 927155-927184 30 NZ_CP039289 Cupriavidus necator H16 plasmid pHG1, complete sequence 65937-65966 9 0.7
NC_012943_4 4.17|927245|36|NC_012943|CRT 927245-927280 36 MF140398 Mycobacterium phage Amohnition, complete genome 24446-24481 9 0.75
NC_012943_8 8.7|2360939|30|NC_012943|CRT 2360939-2360968 30 NZ_CP022197 Celeribacter ethanolicus strain TSPH2 plasmid unnamed, complete sequence 25141-25170 9 0.7
NC_012943_9 9.13|2780767|30|NC_012943|CRT 2780767-2780796 30 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 2045024-2045053 9 0.7
NC_012943_9 9.13|2780767|30|NC_012943|CRT 2780767-2780796 30 MK069556 Microcystis phage Me-ZS1, complete genome 49137-49166 9 0.7
NC_012943_10 10.5|3736815|34|NC_012943|CRT 3736815-3736848 34 NZ_CP021805 Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence 922290-922323 9 0.735
NC_012943_10 10.5|3736815|34|NC_012943|CRT 3736815-3736848 34 MG812496 Gordonia phage SallySpecial, complete genome 7675-7708 9 0.735
NC_012943_1 1.6|369683|33|NC_012943|CRISPRCasFinder 369683-369715 33 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 91179-91211 10 0.697
NC_012943_1 1.6|369683|33|NC_012943|CRISPRCasFinder 369683-369715 33 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 90245-90277 10 0.697
NC_012943_1 1.6|369683|33|NC_012943|CRISPRCasFinder 369683-369715 33 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 99166-99198 10 0.697
NC_012943_4 4.2|926555|39|NC_012943|CRT 926555-926593 39 NZ_CP044080 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence 107058-107096 10 0.744
NC_012943_4 4.5|926708|36|NC_012943|CRT 926708-926743 36 KX683875 Mycobacterium phage Baehexic, complete genome 12172-12207 10 0.722
NC_012943_4 4.5|926708|36|NC_012943|CRT 926708-926743 36 KM197169 Mycobacterium phage Piro94, complete genome 12169-12204 10 0.722
NC_012943_4 4.5|926708|36|NC_012943|CRT 926708-926743 36 MF668269 Mycobacterium phage Drake55, complete genome 12168-12203 10 0.722
NC_012943_4 4.5|926708|36|NC_012943|CRT 926708-926743 36 MK284522 Mycobacterium phage Malec, complete genome 11941-11976 10 0.722
NC_012943_4 4.5|926708|36|NC_012943|CRT 926708-926743 36 KM677210 Mycobacterium phage Larenn, complete genome 11936-11971 10 0.722
NC_012943_4 4.17|927245|36|NC_012943|CRT 927245-927280 36 MN369764 Mycobacterium phage Rahalelujah, complete genome 24340-24375 10 0.722
NC_012943_4 4.17|927245|36|NC_012943|CRT 927245-927280 36 NZ_CP025548 Mycobacterium paragordonae strain 49061 plasmid unnamed2, complete sequence 25147-25182 10 0.722
NC_012943_5 5.4|1290519|34|NC_012943|PILER-CR,CRISPRCasFinder,CRT 1290519-1290552 34 NZ_AP022335 Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49c, complete sequence 171698-171731 10 0.706
NC_012943_6 6.10|1293884|35|NC_012943|CRT,PILER-CR,CRISPRCasFinder 1293884-1293918 35 NZ_AP022607 Mycobacterium branderi strain JCM 12687 plasmid pJCM12687 414652-414686 10 0.714
NC_012943_10 10.5|3736815|34|NC_012943|CRT 3736815-3736848 34 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 470079-470112 10 0.706
NC_012943_10 10.5|3736815|34|NC_012943|CRT 3736815-3736848 34 NZ_CP024986 Streptomyces lavendulae subsp. lavendulae strain CCM 3239 plasmid pSA3239, complete sequence 68774-68807 10 0.706
NC_012943_10 10.5|3736815|34|NC_012943|CRT 3736815-3736848 34 NC_024970 Streptomyces aureofaciens strain CCM3239 plasmid pSA3239, complete sequence 172270-172303 10 0.706
NC_012943_10 10.5|3736815|34|NC_012943|CRT 3736815-3736848 34 NZ_KJ396772 Streptomyces lavendulae subsp. lavendulae strain CCM3239 plasmid pSA3239, complete sequence 172270-172303 10 0.706
NC_012943_10 10.9|3737088|37|NC_012943|CRT 3737088-3737124 37 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 975062-975098 10 0.73
NC_012943_10 10.5|3736815|34|NC_012943|CRT 3736815-3736848 34 NZ_CP029831 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence 326578-326611 11 0.676

1. spacer 11.1|3984029|21|NC_012943|CRISPRCasFinder matches to NZ_CP021914 (Sagittula sp. P11 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ggcggcaacaccggcagcggc	CRISPR spacer
ggcggcaacaccggcagcggc	Protospacer
*********************

2. spacer 11.1|3984029|21|NC_012943|CRISPRCasFinder matches to NZ_CP039644 (Azospirillum sp. TSA2s plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

ggcggcaacaccggcagcggc	CRISPR spacer
ggcggcaacaccggcagcggc	Protospacer
*********************

3. spacer 8.9|2361029|21|NC_012943|CRT matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 1, identity: 0.952

aatggcgggctcctgttcggc	CRISPR spacer
aatggcgggctcctgctcggc	Protospacer
***************.*****

4. spacer 11.1|3984029|21|NC_012943|CRISPRCasFinder matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 1, identity: 0.952

ggcggcaacaccggcagcggc	CRISPR spacer
ggcggcaagaccggcagcggc	Protospacer
******** ************

5. spacer 11.1|3984029|21|NC_012943|CRISPRCasFinder matches to NZ_CP053709 (Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

ggcggcaacaccggcagcggc	CRISPR spacer
ggcggcaacaccggccgcggc	Protospacer
*************** *****

6. spacer 11.1|3984029|21|NC_012943|CRISPRCasFinder matches to NZ_CP006993 (Methylobacterium sp. AMS5 plasmid pAMS5a, complete sequence) position: , mismatch: 1, identity: 0.952

ggcggcaacaccggcagcggc	CRISPR spacer
gtcggcaacaccggcagcggc	Protospacer
* *******************

7. spacer 11.1|3984029|21|NC_012943|CRISPRCasFinder matches to KR053194 (Gordonia phage GAL1, complete genome) position: , mismatch: 1, identity: 0.952

ggcggcaacaccggcagcggc	CRISPR spacer
ggcggcaacaccggcagcagc	Protospacer
******************.**

8. spacer 11.1|3984029|21|NC_012943|CRISPRCasFinder matches to NZ_CP011809 (Pandoraea faecigallinarum strain DSM 23572 plasmid pPF72-2, complete sequence) position: , mismatch: 1, identity: 0.952

ggcggcaacaccggcagcggc	CRISPR spacer
ggcggcaacgccggcagcggc	Protospacer
*********.***********

9. spacer 11.1|3984029|21|NC_012943|CRISPRCasFinder matches to NZ_CP022727 (Erwinia persicina strain B64 plasmid pEP2, complete sequence) position: , mismatch: 1, identity: 0.952

ggcggcaacaccggcagcggc	CRISPR spacer
ggcggcaacaccgtcagcggc	Protospacer
************* *******

10. spacer 11.1|3984029|21|NC_012943|CRISPRCasFinder matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

ggcggcaacaccggcagcggc	CRISPR spacer
ggcggcaacacctgcagcggc	Protospacer
************ ********

11. spacer 11.1|3984029|21|NC_012943|CRISPRCasFinder matches to NZ_CP010865 (Marinovum algicola DG 898 plasmid pMaD10, complete sequence) position: , mismatch: 1, identity: 0.952

ggcggcaacaccggcagcggc	CRISPR spacer
ggcggcaacaccggcggcggc	Protospacer
***************.*****

12. spacer 11.2|3984074|21|NC_012943|CRISPRCasFinder matches to NC_010608 (Exiguobacterium arabatum pEspB plasmid) position: , mismatch: 1, identity: 0.952

agctccaacttcggcggcggc	CRISPR spacer
agctacaacttcggcggcggc	Protospacer
**** ****************

13. spacer 12.2|3984302|21|NC_012943|CRISPRCasFinder matches to NZ_KU254577 (Pseudomonas aeruginosa strain HN39 plasmid pHN39-SIM, complete sequence) position: , mismatch: 1, identity: 0.952

ggcggcaacaccggcaacggc	CRISPR spacer
ggccgcaacaccggcaacggc	Protospacer
*** *****************

14. spacer 12.2|3984302|21|NC_012943|CRISPRCasFinder matches to NZ_CP021914 (Sagittula sp. P11 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

ggcggcaacaccggcaacggc	CRISPR spacer
ggcggcaacaccggcagcggc	Protospacer
****************.****

15. spacer 12.2|3984302|21|NC_012943|CRISPRCasFinder matches to NZ_AP015031 (Pseudomonas putida strain KF715 plasmid pKF715B, complete sequence) position: , mismatch: 1, identity: 0.952

ggcggcaacaccggcaacggc	CRISPR spacer
ggccgcaacaccggcaacggc	Protospacer
*** *****************

16. spacer 12.2|3984302|21|NC_012943|CRISPRCasFinder matches to NZ_CP039644 (Azospirillum sp. TSA2s plasmid p2, complete sequence) position: , mismatch: 1, identity: 0.952

ggcggcaacaccggcaacggc	CRISPR spacer
ggcggcaacaccggcagcggc	Protospacer
****************.****

17. spacer 12.2|3984302|21|NC_012943|CRISPRCasFinder matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 1, identity: 0.952

ggcggcaacaccggcaacggc	CRISPR spacer
ggcggcaacaccggcaatggc	Protospacer
*****************.***

18. spacer 12.2|3984302|21|NC_012943|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

ggcggcaacaccggcaacggc	CRISPR spacer
ggcggcaacagcggcaacggc	Protospacer
********** **********

19. spacer 11.1|3984029|21|NC_012943|CRISPRCasFinder matches to NZ_LR134465 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence) position: , mismatch: 2, identity: 0.905

ggcggcaacaccggcagcggc	CRISPR spacer
ttcggcaacaccggcagcggc	Protospacer
  *******************

20. spacer 11.1|3984029|21|NC_012943|CRISPRCasFinder matches to NC_016586 (Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence) position: , mismatch: 2, identity: 0.905

ggcggcaacaccggcagcggc	CRISPR spacer
cacggcaacaccggcagcggc	Protospacer
 .*******************

21. spacer 11.3|3984119|21|NC_012943|CRISPRCasFinder matches to NZ_CP032828 (Sphingomonas sp. YZ-8 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.905

agcggcaaccgaggcagcgac	CRISPR spacer
ggcggcaaccgaggcagcgag	Protospacer
.******************* 

22. spacer 12.2|3984302|21|NC_012943|CRISPRCasFinder matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 2, identity: 0.905

ggcggcaacaccggcaacggc	CRISPR spacer
atcggcaacaccggcaacggc	Protospacer
. *******************

23. spacer 12.2|3984302|21|NC_012943|CRISPRCasFinder matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 2, identity: 0.905

ggcggcaacaccggcaacggc	CRISPR spacer
atcggcaacaccggcaacggc	Protospacer
. *******************

24. spacer 12.2|3984302|21|NC_012943|CRISPRCasFinder matches to MH153804 (Rhodococcus phage Jace, complete genome) position: , mismatch: 2, identity: 0.905

ggcggcaacaccggcaacggc	CRISPR spacer
ctcggcaacaccggcaacggc	Protospacer
  *******************

25. spacer 4.16|927203|24|NC_012943|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
gaccgacctcggcggcgcgggcga	Protospacer
.***************** ****.

26. spacer 4.16|927203|24|NC_012943|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
caccggcctgggcggcgctggcgg	Protospacer
 ****.*** **************

27. spacer 4.16|927203|24|NC_012943|CRT matches to NZ_CP034768 (Enterobacter sp. N18-03635 plasmid pFRI-6, complete sequence) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
taacgtcctcggcggcgctggcgg	Protospacer
 * ** ******************

28. spacer 4.16|927203|24|NC_012943|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
agccgacctcggcggcgatggcgc	Protospacer
*.*************** ***** 

29. spacer 4.16|927203|24|NC_012943|CRT matches to NZ_AP019631 (Enterobacter asburiae strain 17Nkhm-UP2 plasmid pEAS17Nkhm-UP2-1, complete sequence) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
taacgtcctcggcggcgctggcgg	Protospacer
 * ** ******************

30. spacer 4.16|927203|24|NC_012943|CRT matches to NZ_AP019631 (Enterobacter asburiae strain 17Nkhm-UP2 plasmid pEAS17Nkhm-UP2-1, complete sequence) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
taacgtcctcggcggcgctggcgg	Protospacer
 * ** ******************

31. spacer 4.16|927203|24|NC_012943|CRT matches to KU716094 (Mycobacterium phage Eidsmoe, complete genome) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
gaccgcgctcggcggcgctggcgg	Protospacer
.****  *****************

32. spacer 4.16|927203|24|NC_012943|CRT matches to MH371122 (Mycobacterium phage Priya, complete genome) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
gaccgcgctcggcggcgctggcgg	Protospacer
.****  *****************

33. spacer 4.16|927203|24|NC_012943|CRT matches to MK016502 (Mycobacterium phage Pat3, complete genome) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
catcggcctcggcggcgctggcgg	Protospacer
 *.**.******************

34. spacer 4.16|927203|24|NC_012943|CRT matches to MK937593 (Mycobacterium phage Flypotenuse, complete genome) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
catcggcctcggcggcgctggcgg	Protospacer
 *.**.******************

35. spacer 4.16|927203|24|NC_012943|CRT matches to MG872835 (Mycobacterium phage Conquerage, complete genome) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
gaccgcgctcggcggcgctggcgg	Protospacer
.****  *****************

36. spacer 4.16|927203|24|NC_012943|CRT matches to MH536820 (Mycobacterium phage Glexan, complete genome) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
catcggcctcggcggcgctggcgg	Protospacer
 *.**.******************

37. spacer 4.16|927203|24|NC_012943|CRT matches to NC_010510 (Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
aaccggcctcggcggcgctgccgc	Protospacer
*****.************** ** 

38. spacer 4.16|927203|24|NC_012943|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
caccgagctcggcggcgctgccgg	Protospacer
 ***** ************* ***

39. spacer 4.16|927203|24|NC_012943|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
caccggcctcggcggcgcgggcgg	Protospacer
 ****.************ *****

40. spacer 4.16|927203|24|NC_012943|CRT matches to MH271298 (Microbacterium phage Floof, complete genome) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
aacccacctcggcggcgatggcgc	Protospacer
**** ************ ***** 

41. spacer 8.8|2360987|24|NC_012943|CRT matches to NZ_CP014599 (Yangia sp. CCB-MM3 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.875

accggcactaatgtcaccggcggt	CRISPR spacer
aacggcactaatgtcaccggcgtg	Protospacer
* ********************  

42. spacer 8.8|2360987|24|NC_012943|CRT matches to NZ_CP028945 (Vibrio sp. dhg plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

accggcactaatgtcaccggcggt	CRISPR spacer
accggcactaatgtcaccgccaga	Protospacer
******************* *.* 

43. spacer 9.4|2780173|27|NC_012943|CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 3, identity: 0.889

catggcggtgaccccggcgccggcggg	CRISPR spacer
catggcgctgaccccggcggcggcggc	Protospacer
******* *********** ****** 

44. spacer 9.4|2780173|27|NC_012943|CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 3, identity: 0.889

catggcggtgaccccggcgccggcggg	CRISPR spacer
catggcgctgaccccggcggcggcggc	Protospacer
******* *********** ****** 

45. spacer 9.4|2780173|27|NC_012943|CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 3, identity: 0.889

catggcggtgaccccggcgccggcggg	CRISPR spacer
catggcgctgaccccggcggcggcggc	Protospacer
******* *********** ****** 

46. spacer 9.4|2780173|27|NC_012943|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 3, identity: 0.889

catggcggtgaccccggcgccggcggg	CRISPR spacer
catggcgctgaccccggcggcggcggc	Protospacer
******* *********** ****** 

47. spacer 9.4|2780173|27|NC_012943|CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 3, identity: 0.889

catggcggtgaccccggcgccggcggg	CRISPR spacer
catggcgctgaccccggcggcggcggc	Protospacer
******* *********** ****** 

48. spacer 1.1|369353|27|NC_012943|CRISPRCasFinder matches to NC_023591 (Mycobacterium phage Adler, complete genome) position: , mismatch: 4, identity: 0.852

-aacgcaccggtgtccacatcgcccgtg	CRISPR spacer
cagtgc-ccggtgtccccatcgcccgtg	Protospacer
 *..** ********* ***********

49. spacer 1.1|369353|27|NC_012943|CRISPRCasFinder matches to KF981876 (UNVERIFIED: Mycobacterium phage ADLER F1725, complete genome) position: , mismatch: 4, identity: 0.852

-aacgcaccggtgtccacatcgcccgtg	CRISPR spacer
cagtgc-ccggtgtccccatcgcccgtg	Protospacer
 *..** ********* ***********

50. spacer 1.7|369749|27|NC_012943|CRISPRCasFinder matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 4, identity: 0.852

gcgaagccgatgttgtagctgccggtg	CRISPR spacer
ccgaagccgatgtcgtagcggccggcg	Protospacer
 ************.***** *****.*

51. spacer 1.10|369959|27|NC_012943|CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.852

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgaaggtgaggtcgccgggg	Protospacer
.* ********* ***********.**

52. spacer 1.10|369959|27|NC_012943|CRISPRCasFinder matches to NC_016652 (Rhodococcus phage REQ2, complete genome) position: , mismatch: 4, identity: 0.852

accccgccgaagttgaggtcgccgagg	CRISPR spacer
acggcgccgaagttgaggccgccgacg	Protospacer
**  **************.****** *

53. spacer 2.2|631597|30|NC_012943|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 4, identity: 0.867

accacgccggtgaccacgccg-ccaacgacg	CRISPR spacer
accacgccggtggccacgccgaccagcggc-	Protospacer
************.******** ***.**.* 

54. spacer 4.6|926762|27|NC_012943|CRT matches to NZ_CP010326 (Pantoea sp. PSNIH1 plasmid pPSP-3a9, complete sequence) position: , mismatch: 4, identity: 0.852

cgtcagcggcggggctggcggggaggg	CRISPR spacer
cgtcagcggctgggctggcggggatat	Protospacer
********** ************* . 

55. spacer 4.6|926762|27|NC_012943|CRT matches to NZ_CP021045 (Phaeobacter gallaeciensis strain P129 plasmid pP129_e, complete sequence) position: , mismatch: 4, identity: 0.852

cgtcagcggcggggctggcggggaggg	CRISPR spacer
cgacagcggcggggctggcggcgacag	Protospacer
** ****************** ** .*

56. spacer 4.6|926762|27|NC_012943|CRT matches to NZ_CP010678 (Phaeobacter gallaeciensis strain P75 plasmid pP75_e, complete sequence) position: , mismatch: 4, identity: 0.852

cgtcagcggcggggctggcggggaggg	CRISPR spacer
cgacagcggcggggctggcggcgacag	Protospacer
** ****************** ** .*

57. spacer 4.6|926762|27|NC_012943|CRT matches to NC_023142 (Phaeobacter gallaeciensis DSM 26640 plasmid pGal_F69, complete sequence) position: , mismatch: 4, identity: 0.852

cgtcagcggcggggctggcggggaggg	CRISPR spacer
cgacagcggcggggctggcggcgacag	Protospacer
** ****************** ** .*

58. spacer 4.6|926762|27|NC_012943|CRT matches to NZ_CP010789 (Phaeobacter gallaeciensis strain P63 plasmid pP63_e, complete sequence) position: , mismatch: 4, identity: 0.852

cgtcagcggcggggctggcggggaggg	CRISPR spacer
cgacagcggcggggctggcggcgacag	Protospacer
** ****************** ** .*

59. spacer 4.6|926762|27|NC_012943|CRT matches to NZ_CP010642 (Phaeobacter gallaeciensis strain P73 plasmid pP73_f, complete sequence) position: , mismatch: 4, identity: 0.852

cgtcagcggcggggctggcggggaggg	CRISPR spacer
cgacagcggcggggctggcggcgacag	Protospacer
** ****************** ** .*

60. spacer 4.6|926762|27|NC_012943|CRT matches to NZ_CP010593 (Phaeobacter gallaeciensis strain P11 plasmid pP11_e, complete sequence) position: , mismatch: 4, identity: 0.852

cgtcagcggcggggctggcggggaggg	CRISPR spacer
cgacagcggcggggctggcggcgacag	Protospacer
** ****************** ** .*

61. spacer 4.6|926762|27|NC_012943|CRT matches to AM419438 (Archaeal BJ1 virus complete genome) position: , mismatch: 4, identity: 0.852

cgtcagcggcggggctggcggggaggg	CRISPR spacer
cgtcggcggcgggggtggcgggggcgg	Protospacer
****.********* ********. **

62. spacer 4.6|926762|27|NC_012943|CRT matches to NC_008695 (Archaeal BJ1 virus, complete genome) position: , mismatch: 4, identity: 0.852

cgtcagcggcggggctggcggggaggg	CRISPR spacer
cgtcggcggcgggggtggcgggggcgg	Protospacer
****.********* ********. **

63. spacer 4.10|926918|27|NC_012943|CRT matches to KY945355 (Mycobacterium phage Shandong1, complete genome) position: , mismatch: 4, identity: 0.852

cggatccggcggcggcggtagcgttgc	CRISPR spacer
cgcatccggcggcggcggttgcgttct	Protospacer
** **************** ***** .

64. spacer 4.10|926918|27|NC_012943|CRT matches to NZ_CP015095 (Pelagibaca abyssi strain JLT2014 plasmid pPABY4, complete sequence) position: , mismatch: 4, identity: 0.852

cggatccggcggcggcggtagcgttgc	CRISPR spacer
cggcctcggcggcggcggtggcgttgc	Protospacer
*** ..*************.*******

65. spacer 4.10|926918|27|NC_012943|CRT matches to NC_041888 (Mycobacterium phage Tortellini, complete genome) position: , mismatch: 4, identity: 0.852

cggatccggcggcggcggtagcgttgc	CRISPR spacer
cggccgcggcggcggcggtagcggtgc	Protospacer
*** . ***************** ***

66. spacer 4.15|927155|30|NC_012943|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 4, identity: 0.867

cctgctgttcggctccggcggcgctggcgg-	CRISPR spacer
gctgctgttcggcgccggcggcg-tggtggc	Protospacer
 ************ ********* ***.** 

67. spacer 4.16|927203|24|NC_012943|CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
ctacgaccacggcggcgctggcgg	Protospacer
   ***** ***************

68. spacer 4.16|927203|24|NC_012943|CRT matches to NZ_CP025431 (Paracoccus zhejiangensis strain J6 plasmid pPZ01, complete sequence) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
gcccgatctcggcggcgctggcgt	Protospacer
. ****.**************** 

69. spacer 4.16|927203|24|NC_012943|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
tcccgacctcggcggtgctggcgc	Protospacer
  *************.******* 

70. spacer 4.16|927203|24|NC_012943|CRT matches to NZ_CP016822 (Rhodococcus sp. p52 plasmid pDF03, complete sequence) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
cgtcgacgtcggcggcgctggcgg	Protospacer
 ..**** ****************

71. spacer 4.16|927203|24|NC_012943|CRT matches to MN582086 (Siphoviridae sp. ctdEk19, complete genome) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
cttcgacttcggcggcgctggcgg	Protospacer
  .****.****************

72. spacer 4.16|927203|24|NC_012943|CRT matches to MF919502 (Mycobacterium phage Demsculpinboyz, complete genome) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
ccgcggcctcggcggcgctggcgg	Protospacer
   **.******************

73. spacer 4.16|927203|24|NC_012943|CRT matches to MT889380 (Mycobacterium phage Coco12, complete genome) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
ccgcggcctcggcggcgctggcgg	Protospacer
   **.******************

74. spacer 4.16|927203|24|NC_012943|CRT matches to NC_023698 (Mycobacterium phage Avani, complete genome) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
ccgcggcctcggcggcgctggcgg	Protospacer
   **.******************

75. spacer 4.16|927203|24|NC_012943|CRT matches to MT114167 (Mycobacterium phage Phanphagia, complete genome) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
ccgcggcctcggcggcgctggcgg	Protospacer
   **.******************

76. spacer 4.16|927203|24|NC_012943|CRT matches to NZ_CP050953 (Rhodococcus sp. DMU1 plasmid unnamed) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
cgccgacctcggcggcggtggcga	Protospacer
 .*************** *****.

77. spacer 4.16|927203|24|NC_012943|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
tcccgacctcggcggtgctggcgc	Protospacer
  *************.******* 

78. spacer 4.16|927203|24|NC_012943|CRT matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
ctacgaccacggcggcgctggcgg	Protospacer
   ***** ***************

79. spacer 4.16|927203|24|NC_012943|CRT matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
tctcgacctcggcggcgatggcgg	Protospacer
  .************** ******

80. spacer 4.16|927203|24|NC_012943|CRT matches to MN096355 (Mycobacterium phage Purky, complete genome) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
tgccgacctcggctgcgctggcgc	Protospacer
 .*********** ********* 

81. spacer 4.16|927203|24|NC_012943|CRT matches to MK279853 (Gordonia phage Gray, complete genome) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
ggtcgacctcgacggcgctggcgg	Protospacer
...********.************

82. spacer 8.6|2360894|27|NC_012943|CRT matches to NZ_CP022566 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK02, complete sequence) position: , mismatch: 4, identity: 0.852

gtcggcggactcgcggctgacgccggt	CRISPR spacer
ggcggcggactcgcggctgtcgccatt	Protospacer
* ***************** ****. *

83. spacer 9.1|2780038|27|NC_012943|CRT matches to NZ_CP045329 (Labrenzia sp. THAF191b plasmid pTHAF191b_a, complete sequence) position: , mismatch: 4, identity: 0.852

ctgatcagcctgctgggcggccaaggc	CRISPR spacer
ctgatcagccttctgggcggcctctgc	Protospacer
*********** **********   **

84. spacer 9.1|2780038|27|NC_012943|CRT matches to NZ_CP045345 (Labrenzia sp. THAF187b plasmid pTHAF187b_a, complete sequence) position: , mismatch: 4, identity: 0.852

ctgatcagcctgctgggcggccaaggc	CRISPR spacer
ctgatcagccttctgggcggcctctgc	Protospacer
*********** **********   **

85. spacer 9.1|2780038|27|NC_012943|CRT matches to NZ_CP045335 (Labrenzia sp. THAF191a plasmid pTHAF191a_b, complete sequence) position: , mismatch: 4, identity: 0.852

ctgatcagcctgctgggcggccaaggc	CRISPR spacer
ctgatcagccttctgggcggcctctgc	Protospacer
*********** **********   **

86. spacer 9.1|2780038|27|NC_012943|CRT matches to NZ_CP045381 (Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence) position: , mismatch: 4, identity: 0.852

ctgatcagcctgctgggcggccaaggc	CRISPR spacer
ctgatcagccttctgggcggcctttgc	Protospacer
*********** **********   **

87. spacer 9.1|2780038|27|NC_012943|CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 4, identity: 0.852

ctgatcagcctgctgggcggccaaggc	CRISPR spacer
ctgatcagcctgctgcgcggcgaaccc	Protospacer
*************** ***** **  *

88. spacer 9.1|2780038|27|NC_012943|CRT matches to NZ_CP019631 (Labrenzia aggregata strain RMAR6-6 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852

ctgatcagcctgctgggcggccaaggc	CRISPR spacer
ctgatcagccttctgggcggcctctgc	Protospacer
*********** **********   **

89. spacer 9.2|2780083|27|NC_012943|CRT matches to NZ_CP010408 (Streptomyces vietnamensis strain GIMV4.0001 plasmid pSVL1, complete sequence) position: , mismatch: 4, identity: 0.852

accggcggggccggcggtgttggcggt	CRISPR spacer
gacggcggtgccgtcggtgttggcggt	Protospacer
. ****** **** *************

90. spacer 9.2|2780083|27|NC_012943|CRT matches to NZ_CP011665 (Streptomyces sp. Mg1 plasmid pSMg1-1, complete sequence) position: , mismatch: 4, identity: 0.852

accggcggggccggcggtgttggcggt	CRISPR spacer
ctcggcggtgccggcggtgatggcggt	Protospacer
 .****** ********** *******

91. spacer 9.2|2780083|27|NC_012943|CRT matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 4, identity: 0.852

accggcggggccggcggtgttggcggt	CRISPR spacer
accggcggggccggcgggcttggcgcg	Protospacer
*****************  ******  

92. spacer 9.2|2780083|27|NC_012943|CRT matches to NZ_AP022338 (Mameliella alba strain KU6B plasmid pKUB257, complete sequence) position: , mismatch: 4, identity: 0.852

accggcggggccggcggtgttggcggt	CRISPR spacer
accggcggggccggtggtattggcgcg	Protospacer
**************.***.******  

93. spacer 9.2|2780083|27|NC_012943|CRT matches to MH155876 (Mycobacterium phage Priamo, complete genome) position: , mismatch: 4, identity: 0.852

accggcggggccggcggtgttggcggt	CRISPR spacer
ttcggcggtgccggcggtggtggcggt	Protospacer
 .****** ********** *******

94. spacer 9.2|2780083|27|NC_012943|CRT matches to MN586039 (Mycobacterium phage Blinn1, complete genome) position: , mismatch: 4, identity: 0.852

accggcggggccggcggtgttggcggt	CRISPR spacer
ttcggcggtgccggcggtggtggcggt	Protospacer
 .****** ********** *******

95. spacer 9.2|2780083|27|NC_012943|CRT matches to NZ_LR134459 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence) position: , mismatch: 4, identity: 0.852

accggcggggccggcggtgttggcggt	CRISPR spacer
accggcgggaccggcggtgctggcact	Protospacer
*********.*********.****. *

96. spacer 9.2|2780083|27|NC_012943|CRT matches to NZ_CP024423 (Paracoccus yeei strain TT13 plasmid pTT13-1, complete sequence) position: , mismatch: 4, identity: 0.852

accggcggggccggcggtgttggcggt	CRISPR spacer
atcggcggcgacggcggtgttggcggc	Protospacer
*.****** * ***************.

97. spacer 9.2|2780083|27|NC_012943|CRT matches to NZ_CP020441 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852

accggcggggccggcggtgttggcggt	CRISPR spacer
atcggcggcgacggcggtgttggcggc	Protospacer
*.****** * ***************.

98. spacer 9.2|2780083|27|NC_012943|CRT matches to NZ_CP053345 (Herbiconiux sp. SALV-R1 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852

accggcggggccggcggtgttggcggt	CRISPR spacer
gccggcggtgccggcggtgatggcgat	Protospacer
.******* ********** *****.*

99. spacer 9.2|2780083|27|NC_012943|CRT matches to NC_006362 (Nocardia farcinica IFM 10152 plasmid pNF1, complete sequence) position: , mismatch: 4, identity: 0.852

accggcggggccggcggtgttg-gcggt	CRISPR spacer
cccggcggggccgccggtgttgcgccg-	Protospacer
 ************ ******** ** * 

100. spacer 9.4|2780173|27|NC_012943|CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 4, identity: 0.852

catggcggtgaccccggcgccggcggg	CRISPR spacer
ggtggcggtgaccccggcgcgggcgag	Protospacer
 .****************** ****.*

101. spacer 9.4|2780173|27|NC_012943|CRT matches to NZ_CP046258 (Gordonia sp. 135 plasmid pG135, complete sequence) position: , mismatch: 4, identity: 0.852

catggcggtgaccccggcgccggcggg	CRISPR spacer
ctgagcggtgaccccggccccggcggg	Protospacer
*  .************** ********

102. spacer 9.4|2780173|27|NC_012943|CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 4, identity: 0.852

catggcggtgaccccggcgccggcggg	CRISPR spacer
ggtggcggtgaccccggcgcgggcgag	Protospacer
 .****************** ****.*

103. spacer 9.4|2780173|27|NC_012943|CRT matches to NC_013859 (Azospirillum sp. B510 plasmid pAB510e, complete sequence) position: , mismatch: 4, identity: 0.852

catggcggtgaccccggcgccggcggg	CRISPR spacer
ccggtcggtgaccccggcgccggcggc	Protospacer
*  * ********************* 

104. spacer 9.4|2780173|27|NC_012943|CRT matches to NZ_CP021356 (Rhodococcus sp. S2-17 plasmid pRB29, complete sequence) position: , mismatch: 4, identity: 0.852

catggcggtgaccccggcgccggcggg	CRISPR spacer
cacggcggtgaccccggccccggccag	Protospacer
**.*************** ***** .*

105. spacer 9.4|2780173|27|NC_012943|CRT matches to NZ_CP015739 (Shinella sp. HZN7 plasmid pShin-03, complete sequence) position: , mismatch: 4, identity: 0.852

catggcggtgaccccggcgccggcggg	CRISPR spacer
cgtgtcggtgacctcggcgccggcgcg	Protospacer
*.** ********.*********** *

106. spacer 9.4|2780173|27|NC_012943|CRT matches to NZ_CP030264 (Ensifer adhaerens strain Corn53 plasmid AB, complete sequence) position: , mismatch: 4, identity: 0.852

catg-gcggtgaccccggcgccggcggg	CRISPR spacer
-acgcgcggtgaccccggcgacggcgtg	Protospacer
 *.* *************** ***** *

107. spacer 9.14|2780815|27|NC_012943|CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 4, identity: 0.852

aacggcggtagccgcggcatcggtggt	CRISPR spacer
accggcggcagccgcggcatcggtgcc	Protospacer
* ******.**************** .

108. spacer 9.14|2780815|27|NC_012943|CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 4, identity: 0.852

aacggcggtagccgcggcatcggtggt	CRISPR spacer
accggcggcagccgcggcatcggtgcc	Protospacer
* ******.**************** .

109. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP042572 (Enterobacter hormaechei strain E5 plasmid pE5_001, complete sequence) position: , mismatch: 4, identity: 0.852

aacggcggtagccgcggcatcggtggt	CRISPR spacer
accggcggaagccgcggcatcggtgcc	Protospacer
* ****** **************** .

110. spacer 1.1|369353|27|NC_012943|CRISPRCasFinder matches to LR794124 (Vibrio phage vB_Vc_SrVc9 genome assembly, chromosome: 1) position: , mismatch: 5, identity: 0.815

aacgcaccggtgtccacatcgcccgtg	CRISPR spacer
aacgcaccgttgtccacatcaccaatc	Protospacer
********* **********.** .* 

111. spacer 1.1|369353|27|NC_012943|CRISPRCasFinder matches to NC_012662 (Vibrio phage VP93, complete genome) position: , mismatch: 5, identity: 0.815

aacgcaccggtgtccacatcgcccgtg	CRISPR spacer
aacgcaccgttgtccacatcaccaatc	Protospacer
********* **********.** .* 

112. spacer 1.7|369749|27|NC_012943|CRISPRCasFinder matches to NZ_CP016084 (Streptomyces sp. SAT1 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.815

gcgaagccgatgttgtagctgccggtg	CRISPR spacer
gcgaagccgaagttgtagctgcgctcg	Protospacer
********** ***********   .*

113. spacer 1.7|369749|27|NC_012943|CRISPRCasFinder matches to MN693945 (Marine virus AFVG_250M952, complete genome) position: , mismatch: 5, identity: 0.815

gcgaagccgatgttgtagctgccggtg	CRISPR spacer
atgaagccgatgttgtcgctaccgggg	Protospacer
..************** ***.**** *

114. spacer 1.10|369959|27|NC_012943|CRISPRCasFinder matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

115. spacer 1.10|369959|27|NC_012943|CRISPRCasFinder matches to NZ_CP013525 (Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

116. spacer 1.10|369959|27|NC_012943|CRISPRCasFinder matches to NZ_CP013554 (Rhizobium phaseoli strain N931 plasmid pRphaN931b, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

117. spacer 1.10|369959|27|NC_012943|CRISPRCasFinder matches to NZ_CP015368 (Methylobacterium phyllosphaerae strain CBMB27 plasmid CBMB27-p1, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tccccgcggaagttgaggtcgcgggtg	Protospacer
 ****** ************** *. *

118. spacer 1.10|369959|27|NC_012943|CRISPRCasFinder matches to NZ_CP013588 (Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

119. spacer 1.10|369959|27|NC_012943|CRISPRCasFinder matches to NZ_CP013560 (Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

120. spacer 1.10|369959|27|NC_012943|CRISPRCasFinder matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

121. spacer 1.10|369959|27|NC_012943|CRISPRCasFinder matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

122. spacer 1.10|369959|27|NC_012943|CRISPRCasFinder matches to NZ_CP013529 (Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

123. spacer 1.10|369959|27|NC_012943|CRISPRCasFinder matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

124. spacer 1.10|369959|27|NC_012943|CRISPRCasFinder matches to NZ_CP013539 (Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

125. spacer 1.10|369959|27|NC_012943|CRISPRCasFinder matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

126. spacer 1.10|369959|27|NC_012943|CRISPRCasFinder matches to NZ_CP020444 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcaccgccgaagttgaagtggccgagc	Protospacer
 * *************.** ****** 

127. spacer 1.10|369959|27|NC_012943|CRISPRCasFinder matches to NZ_CP013565 (Rhizobium phaseoli strain N831 plasmid pRphaN831b, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

128. spacer 1.10|369959|27|NC_012943|CRISPRCasFinder matches to NZ_CP013582 (Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

129. spacer 1.10|369959|27|NC_012943|CRISPRCasFinder matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

130. spacer 1.10|369959|27|NC_012943|CRISPRCasFinder matches to NZ_CP044078 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcaccgccgaagttgaagtggccgagc	Protospacer
 * *************.** ****** 

131. spacer 1.10|369959|27|NC_012943|CRISPRCasFinder matches to NZ_CP031081 (Paracoccus yeei strain CCUG 32053 plasmid pYEE3, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcaccgccgaagttgaagtggccgagc	Protospacer
 * *************.** ****** 

132. spacer 1.10|369959|27|NC_012943|CRISPRCasFinder matches to MN586031 (Gordonia phage Gambino, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

133. spacer 1.10|369959|27|NC_012943|CRISPRCasFinder matches to KU998236 (Gordonia phage Blueberry, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

134. spacer 1.10|369959|27|NC_012943|CRISPRCasFinder matches to MN062704 (Gordonia phage JuJu, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

135. spacer 1.10|369959|27|NC_012943|CRISPRCasFinder matches to MK501729 (Gordonia phage Walrus, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

136. spacer 1.10|369959|27|NC_012943|CRISPRCasFinder matches to NC_031226 (Gordonia phage BaxterFox, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

137. spacer 1.10|369959|27|NC_012943|CRISPRCasFinder matches to MK967393 (Rhodococcus phage Whack, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tccttaccgaagttgaggtcgacgagg	Protospacer
 **...*************** *****

138. spacer 1.10|369959|27|NC_012943|CRISPRCasFinder matches to MT723935 (Gordonia phage Azula, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

139. spacer 1.10|369959|27|NC_012943|CRISPRCasFinder matches to KU963249 (Gordonia phage Yeezy, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

140. spacer 1.10|369959|27|NC_012943|CRISPRCasFinder matches to MH153808 (Gordonia phage Petra, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

141. spacer 1.10|369959|27|NC_012943|CRISPRCasFinder matches to MT639650 (Gordonia phage Ohgeesy, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

142. spacer 1.10|369959|27|NC_012943|CRISPRCasFinder matches to MH536818 (Gordonia phage Frokostdame, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

143. spacer 1.10|369959|27|NC_012943|CRISPRCasFinder matches to KX557275 (Gordonia phage CarolAnn, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

144. spacer 4.6|926762|27|NC_012943|CRT matches to CP009871 (Pantoea sp. PSNIH2 plasmid pPSP-cd6, complete sequence) position: , mismatch: 5, identity: 0.815

cgtcagcggcggggctggcggggaggg	CRISPR spacer
cgtcagcggctgggcaggcggggatat	Protospacer
********** **** ******** . 

145. spacer 4.6|926762|27|NC_012943|CRT matches to NZ_CP030354 (Novosphingobium sp. P6W plasmid pP6W1, complete sequence) position: , mismatch: 5, identity: 0.815

cgtcagcggcggggctggcggggaggg	CRISPR spacer
cgtcaccggcggggctggcggcatcgg	Protospacer
***** *************** .  **

146. spacer 4.6|926762|27|NC_012943|CRT matches to NZ_CP045223 (Achromobacter xylosoxidans strain DN002 plasmid unnamed) position: , mismatch: 5, identity: 0.815

cgtcagcggcggggctggcggggaggg	CRISPR spacer
ccaaagcggcgagactggcggggaggg	Protospacer
*   *******.*.*************

147. spacer 4.6|926762|27|NC_012943|CRT matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 5, identity: 0.815

cgtcagcggcggggctggcggggaggg	CRISPR spacer
tgttcacggcggggctggcggggacgg	Protospacer
.**. .****************** **

148. spacer 4.6|926762|27|NC_012943|CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.815

cgtcagcggcggggctggcggggaggg	CRISPR spacer
cggcagcggcggggctggcggagccgc	Protospacer
** ******************.*  * 

149. spacer 4.6|926762|27|NC_012943|CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 5, identity: 0.815

cgtcagcggcggggctggcggggaggg	CRISPR spacer
cggcagcggcggggctggcggagccgc	Protospacer
** ******************.*  * 

150. spacer 4.6|926762|27|NC_012943|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815

cgtcagcggcggggctggcggggaggg	CRISPR spacer
actcgccggcgcggctggcggggaggg	Protospacer
  **. ***** ***************

151. spacer 4.10|926918|27|NC_012943|CRT matches to NZ_CP022264 (Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plA, complete sequence) position: , mismatch: 5, identity: 0.815

cggatccggcggcggcggtagcgttgc	CRISPR spacer
ggcaggcggcggcggcggtagcgttgg	Protospacer
 * *  ******************** 

152. spacer 4.10|926918|27|NC_012943|CRT matches to NZ_CP022264 (Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plA, complete sequence) position: , mismatch: 5, identity: 0.815

cggatccggcggcggcggtagcgttgc	CRISPR spacer
ggcaggcggcggcggcggtagcgttgg	Protospacer
 * *  ******************** 

153. spacer 4.10|926918|27|NC_012943|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 5, identity: 0.815

cggatccggcggcggcggtagcgttgc	CRISPR spacer
aggatccggccgcggcggtagcgctcg	Protospacer
 ********* ************.*  

154. spacer 4.10|926918|27|NC_012943|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 5, identity: 0.815

cggatccggcggcggcggtagcgttgc	CRISPR spacer
aggatccggccgcggcggtagcgctcg	Protospacer
 ********* ************.*  

155. spacer 4.10|926918|27|NC_012943|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.815

cggatccggcggcggcggtagcgttgc	CRISPR spacer
cgggtccggcggcggcggtggcggttt	Protospacer
***.***************.*** * .

156. spacer 4.10|926918|27|NC_012943|CRT matches to NZ_CP049908 (Hymenobacter sp. HDW8 plasmid p_unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815

cggatccggcggcggcggtagcgttgc	CRISPR spacer
cgactccggcggcgggggtagcgttcg	Protospacer
**. *********** *********  

157. spacer 4.10|926918|27|NC_012943|CRT matches to NZ_CP049700 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2a, complete sequence) position: , mismatch: 5, identity: 0.815

cggatccggcggcggcggtagcgttgc	CRISPR spacer
cgccgccggcggcggcggtggcgttgg	Protospacer
**   **************.****** 

158. spacer 4.10|926918|27|NC_012943|CRT matches to MH576962 (Streptomyces phage Satis, complete genome) position: , mismatch: 5, identity: 0.815

cggatccggcggcggcggtagcgttgc	CRISPR spacer
tgactccggcggcggccgtggcgttgc	Protospacer
.*. ************ **.*******

159. spacer 4.10|926918|27|NC_012943|CRT matches to MK620894 (Streptomyces phage Kradal, complete genome) position: , mismatch: 5, identity: 0.815

cggatccggcggcggcggtagcgttgc	CRISPR spacer
tgactccggcggcggccgtggcgttgc	Protospacer
.*. ************ **.*******

160. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 5, identity: 0.833

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgaggccggcctgctggtcgtctccgggct	Protospacer
*** **************** ******   

161. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 5, identity: 0.833

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
agattccggcctgttcgtcggctccggcgg	Protospacer
 **. ********.* **************

162. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 5, identity: 0.833

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgccatcggcctgctgctcggcaccggcgg	Protospacer
** *..********** ***** *******

163. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP031193 (Humibacter sp. BT305 plasmid unnamed1) position: , mismatch: 5, identity: 0.833

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgccgccggcctgctggtcggcgcggcggg	Protospacer
** ******************* * *  **

164. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP050092 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence) position: , mismatch: 5, identity: 0.833

cgacgccggcctgctggtcggc-tccggcgg	CRISPR spacer
cgacgccggcatgccggtcggcttcctgct-	Protospacer
********** ***.******* *** **  

165. spacer 4.15|927155|30|NC_012943|CRT matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.833

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
attgctgttcggctgcggcggcgcgggcgc	Protospacer
 .************ ********* **** 

166. spacer 4.15|927155|30|NC_012943|CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
attgctgttcggctgcggcggcgcgggcgc	Protospacer
 .************ ********* **** 

167. spacer 4.15|927155|30|NC_012943|CRT matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 5, identity: 0.833

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cctgctgctcggcaccggcggcgcactcgg	Protospacer
*******.***** **********   ***

168. spacer 4.15|927155|30|NC_012943|CRT matches to NZ_CP046705 (Nostoc sp. ATCC 53789 plasmid pNsp_b, complete sequence) position: , mismatch: 5, identity: 0.833

cctgctg--ttcggctccggcggcgctggcgg	CRISPR spacer
--tactgattacggctccggcggtgctggcgg	Protospacer
  *.***  * ************.********

169. spacer 4.15|927155|30|NC_012943|CRT matches to AY950802 (Haloarcula phage SH1, complete genome) position: , mismatch: 5, identity: 0.833

--cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
ggcctac--ttcggctccggcggctccggcgg	Protospacer
  ***.*  *************** *.*****

170. spacer 4.16|927203|24|NC_012943|CRT matches to NC_006911 (Streptomyces sp. F11 plasmid pFP11, complete sequence) position: , mismatch: 5, identity: 0.792

aaccgacctcggcggcgctggcgg	CRISPR spacer
gggcgacctcggcggcgctggcct	Protospacer
.. *******************  

171. spacer 8.6|2360894|27|NC_012943|CRT matches to NZ_CP048282 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248d, complete sequence) position: , mismatch: 5, identity: 0.815

gtcggcggactcgcggctgacgccggt	CRISPR spacer
ggcggcggactcgcggctgtcgccatc	Protospacer
* ***************** ****. .

172. spacer 8.6|2360894|27|NC_012943|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 5, identity: 0.815

gtcggcggactcgcggctgacgccggt	CRISPR spacer
gtcggcggcctcgcggctgatgccata	Protospacer
******** ***********.***.  

173. spacer 8.6|2360894|27|NC_012943|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.815

gtcggcggactcgcggctgacgccggt	CRISPR spacer
ctcggcgcactcgaggctgacgcctgc	Protospacer
 ****** ***** ********** *.

174. spacer 8.6|2360894|27|NC_012943|CRT matches to NZ_CP021355 (Rhodococcus sp. S2-17 plasmid pRB98, complete sequence) position: , mismatch: 5, identity: 0.815

gtcggcggactcgcggctgacgccggt	CRISPR spacer
ggcggcggtttcgcggctgacgccgtc	Protospacer
* ****** .*************** .

175. spacer 8.7|2360939|30|NC_012943|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 5, identity: 0.833

gacggcgggttgttcttcggcgtgggcggt	CRISPR spacer
gccggcgggttgttctgcggcgttggcgca	Protospacer
* ************** ****** ****  

176. spacer 8.7|2360939|30|NC_012943|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833

gacggcgggttgttcttcggcgtgggcggt	CRISPR spacer
gccggcgggttgttctgcggcgttggcgca	Protospacer
* ************** ****** ****  

177. spacer 9.1|2780038|27|NC_012943|CRT matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 5, identity: 0.815

ctgatcagcctgctgggcggccaaggc	CRISPR spacer
ctgatcagcctgctgcgcggcgaacct	Protospacer
*************** ***** **  .

178. spacer 9.1|2780038|27|NC_012943|CRT matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 5, identity: 0.815

ctgatcagcctgctgggcggccaaggc	CRISPR spacer
ctgatcagcctgctgcgcggcgaacct	Protospacer
*************** ***** **  .

179. spacer 9.1|2780038|27|NC_012943|CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 5, identity: 0.815

ctgatcagcctgctgggcggccaaggc	CRISPR spacer
ttgatcagcctgctgcgcggcgaaccc	Protospacer
.************** ***** **  *

180. spacer 9.1|2780038|27|NC_012943|CRT matches to NZ_AP022623 (Mycobacteroides abscessus strain JCM 30620 plasmid pJCM30620_2) position: , mismatch: 5, identity: 0.815

ctgatcagcctgctgggcggccaaggc	CRISPR spacer
gagatcagcctggtgggcggccagcgc	Protospacer
  ********** **********. **

181. spacer 9.1|2780038|27|NC_012943|CRT matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 5, identity: 0.815

ctgatcagcctgctgggcggccaaggc	CRISPR spacer
ttgatcagcctgctgcgcggcgaaccc	Protospacer
.************** ***** **  *

182. spacer 9.1|2780038|27|NC_012943|CRT matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815

ctgatcagcctgctgggcggccaaggc	CRISPR spacer
ctgaccagcctgccgggcggccagatc	Protospacer
****.********.*********.. *

183. spacer 9.1|2780038|27|NC_012943|CRT matches to NC_021278 (Mycobacteroides abscessus subsp. bolletii 50594 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.815

ctgatcagcctgctgggcggccaaggc	CRISPR spacer
gagatcagcctggtgggcggccagcgc	Protospacer
  ********** **********. **

184. spacer 9.2|2780083|27|NC_012943|CRT matches to NZ_CP020568 (Kitasatospora aureofaciens strain DM-1 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815

accggcggggccggcggtgttggcggt	CRISPR spacer
ggcggcgcggccggcggtggtggcggc	Protospacer
. ***** *********** ******.

185. spacer 9.2|2780083|27|NC_012943|CRT matches to NZ_CP044283 (Rhodococcus erythropolis strain X5 plasmid pRhX5, complete sequence) position: , mismatch: 5, identity: 0.815

accggcggggccggcggtgttggcggt	CRISPR spacer
ggggacggggccggcggtgctggcggt	Protospacer
.  *.**************.*******

186. spacer 9.2|2780083|27|NC_012943|CRT matches to NZ_CP018229 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815

accggcggggccggcggtgttggcggt	CRISPR spacer
ggcggcggcgccggcggcgttggcggc	Protospacer
. ****** ********.********.

187. spacer 9.2|2780083|27|NC_012943|CRT matches to NZ_CP022999 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence) position: , mismatch: 5, identity: 0.815

accggcggggccggcggtgttggcggt	CRISPR spacer
accggcgccgccggcggtgttggccag	Protospacer
*******  *************** . 

188. spacer 9.2|2780083|27|NC_012943|CRT matches to NZ_CP019316 (Tateyamaria omphalii strain DOK1-4 plasmid pDOK1-4-4, complete sequence) position: , mismatch: 5, identity: 0.815

accggcggggccggcggtgttggcggt	CRISPR spacer
cccggcggggccgggggtgtgggcgag	Protospacer
 ************* ***** ****. 

189. spacer 9.2|2780083|27|NC_012943|CRT matches to NZ_CP025513 (Neorhizobium sp. SOG26 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.815

accggcggggccggcggtgttggcggt	CRISPR spacer
ggtggcggtgccggcggtgatggcggt	Protospacer
. .***** ********** *******

190. spacer 9.2|2780083|27|NC_012943|CRT matches to NC_048097 (Arthrobacter phage Yang, complete genome) position: , mismatch: 5, identity: 0.815

accggcggggccggcggtgttggcggt	CRISPR spacer
gtcggcggggccagcggtgtcggcggg	Protospacer
..**********.*******.***** 

191. spacer 9.2|2780083|27|NC_012943|CRT matches to MH910037 (Arthrobacter phage Isolde, complete genome) position: , mismatch: 5, identity: 0.815

accggcggggccggcggtgttggcggt	CRISPR spacer
ttgggcggggccgggggtgttgggggt	Protospacer
 . *********** ******** ***

192. spacer 9.2|2780083|27|NC_012943|CRT matches to MN693489 (Marine virus AFVG_25M400, complete genome) position: , mismatch: 5, identity: 0.815

accggcggggccggcggtgttggcggt	CRISPR spacer
ggcggcggtgccggcgctgttggcggc	Protospacer
. ****** ******* *********.

193. spacer 9.2|2780083|27|NC_012943|CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 5, identity: 0.815

accggcggggccggcggtgttggcggt	CRISPR spacer
ggcggcggcgccggcggtgtcggcgga	Protospacer
. ****** ***********.***** 

194. spacer 9.2|2780083|27|NC_012943|CRT matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 5, identity: 0.815

accggcggggccggcggtgttggcggt	CRISPR spacer
tgcggcggcaccggcggtgttggcggc	Protospacer
  ****** .****************.

195. spacer 9.2|2780083|27|NC_012943|CRT matches to MN693270 (Marine virus AFVG_25M401, complete genome) position: , mismatch: 5, identity: 0.815

accggcggggccggcggtgttggcggt	CRISPR spacer
ggcggcggtgccggcgctgttggcggc	Protospacer
. ****** ******* *********.

196. spacer 9.2|2780083|27|NC_012943|CRT matches to MN096376 (Mycobacterium phage Lucyedi, complete genome) position: , mismatch: 5, identity: 0.815

accggcggggccggcggtgttggcggt	CRISPR spacer
ttcggcggggccggtggtggtggcggc	Protospacer
 .************.**** ******.

197. spacer 9.2|2780083|27|NC_012943|CRT matches to NC_023564 (Mycobacterium phage EagleEye, complete genome) position: , mismatch: 5, identity: 0.815

accggcggggccggcggtgttggcggt	CRISPR spacer
ttcggcggggccggtggtggtggcggc	Protospacer
 .************.**** ******.

198. spacer 9.2|2780083|27|NC_012943|CRT matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.815

accggcggggccggcggtgttggcggt	CRISPR spacer
ccaggcggggccggcggggtcggcggc	Protospacer
 * ************** **.*****.

199. spacer 9.2|2780083|27|NC_012943|CRT matches to NZ_CP024986 (Streptomyces lavendulae subsp. lavendulae strain CCM 3239 plasmid pSA3239, complete sequence) position: , mismatch: 5, identity: 0.815

accggcggggccggcggtgttggcggt	CRISPR spacer
ctccgcggtgccggcggtgatggcggt	Protospacer
 .* **** ********** *******

200. spacer 9.2|2780083|27|NC_012943|CRT matches to NZ_CP038636 (Cupriavidus oxalaticus strain X32 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815

accggcggggccggcggtgttggcggt	CRISPR spacer
ttcggcggggccggcggtcttgtcgat	Protospacer
 .**************** *** **.*

201. spacer 9.2|2780083|27|NC_012943|CRT matches to NZ_FO538766 (Magnetospira sp. QH-2 plasmid MGMAQ_p, complete sequence) position: , mismatch: 5, identity: 0.815

accggcggggccggcggtgttggcggt	CRISPR spacer
atgggcagggcgggcggtgttggcggc	Protospacer
*. ***.**** **************.

202. spacer 9.2|2780083|27|NC_012943|CRT matches to MN734439 (Sphingomonas phage Kharn, complete genome) position: , mismatch: 5, identity: 0.815

accggcggggccggcggtgttggcggt	CRISPR spacer
agcggcgggggcggcggtgttggtgtc	Protospacer
* ******** ************.* .

203. spacer 9.2|2780083|27|NC_012943|CRT matches to NC_024970 (Streptomyces aureofaciens strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 5, identity: 0.815

accggcggggccggcggtgttggcggt	CRISPR spacer
ctccgcggtgccggcggtgatggcggt	Protospacer
 .* **** ********** *******

204. spacer 9.2|2780083|27|NC_012943|CRT matches to NZ_KJ396772 (Streptomyces lavendulae subsp. lavendulae strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 5, identity: 0.815

accggcggggccggcggtgttggcggt	CRISPR spacer
ctccgcggtgccggcggtgatggcggt	Protospacer
 .* **** ********** *******

205. spacer 9.2|2780083|27|NC_012943|CRT matches to NC_015314 (Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence) position: , mismatch: 5, identity: 0.815

accggcggggccggcggtgttggcggt	CRISPR spacer
agcggcggggccggcggtggtgtcgac	Protospacer
* ***************** ** **..

206. spacer 9.2|2780083|27|NC_012943|CRT matches to JN699011 (Mycobacterium phage Stinger, complete genome) position: , mismatch: 5, identity: 0.815

accggcggggccggcggtgttggcggt	CRISPR spacer
ttcggcggggctggcggtgtcggcgct	Protospacer
 .*********.********.**** *

207. spacer 9.2|2780083|27|NC_012943|CRT matches to MN234184 (Mycobacterium phage IdentityCrisis, complete genome) position: , mismatch: 5, identity: 0.815

accggcggggccggcggtgttggcggt	CRISPR spacer
gcgggcggggccggcggtgtgggcaat	Protospacer
.* ***************** ***..*

208. spacer 9.2|2780083|27|NC_012943|CRT matches to KR080200 (Mycobacterium phage AlanGrant, complete genome) position: , mismatch: 5, identity: 0.815

accggcggggccggcggtgttggcggt	CRISPR spacer
ttcggcggggctggcggtgtcggcgct	Protospacer
 .*********.********.**** *

209. spacer 9.2|2780083|27|NC_012943|CRT matches to KR080194 (Mycobacterium phage Vincenzo, complete genome) position: , mismatch: 5, identity: 0.815

accggcggggccggcggtgttggcggt	CRISPR spacer
ttcggcggggctggcggtgtcggcgct	Protospacer
 .*********.********.**** *

210. spacer 9.3|2780128|27|NC_012943|CRT matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 5, identity: 0.815

cccggcaaccaggccttcaacgcaggt	CRISPR spacer
cccggcaaccaggccctcagcgctctt	Protospacer
***************.***.***   *

211. spacer 9.3|2780128|27|NC_012943|CRT matches to NZ_CP030832 (Neorhizobium sp. NCHU2750 plasmid pNCHU2750d, complete sequence) position: , mismatch: 5, identity: 0.815

cccggcaaccaggccttcaacgcaggt	CRISPR spacer
cccggcaacccggccttcatcgccgca	Protospacer
********** ******** *** *  

212. spacer 9.3|2780128|27|NC_012943|CRT matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 5, identity: 0.815

cccggcaaccaggccttcaacgcaggt	CRISPR spacer
cccggcaaccaggccctcagcgctctt	Protospacer
***************.***.***   *

213. spacer 9.4|2780173|27|NC_012943|CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.815

catggcggtgaccccggcgccggcggg	CRISPR spacer
ctcggcggtgaccccggcgccggacag	Protospacer
* .********************  .*

214. spacer 9.4|2780173|27|NC_012943|CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 5, identity: 0.815

catggcggtgaccccggcgccggcggg	CRISPR spacer
ctcggcggtgaccccggcgccggacag	Protospacer
* .********************  .*

215. spacer 9.4|2780173|27|NC_012943|CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.815

catggcggtgaccccggcgccggcggg	CRISPR spacer
ctcggcggtgaccccggcgccggacag	Protospacer
* .********************  .*

216. spacer 9.4|2780173|27|NC_012943|CRT matches to NC_018583 (Gordonia sp. KTR9 plasmid pGKT3, complete sequence) position: , mismatch: 5, identity: 0.815

catggcggtgaccccggcgccggcggg	CRISPR spacer
ctgagcggtgaccccggccgcggcggg	Protospacer
*  .**************  *******

217. spacer 9.4|2780173|27|NC_012943|CRT matches to NC_012523 (Rhodococcus opacus B4 plasmid pKNR, complete sequence) position: , mismatch: 5, identity: 0.815

catggcggtgaccccggcgccggcggg	CRISPR spacer
gagggcggtgaccgcggcgtcggcggc	Protospacer
 * ********** *****.****** 

218. spacer 9.4|2780173|27|NC_012943|CRT matches to NC_011143 (Phenylobacterium zucineum HLK1 plasmid, complete sequence) position: , mismatch: 5, identity: 0.815

catggcggtgaccccggcgccggcggg	CRISPR spacer
gaaggcggtgaccgcggcgccgacgga	Protospacer
 * ********** ********.***.

219. spacer 9.4|2780173|27|NC_012943|CRT matches to MK967392 (Gordonia phage GrandSlam, complete genome) position: , mismatch: 5, identity: 0.815

catggcggtgaccccggcgccggcggg	CRISPR spacer
ctcggccgtgactccggcgccggcggc	Protospacer
* .*** *****.************* 

220. spacer 9.4|2780173|27|NC_012943|CRT matches to NZ_CP015867 (Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence) position: , mismatch: 5, identity: 0.815

catggcggtgaccccggcgccggcggg	CRISPR spacer
ggtggcggagagcccggcgccggcgag	Protospacer
 .****** ** *************.*

221. spacer 9.4|2780173|27|NC_012943|CRT matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 5, identity: 0.815

catggcggtgaccccggcgccggcggg	CRISPR spacer
ccaggcggcgaccccggcgccggccgc	Protospacer
*  *****.*************** * 

222. spacer 9.4|2780173|27|NC_012943|CRT matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 5, identity: 0.815

catggcggtgaccccggcgccggcggg	CRISPR spacer
ctcggcggtggccccggcgccggtggt	Protospacer
* .*******.************.** 

223. spacer 9.4|2780173|27|NC_012943|CRT matches to NZ_CP021082 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence) position: , mismatch: 5, identity: 0.815

catggcggtgaccccggcgccggcggg	CRISPR spacer
gctggcggtgaccccggacccggcgcg	Protospacer
  ***************  ****** *

224. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP017077 (Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
gtcggcggcagccgcggcatcggtgcc	Protospacer
. ******.**************** .

225. spacer 9.14|2780815|27|NC_012943|CRT matches to NC_009479 (Clavibacter michiganensis subsp. michiganensis NCPPB 382 plasmid pCM2, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
cgcggcgttagccgcggcatcgctggc	Protospacer
 .***** ************** ***.

226. spacer 9.14|2780815|27|NC_012943|CRT matches to MF417867 (Uncultured Caudovirales phage clone 3F_7, partial genome) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
acgggcggcagccgcggcatcggtgcc	Protospacer
*  *****.**************** .

227. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
ggcggcggtggccgcggcagcggtgct	Protospacer
..*******.********* ***** *

228. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
ggcggcggtggccgcggcagcggtgct	Protospacer
..*******.********* ***** *

229. spacer 9.14|2780815|27|NC_012943|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
ggcggcggtggccgcggcagcggtgct	Protospacer
..*******.********* ***** *

230. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
accggcgccagccgcggcatcggtgcg	Protospacer
* ***** .****************  

231. spacer 9.14|2780815|27|NC_012943|CRT matches to NC_009427 (Novosphingobium aromaticivorans DSM 12444 plasmid pNL2, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
accggcgggagccgcggcatcggccgg	Protospacer
* ****** **************. * 

232. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
ggcggcggtggccgcggcagcggtgct	Protospacer
..*******.********* ***** *

233. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
ggcggcggtggccgcggcagcggtgct	Protospacer
..*******.********* ***** *

234. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
ggcggcggtggccgcggcagcggtgct	Protospacer
..*******.********* ***** *

235. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
accggcggcagccgcggcatcgggcgg	Protospacer
* ******.**************  * 

236. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
ggcggcggtggccgcggcagcggtgct	Protospacer
..*******.********* ***** *

237. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
accggcggcagccgcggcatcggcgcc	Protospacer
* ******.**************.* .

238. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
accggcggcagccgcggcatcggcgcc	Protospacer
* ******.**************.* .

239. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
ggcggcggtggccgcggcagcggtgct	Protospacer
..*******.********* ***** *

240. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
atcggcggttgctgcggcatcggtgcc	Protospacer
* ******* **.************ .

241. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
ggcggcggtggccgcggcagcggtgct	Protospacer
..*******.********* ***** *

242. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
ggcggcggtggccgcggcagcggtgct	Protospacer
..*******.********* ***** *

243. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
ggcggcggtggccgcggcagcggtgct	Protospacer
..*******.********* ***** *

244. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
ggcggcggtggccgcggcagcggtgct	Protospacer
..*******.********* ***** *

245. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
ggcggcggtggccgcggcagcggtgct	Protospacer
..*******.********* ***** *

246. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
ggcggcggtggccgcggcagcggtgct	Protospacer
..*******.********* ***** *

247. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
ggcggcggtggccgcggcagcggtgct	Protospacer
..*******.********* ***** *

248. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
ggcggcggtggccgcggcagcggtgct	Protospacer
..*******.********* ***** *

249. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
ggcggcggtggccgcggcagcggtgct	Protospacer
..*******.********* ***** *

250. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
ggcggcggtggccgcggcagcggtgct	Protospacer
..*******.********* ***** *

251. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP032520 (Cupriavidus oxalaticus strain T2 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
accggcggttcccgcggcatcggtgcc	Protospacer
* *******  ************** .

252. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
accggcggcagccgcggcatcggggcg	Protospacer
* ******.************** *  

253. spacer 9.14|2780815|27|NC_012943|CRT matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
accggcggcagccgcggcatcggcgcg	Protospacer
* ******.**************.*  

254. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
ggcggcggtggccgcggcagcggtgct	Protospacer
..*******.********* ***** *

255. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
ggcggcggtggccgcggcagcggtgct	Protospacer
..*******.********* ***** *

256. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
ggcggcggtggccgcggcagcggtgct	Protospacer
..*******.********* ***** *

257. spacer 9.14|2780815|27|NC_012943|CRT matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
accggcggaagccgcggcatcgggctt	Protospacer
* ****** **************   *

258. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
ggcggcggtggccgcggcagcggtgct	Protospacer
..*******.********* ***** *

259. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
ggcggcggtggccgcggcagcggtgct	Protospacer
..*******.********* ***** *

260. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
accggcgcaagccgcggcatcggtgca	Protospacer
* *****  ****************  

261. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
ggcggcggtggccgcggcagcggtgct	Protospacer
..*******.********* ***** *

262. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
accggcgccagccgcggcatcggtgcg	Protospacer
* ***** .****************  

263. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
ggcggcggtggccgcggcagcggtgct	Protospacer
..*******.********* ***** *

264. spacer 9.14|2780815|27|NC_012943|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
ggcggcggtggccgcggcagcggtgct	Protospacer
..*******.********* ***** *

265. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
ggcggcggtggccgcggcagcggtgct	Protospacer
..*******.********* ***** *

266. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
ggcggcggtggccgcggcagcggtgct	Protospacer
..*******.********* ***** *

267. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
ggcggcggtggccgcggcagcggtgct	Protospacer
..*******.********* ***** *

268. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
ggcggcggtggccgcggcagcggtgct	Protospacer
..*******.********* ***** *

269. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
ggcggcggtggccgcggcagcggtgct	Protospacer
..*******.********* ***** *

270. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
ggcggcggtggccgcggcagcggtgct	Protospacer
..*******.********* ***** *

271. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
ggcggcggtggccgcggcagcggtgct	Protospacer
..*******.********* ***** *

272. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
ggcggcggtggccgcggcagcggtgct	Protospacer
..*******.********* ***** *

273. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
accggcagcagccgcggcatcggtgcc	Protospacer
* ****.*.**************** .

274. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
ggcggcggtggccgcggcagcggtgct	Protospacer
..*******.********* ***** *

275. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
ggcggcggtggccgcggcagcggtgct	Protospacer
..*******.********* ***** *

276. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
ggcggcggtggccgcggcagcggtgct	Protospacer
..*******.********* ***** *

277. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
ggcggcggtggccgcggcagcggtgct	Protospacer
..*******.********* ***** *

278. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
ggcggcggtggccgcggcagcggtgct	Protospacer
..*******.********* ***** *

279. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
ggcggcggtggccgcggcagcggtgct	Protospacer
..*******.********* ***** *

280. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
ggcggcggtggccgcggcagcggtgct	Protospacer
..*******.********* ***** *

281. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
ggcggcggtggccgcggcagcggtgct	Protospacer
..*******.********* ***** *

282. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
accggcgccagccgcggcatcggtgcg	Protospacer
* ***** .****************  

283. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
ggcggcggtggccgcggcagcggtgct	Protospacer
..*******.********* ***** *

284. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
accggcgccagccgcggcatcggtgcg	Protospacer
* ***** .****************  

285. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
ggcggcggtggccgcggcagcggtgct	Protospacer
..*******.********* ***** *

286. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
ggcggcggtggccgcggcagcggtgct	Protospacer
..*******.********* ***** *

287. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
ggcggcggtggccgcggcagcggtgct	Protospacer
..*******.********* ***** *

288. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
ggcggcggtggccgcggcagcggtgct	Protospacer
..*******.********* ***** *

289. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
ggcggcggtggccgcggcagcggtgct	Protospacer
..*******.********* ***** *

290. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
ggcggcggtggccgcggcagcggtgct	Protospacer
..*******.********* ***** *

291. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
ggcggcggtggccgcggcagcggtgct	Protospacer
..*******.********* ***** *

292. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
ggcggcggtggccgcggcagcggtgct	Protospacer
..*******.********* ***** *

293. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
ggcggcggtggccgcggcagcggtgct	Protospacer
..*******.********* ***** *

294. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
ggcggcggtggccgcggcagcggtgct	Protospacer
..*******.********* ***** *

295. spacer 9.14|2780815|27|NC_012943|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
ggcggcggtggccgcggcagcggtgct	Protospacer
..*******.********* ***** *

296. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
ggcggcggtggccgcggcagcggtgct	Protospacer
..*******.********* ***** *

297. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
ggcggcggtggccgcggcagcggtgct	Protospacer
..*******.********* ***** *

298. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
ggcggcggtggccgcggcagcggtgct	Protospacer
..*******.********* ***** *

299. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
ggcggcggtggccgcggcagcggtgct	Protospacer
..*******.********* ***** *

300. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
ggcggcggtggccgcggcagcggtgct	Protospacer
..*******.********* ***** *

301. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
ggcggcggtggccgcggcagcggtgct	Protospacer
..*******.********* ***** *

302. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
ggcggcggtggccgcggcagcggtgct	Protospacer
..*******.********* ***** *

303. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
ggcggcggtggccgcggcagcggtgct	Protospacer
..*******.********* ***** *

304. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
ggcggcggtggccgcggcagcggtgct	Protospacer
..*******.********* ***** *

305. spacer 9.14|2780815|27|NC_012943|CRT matches to MK359341 (Mycobacterium phage GingkoMaracino, complete genome) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
aacggcggcagcggcggcatcggctgg	Protospacer
********.*** **********. * 

306. spacer 9.14|2780815|27|NC_012943|CRT matches to MH536825 (Mycobacterium phage Ollie, complete genome) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
aacggcggcagcggcggcatcggctgg	Protospacer
********.*** **********. * 

307. spacer 9.14|2780815|27|NC_012943|CRT matches to MG252615 (Escherichia phage vB_EcoS_HSE2, complete genome) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
aacggcggtagccgcggcaaccggagc	Protospacer
******************* * * .*.

308. spacer 9.14|2780815|27|NC_012943|CRT matches to NC_021535 (Mycobacterium phage Jobu08, complete genome) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
aacggcggcagcggcggcatcggctgg	Protospacer
********.*** **********. * 

309. spacer 9.14|2780815|27|NC_012943|CRT matches to MN062718 (Mycobacterium phage SoilDragon, complete genome) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
aacggcggcagcggcggcatcggctgg	Protospacer
********.*** **********. * 

310. spacer 9.14|2780815|27|NC_012943|CRT matches to KF279418 (Mycobacterium phage Anubis, complete genome) position: , mismatch: 5, identity: 0.815

aacggcggtagccgcggcatcggtggt	CRISPR spacer
aacggcggcagcggcggcatcggctgg	Protospacer
********.*** **********. * 

311. spacer 10.7|3736956|31|NC_012943|CRT matches to NC_010850 (Rhodococcus sp. NS1 plasmid pNSL1, complete sequence) position: , mismatch: 5, identity: 0.839

aacgccc-acttcaccgccgttgccgccgtca	CRISPR spacer
-acacccgacttcaccgccgctgccgccgaga	Protospacer
 **.*** ************.********  *

312. spacer 1.1|369353|27|NC_012943|CRISPRCasFinder matches to NZ_CP045917 (Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence) position: , mismatch: 6, identity: 0.778

aacgcaccggtgtccacatcgcccgtg	CRISPR spacer
agttcactggtgtccacatcgcccgaa	Protospacer
*.. ***.***************** .

313. spacer 1.6|369683|33|NC_012943|CRISPRCasFinder matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.818

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
agcaggtcgatcacgatctggccgttgccggcg	Protospacer
**   *.***** ******************.*

314. spacer 1.7|369749|27|NC_012943|CRISPRCasFinder matches to NZ_CP022542 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-2, complete sequence) position: , mismatch: 6, identity: 0.778

gcgaagccgatgttgtagctgccggtg	CRISPR spacer
ggataggcgatgttgtagctgccggaa	Protospacer
* . ** ****************** .

315. spacer 1.9|369899|27|NC_012943|CRISPRCasFinder matches to NC_009959 (Dinoroseobacter shibae DFL 12 = DSM 16493 plasmid pDSHI05, complete sequence) position: , mismatch: 6, identity: 0.778

gccaagccgatatcgaagatcccggtg	CRISPR spacer
accatgccgatatcgacgatcccgtcc	Protospacer
.*** *********** ******* . 

316. spacer 1.10|369959|27|NC_012943|CRISPRCasFinder matches to NZ_CP009112 (Rhodococcus opacus strain 1CP plasmid pR1CP1, complete sequence) position: , mismatch: 6, identity: 0.778

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tagacgccgaagtcgaggtcggcgagg	Protospacer
    *********.******* *****

317. spacer 1.10|369959|27|NC_012943|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.778

accccgccgaagttgaggtcgccgagg	CRISPR spacer
ctcccgccgaagttgagggtgccgaac	Protospacer
 .**************** .*****. 

318. spacer 1.10|369959|27|NC_012943|CRISPRCasFinder matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 6, identity: 0.778

accccgccgaagttgaggtcgccgagg	CRISPR spacer
aagaagccgaagttgaggtcgccgtag	Protospacer
*    ******************* .*

319. spacer 1.10|369959|27|NC_012943|CRISPRCasFinder matches to MK494099 (Mycobacterium phage Typha, complete genome) position: , mismatch: 6, identity: 0.778

accccgccgaagttgaggtcgccgagg	CRISPR spacer
cggtcgccgaggtcgaggtcgccgagg	Protospacer
   .******.**.*************

320. spacer 2.2|631597|30|NC_012943|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
gcgccgccggtgactacgccgccagcgaca	Protospacer
.*  **********.*********.****.

321. spacer 2.2|631597|30|NC_012943|CRT matches to KX620751 (Propionibacterium phage Doucette, complete genome) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
gagactccggtgaccacgccgccatcgatg	Protospacer
.  ** ****************** ***.*

322. spacer 2.2|631597|30|NC_012943|CRT matches to NC_041891 (Propionibacterium phage B22, complete genome) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
gagactccggtgaccacgccgccatcgatg	Protospacer
.  ** ****************** ***.*

323. spacer 2.2|631597|30|NC_012943|CRT matches to NC_041894 (Propionibacterium phage E6, complete genome) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
gagactccggtgaccacgccgccatcgatg	Protospacer
.  ** ****************** ***.*

324. spacer 2.2|631597|30|NC_012943|CRT matches to KX620754 (Propionibacterium phage G4, complete genome) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
gagactccggtgaccacgccgccatcgatg	Protospacer
.  ** ****************** ***.*

325. spacer 2.2|631597|30|NC_012943|CRT matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
tccacgccggtgaccacgccgaccaccttg	Protospacer
 ******************** * **  .*

326. spacer 2.2|631597|30|NC_012943|CRT matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
aagaggccggcgagcacgccgccaacgaag	Protospacer
*  * *****.** ************** *

327. spacer 2.2|631597|30|NC_012943|CRT matches to MT818419 (Mycobacterium phage Lolalove, complete genome) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg	Protospacer
*.*. * ****************. *****

328. spacer 2.2|631597|30|NC_012943|CRT matches to MN428050 (Mycobacterium phage Apex, complete genome) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg	Protospacer
*.*. * ****************. *****

329. spacer 2.2|631597|30|NC_012943|CRT matches to MN234171 (Mycobacterium phage Magpie, complete genome) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg	Protospacer
*.*. * ****************. *****

330. spacer 2.2|631597|30|NC_012943|CRT matches to KX589269 (Mycobacterium phage Fortunato, complete genome) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg	Protospacer
*.*. * ****************. *****

331. spacer 2.2|631597|30|NC_012943|CRT matches to NC_042035 (Mycobacterium phage Zemanar, complete sequence) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg	Protospacer
*.*. * ****************. *****

332. spacer 2.2|631597|30|NC_012943|CRT matches to NC_022331 (Mycobacterium phage Bane1, complete genome) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg	Protospacer
*.*. * ****************. *****

333. spacer 2.2|631597|30|NC_012943|CRT matches to KF279413 (Mycobacterium phage Bane2, complete genome) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg	Protospacer
*.*. * ****************. *****

334. spacer 2.2|631597|30|NC_012943|CRT matches to MT310870 (Mycobacterium phage RawrgerThat, complete genome) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg	Protospacer
*.*. * ****************. *****

335. spacer 3.1|692300|31|NC_012943|CRISPRCasFinder matches to GQ141189 (Bifidobacterium phage Bbif-1, complete sequence) position: , mismatch: 6, identity: 0.806

agcgcgaacggcaagccgaac----cgttggaccc	CRISPR spacer
agcgcgaacggccagccgaaccatgcgctgg----	Protospacer
************ ********    **.***    

336. spacer 4.6|926762|27|NC_012943|CRT matches to NZ_LN907829 (Erwinia gerundensis isolate E_g_EM595 plasmid pEM02, complete sequence) position: , mismatch: 6, identity: 0.778

cgtcagcggcggggctggcggggaggg	CRISPR spacer
tgtaagcggctgggctggcggggatat	Protospacer
.** ****** ************* . 

337. spacer 4.6|926762|27|NC_012943|CRT matches to NZ_CP041653 (Streptomyces sp. RLB1-9 plasmid pRLB1-9.1, complete sequence) position: , mismatch: 6, identity: 0.778

cgtcagcggcggggctggcggggaggg	CRISPR spacer
tgtcagcggcggggctggcgttcatcg	Protospacer
.*******************   *  *

338. spacer 4.6|926762|27|NC_012943|CRT matches to NZ_CP010826 (Thermus aquaticus Y51MC23 plasmid pTA78, complete sequence) position: , mismatch: 6, identity: 0.778

cgtcagcggcggggctggcggggaggg	CRISPR spacer
tagaagcggcggggctggtggagaggg	Protospacer
..  **************.**.*****

339. spacer 4.6|926762|27|NC_012943|CRT matches to NZ_CP054620 (Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence) position: , mismatch: 6, identity: 0.778

cgtcagcggcggggctggcggggaggg	CRISPR spacer
gcgcaccggcggggctggcggggcggc	Protospacer
   ** ***************** ** 

340. spacer 4.10|926918|27|NC_012943|CRT matches to NZ_AP021845 (Azospira sp. I09 plasmid pAZI09, complete sequence) position: , mismatch: 6, identity: 0.778

cggatccggcggcggcggtagcgttgc	CRISPR spacer
cggatcctgcggcggcggtagaaagcc	Protospacer
******* ************* .   *

341. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
gagcgtcggcctgctggtcggcttcggcgc	Protospacer
 ..**.*****************.***** 

342. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
gagcgtcggcctgctggtcggcttcggcgc	Protospacer
 ..**.*****************.***** 

343. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgacgacggcctggtggtcggctacctcga	Protospacer
***** ******* ********* *  **.

344. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgcgatcggcctgctgctcggcaccggcgg	Protospacer
**  ..********** ***** *******

345. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgcgatcggcctgctgctcggcaccggcgg	Protospacer
**  ..********** ***** *******

346. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgcgcgcggcgtgccggtcggctccggcgg	Protospacer
**    **** ***.***************

347. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP053207 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgcgatcggcctgctgctcggcaccggcgg	Protospacer
**  ..********** ***** *******

348. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgcgcgcggcgtgccggtcggctccggcgg	Protospacer
**    **** ***.***************

349. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgcggcgggcctgctggtcggcttcggcac	Protospacer
**  ** ****************.****. 

350. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

351. spacer 4.13|927059|30|NC_012943|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

352. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

353. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP037868 (Hydrogenophaga pseudoflava strain DSM 1084 plasmid pDSM1084, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcg----gctccggcgg	CRISPR spacer
cgacgccggccggctggtcggagagctgcg----	Protospacer
*********** ********    *** **    

354. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

355. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

356. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP023549 (Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgtcgccggcctgctgatcggcttcttctg	Protospacer
** *************.******.*  * *

357. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

358. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

359. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

360. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

361. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

362. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

363. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

364. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

365. spacer 4.13|927059|30|NC_012943|CRT matches to NC_019408 (Caulobacter phage CcrRogue, complete genome) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgtcatcggcctgctggtcgtcgccggcgc	Protospacer
** *..************** * ****** 

366. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgacgccgacctgctggtcggggcggactg	Protospacer
********.************  * *.* *

367. spacer 4.15|927155|30|NC_012943|CRT matches to NZ_CP017941 (Phyllobacterium zundukense strain Tri-48 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
caagctggtcggccccggcggcgctggcaa	Protospacer
*  **** *****.**************..

368. spacer 4.15|927155|30|NC_012943|CRT matches to MK937608 (Microbacterium phage Cressida, complete genome) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tcacctgtccggctccggcggcggtggcga	Protospacer
.*  ****.************** *****.

369. spacer 4.15|927155|30|NC_012943|CRT matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cctgctgctcggcaccggcggcgcgcttgg	Protospacer
*******.***** **********   .**

370. spacer 4.15|927155|30|NC_012943|CRT matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cctgctgctcggcaccggcggcgcgcttgg	Protospacer
*******.***** **********   .**

371. spacer 4.15|927155|30|NC_012943|CRT matches to NZ_CP017592 (Pantoea stewartii subsp. stewartii DC283 plasmid ppDSJ01, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg--	CRISPR spacer
tctgctgttcggctgcggcggcg--agcagcg	Protospacer
.************* ********  .**.*  

372. spacer 4.15|927155|30|NC_012943|CRT matches to NZ_CP008898 (Enterobacter hormaechei subsp. hoffmannii ECNIH3 plasmid pENT-576, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gctgctgttcggcgccgccggcgctattgg	Protospacer
 ************ *** *******. .**

373. spacer 4.15|927155|30|NC_012943|CRT matches to NZ_CP023489 (Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_02, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gctgctgttcggcgccgccggcgctattgg	Protospacer
 ************ *** *******. .**

374. spacer 4.15|927155|30|NC_012943|CRT matches to NZ_CP043515 (Enterobacter kobei strain EB_P8_L5_01.19 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gctgctgttcggcgccgccggcgctattgg	Protospacer
 ************ *** *******. .**

375. spacer 4.15|927155|30|NC_012943|CRT matches to NZ_CP053207 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cctgctgctcggcaccggcggcgcgcttgg	Protospacer
*******.***** **********   .**

376. spacer 4.15|927155|30|NC_012943|CRT matches to NZ_LT984809 (Cupriavidus taiwanensis isolate Cupriavidus taiwanensis STM 8555 plasmid I, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
catcgcgctcggcttcggcggcgctggcgg	Protospacer
* *  .*.******.***************

377. spacer 4.15|927155|30|NC_012943|CRT matches to NZ_CP026371 (Klebsiella quasipneumoniae strain A708 plasmid pA708-3, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gctgctgttcggcgccgccggcgctattgg	Protospacer
 ************ *** *******. .**

378. spacer 4.15|927155|30|NC_012943|CRT matches to NZ_CP050069 (Klebsiella aerogenes strain 035 plasmid p035_A-VIM-1, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gctgctgttcggcgccgccggcgctattgg	Protospacer
 ************ *** *******. .**

379. spacer 4.15|927155|30|NC_012943|CRT matches to NZ_CP039425 (Citricoccus sp. SGAir0253 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cctgctgttcggcaccgacggcgccctccg	Protospacer
************* ***.******.  * *

380. spacer 4.15|927155|30|NC_012943|CRT matches to NZ_CP009856 (UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH5 plasmid pENT-784, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gctgctgttcggcgccgccggcgctattgg	Protospacer
 ************ *** *******. .**

381. spacer 4.15|927155|30|NC_012943|CRT matches to NZ_CP039430 (Citricoccus sp. SGAir0453 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cctgctgttcggcaccgacggcgccctccg	Protospacer
************* ***.******.  * *

382. spacer 4.15|927155|30|NC_012943|CRT matches to NZ_CP040937 (Hymenobacter sp. DG01 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgt-tcggctccggcggcgctggcgg	CRISPR spacer
-ccgccgcgccggctccggccgcgctggcgg	Protospacer
 *.**.*. .********** **********

383. spacer 4.15|927155|30|NC_012943|CRT matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cgtccagctcggcgccggcggcgctggcgt	Protospacer
* * * *.***** *************** 

384. spacer 4.15|927155|30|NC_012943|CRT matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cgtccagctcggcgccggcggcgctggcgt	Protospacer
* * * *.***** *************** 

385. spacer 4.15|927155|30|NC_012943|CRT matches to NZ_CP006588 (Hymenobacter sp. APR13 plasmid pHA, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgt-tcggctccggcggcgctggcgg	CRISPR spacer
-ccgccgcgccggctccggccgcgctggcgg	Protospacer
 *.**.*. .********** **********

386. spacer 4.15|927155|30|NC_012943|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgtt--cggctccggcggcgctggcgg	CRISPR spacer
--cgccgctggcggcgccggcggcgctggcgg	Protospacer
  .**.*.*  **** ****************

387. spacer 4.15|927155|30|NC_012943|CRT matches to NZ_AP022333 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgtt----cggctccggcggcgctggcgg	CRISPR spacer
----cagttggggcggctccggcggcgcgggcgg	Protospacer
    * ***    *************** *****

388. spacer 4.15|927155|30|NC_012943|CRT matches to MH029534 (Myoviridae environmental samples clone NHS-Seq2, complete sequence) position: , mismatch: 6, identity: 0.8

-cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
atttggt-ttcggcgctggcggcgctggcgg	Protospacer
 ..** * ****** *.**************

389. spacer 4.17|927245|36|NC_012943|CRT matches to MT723940 (Mycobacterium phage Ellie, complete genome) position: , mismatch: 6, identity: 0.833

gctgatcggcaacggcggtaacggcggggccggcgg	CRISPR spacer
cgttgtcggcaacggcggtaacggcgggggtggcgg	Protospacer
  * .************************ .*****

390. spacer 8.6|2360894|27|NC_012943|CRT matches to NZ_AP022566 (Mycolicibacterium alvei strain JCM 12272 plasmid pJCM12272, complete sequence) position: , mismatch: 6, identity: 0.778

gtcggcggactcgcggctgacgccggt	CRISPR spacer
cccggcggacgcgcagctgacgccgcg	Protospacer
 .******** ***.**********  

391. spacer 8.6|2360894|27|NC_012943|CRT matches to NZ_AP014706 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_2p, complete sequence) position: , mismatch: 6, identity: 0.778

gtcggcggactcgcggctgacgccggt	CRISPR spacer
cccgtcggactcgcggctggcgccgta	Protospacer
 .** **************.*****  

392. spacer 8.7|2360939|30|NC_012943|CRT matches to NZ_CP021082 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence) position: , mismatch: 6, identity: 0.8

gacggcgggttgttcttcggcgtgggcggt	CRISPR spacer
gtgagcgggttgttcctcggcgtggggggc	Protospacer
*  .***********.********** **.

393. spacer 8.7|2360939|30|NC_012943|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

gacggcgggttgttcttcggcgtgggcggt	CRISPR spacer
gccggcgggttgttctgcggcgttggtgca	Protospacer
* ************** ****** **.*  

394. spacer 8.7|2360939|30|NC_012943|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

gacggcgggttgttcttcggcgtgggcggt	CRISPR spacer
gccggcgggttgttctgcggcgttggtgca	Protospacer
* ************** ****** **.*  

395. spacer 9.1|2780038|27|NC_012943|CRT matches to NZ_LR594691 (Variovorax sp. WDL1 plasmid 3) position: , mismatch: 6, identity: 0.778

ctgatcagcctgctgggcggccaaggc	CRISPR spacer
ggtctcggcctgcttggcggccaaggc	Protospacer
    **.******* ************

396. spacer 9.1|2780038|27|NC_012943|CRT matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 6, identity: 0.778

ctgatcagcctgctgggcggccaaggc	CRISPR spacer
ctgatcagcctgctgcgcggcgagcct	Protospacer
*************** ***** *.  .

397. spacer 9.1|2780038|27|NC_012943|CRT matches to NZ_CP034811 (Paracoccus sp. Arc7-R13 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.778

ctgatcagcctgctgggcggccaaggc	CRISPR spacer
ctgatccgcctgctgggcggcaacctg	Protospacer
****** ************** *    

398. spacer 9.1|2780038|27|NC_012943|CRT matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.778

ctgatcagcctgctgggcggccaaggc	CRISPR spacer
ctgatcagcctgctgcgcggcggcacc	Protospacer
*************** ***** . . *

399. spacer 9.1|2780038|27|NC_012943|CRT matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 6, identity: 0.778

ctgatcagcctgctgggcggccaaggc	CRISPR spacer
ctgatcggcctgctgggcggcattgca	Protospacer
******.**************   *  

400. spacer 9.2|2780083|27|NC_012943|CRT matches to NZ_CP011274 (Planctomyces sp. SH-PL62 plasmid pPL62-1, complete sequence) position: , mismatch: 6, identity: 0.778

accggcggggccggcggtgttggcggt	CRISPR spacer
cgccgcggggccggcggtgttggcctg	Protospacer
  * ********************   

401. spacer 9.2|2780083|27|NC_012943|CRT matches to NZ_CP032676 (Rhodococcus rhodochrous strain ATCC BAA870 plasmid pNit, complete sequence) position: , mismatch: 6, identity: 0.778

accggcggggccggcggtgttggcggt	CRISPR spacer
tatcgcggggcgggcggtgtaggcggt	Protospacer
  . ******* ******** ******

402. spacer 9.2|2780083|27|NC_012943|CRT matches to NZ_AP022580 (Mycolicibacterium boenickei strain JCM 15653 plasmid pJCM15653, complete sequence) position: , mismatch: 6, identity: 0.778

accggcggggccggcggtgttggcggt	CRISPR spacer
taggccggggcgggcggtgttggcggc	Protospacer
   * ****** **************.

403. spacer 9.2|2780083|27|NC_012943|CRT matches to NZ_CP038238 (Leisingera sp. NJS201 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.778

accggcggggccggcggtgttggcggt	CRISPR spacer
atcggcggggcaggcggtgttggttcg	Protospacer
*.********* ***********.   

404. spacer 9.2|2780083|27|NC_012943|CRT matches to NZ_CP033823 (Klebsiella sp. FDAARGOS_511 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.778

accggcggggccggcggtgttggcggt	CRISPR spacer
ggtggcggggccgccggtattggcggc	Protospacer
. .********** ****.*******.

405. spacer 9.2|2780083|27|NC_012943|CRT matches to NC_023285 (Streptomyces sp. F8 plasmid pFRL5, complete sequence) position: , mismatch: 6, identity: 0.778

accggcggggccggcggtgttggcggt	CRISPR spacer
cgaggcggggccggcggtgttgcgggg	Protospacer
   *******************  ** 

406. spacer 9.2|2780083|27|NC_012943|CRT matches to NZ_CP011633 (Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-150, complete sequence) position: , mismatch: 6, identity: 0.778

accggcggggccggcggtgttggcggt	CRISPR spacer
ggtggcggggccgccggtattggcggc	Protospacer
. .********** ****.*******.

407. spacer 9.2|2780083|27|NC_012943|CRT matches to NZ_CP009030 (Xanthomonas citri pv. citri strain AW13 plasmid pXCAW58, complete sequence) position: , mismatch: 6, identity: 0.778

accggcggggccggcggtgttggcggt	CRISPR spacer
tccggcggggccggcagcgttggcccg	Protospacer
 **************.*.******   

408. spacer 9.2|2780083|27|NC_012943|CRT matches to NZ_CP009039 (Xanthomonas citri pv. citri strain AW16 plasmid pXCAW58, complete sequence) position: , mismatch: 6, identity: 0.778

accggcggggccggcggtgttggcggt	CRISPR spacer
tccggcggggccggcagcgttggcccg	Protospacer
 **************.*.******   

409. spacer 9.2|2780083|27|NC_012943|CRT matches to NZ_CP032053 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL2, complete sequence) position: , mismatch: 6, identity: 0.778

accggcggggccggcggtgttggcggt	CRISPR spacer
cggggccgggccgccggtgttggcggg	Protospacer
   *** ****** ************ 

410. spacer 9.2|2780083|27|NC_012943|CRT matches to NZ_CP025552 (Streptomyces rimosus strain WT5260 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778

accggcggggccggcggtgttggcggt	CRISPR spacer
cattgcggggccggcgatgttggccgt	Protospacer
  . ************.******* **

411. spacer 9.2|2780083|27|NC_012943|CRT matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 6, identity: 0.778

accggcggggccggcggtgttggcggt	CRISPR spacer
gccggcgggaccgtcggtgttggccac	Protospacer
.********.*** ********** ..

412. spacer 9.3|2780128|27|NC_012943|CRT matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 6, identity: 0.778

cccggcaaccaggccttcaacgcaggt	CRISPR spacer
gccggcaaccaggccttcgacgtgcgc	Protospacer
 *****************.***.. *.

413. spacer 9.4|2780173|27|NC_012943|CRT matches to NZ_CP014514 (Frondihabitans sp. PAMC 28766 strain SR6 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.778

catggcggtgaccccggcgccggcggg	CRISPR spacer
ggaggaggtgaccccggcgccggcgtt	Protospacer
 . ** *******************  

414. spacer 9.4|2780173|27|NC_012943|CRT matches to NZ_CP023524 (Burkholderia gladioli pv. gladioli strain FDAARGOS_389 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778

catggcggtgaccccggcgccggcggg	CRISPR spacer
agccgcggtggccccggcgccggcggc	Protospacer
 .. ******.*************** 

415. spacer 9.4|2780173|27|NC_012943|CRT matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.778

catggcggtgaccccggcgccggcggg	CRISPR spacer
gtcggcggtgaccaccgcgccggcggc	Protospacer
  .********** * ********** 

416. spacer 9.4|2780173|27|NC_012943|CRT matches to NZ_CP015095 (Pelagibaca abyssi strain JLT2014 plasmid pPABY4, complete sequence) position: , mismatch: 6, identity: 0.778

catggcggtgaccccggcgccggcggg	CRISPR spacer
ggcgccggtgaccccggcggcggcggc	Protospacer
 ..* ************** ****** 

417. spacer 9.4|2780173|27|NC_012943|CRT matches to NZ_CP054842 (Acidovorax sp. 16-35-5 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.778

catggcggtgaccccggcgccggcggg	CRISPR spacer
aatgacggtgacctcggcgccggcctt	Protospacer
 ***.********.**********   

418. spacer 9.4|2780173|27|NC_012943|CRT matches to NZ_CP023152 (Mycobacterium chimaera strain FLAC0070 plasmid pFLAC0070_1, complete sequence) position: , mismatch: 6, identity: 0.778

catggcggtgaccccggcgccggcggg	CRISPR spacer
ggcggcggtgacggcggcgccggcggt	Protospacer
 ..*********  ************ 

419. spacer 9.4|2780173|27|NC_012943|CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 6, identity: 0.778

catggcggtgaccccggcgccggcggg	CRISPR spacer
ttgggcgctgaccccggcgccggagga	Protospacer
.  **** *************** **.

420. spacer 9.4|2780173|27|NC_012943|CRT matches to NZ_CP046573 (Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence) position: , mismatch: 6, identity: 0.778

catggcggtgaccccggcgccggcggg	CRISPR spacer
ggtggcggtgacccaggcggcggcgtt	Protospacer
 .************ **** *****  

421. spacer 9.4|2780173|27|NC_012943|CRT matches to MH697582 (Mycobacterium phage Ejimix, complete genome) position: , mismatch: 6, identity: 0.778

catggcggtgaccccggcgccggcggg	CRISPR spacer
ggtggcgatggccccggcgccggcgac	Protospacer
 .*****.**.**************. 

422. spacer 9.4|2780173|27|NC_012943|CRT matches to MK967402 (Mycobacterium phage NihilNomen, complete genome) position: , mismatch: 6, identity: 0.778

catggcggtgaccccggcgccggcggg	CRISPR spacer
ggtggcgatggccccggcgccggcgac	Protospacer
 .*****.**.**************. 

423. spacer 9.4|2780173|27|NC_012943|CRT matches to MN586029 (Mycobacterium phage Hannaconda, complete genome) position: , mismatch: 6, identity: 0.778

catggcggtgaccccggcgccggcggg	CRISPR spacer
ggtggcgatggccccggcgccggcgac	Protospacer
 .*****.**.**************. 

424. spacer 9.4|2780173|27|NC_012943|CRT matches to MH697583 (Mycobacterium phage EricMillard, complete genome) position: , mismatch: 6, identity: 0.778

catggcggtgaccccggcgccggcggg	CRISPR spacer
ggtggcgatggccccggcgccggcgat	Protospacer
 .*****.**.**************. 

425. spacer 9.4|2780173|27|NC_012943|CRT matches to MH727551 (Mycobacterium phage Kalah2, complete genome) position: , mismatch: 6, identity: 0.778

catggcggtgaccccggcgccggcggg	CRISPR spacer
ggtggcgatggccccggcgccggcgac	Protospacer
 .*****.**.**************. 

426. spacer 9.4|2780173|27|NC_012943|CRT matches to MF919504 (Mycobacterium phage DmpstrDiver, complete genome) position: , mismatch: 6, identity: 0.778

catggcggtgaccccggcgccggcggg	CRISPR spacer
ggtggcgatggccccggcgccggcgac	Protospacer
 .*****.**.**************. 

427. spacer 9.4|2780173|27|NC_012943|CRT matches to MH399772 (Mycobacterium phage Constella, complete genome) position: , mismatch: 6, identity: 0.778

catggcggtgaccccggcgccggcggg	CRISPR spacer
ggtggcgatggccccggcgccggcgac	Protospacer
 .*****.**.**************. 

428. spacer 9.4|2780173|27|NC_012943|CRT matches to MH077579 (Mycobacterium phage Halley, complete genome) position: , mismatch: 6, identity: 0.778

catggcggtgaccccggcgccggcggg	CRISPR spacer
ggtggcgatggccccggcgccggcgac	Protospacer
 .*****.**.**************. 

429. spacer 9.4|2780173|27|NC_012943|CRT matches to JF937090 (Mycobacterium virus BAKA, complete genome) position: , mismatch: 6, identity: 0.778

catggcggtgaccccggcgccggcggg	CRISPR spacer
ggtggcgatggccccggcgccggcgac	Protospacer
 .*****.**.**************. 

430. spacer 9.4|2780173|27|NC_012943|CRT matches to MH669017 (Mycobacterium phage Zelink, complete genome) position: , mismatch: 6, identity: 0.778

catggcggtgaccccggcgccggcggg	CRISPR spacer
ggtggcgatggccccggcgccggcgac	Protospacer
 .*****.**.**************. 

431. spacer 9.4|2780173|27|NC_012943|CRT matches to MK524521 (Mycobacterium phage Schatzie, complete genome) position: , mismatch: 6, identity: 0.778

catggcggtgaccccggcgccggcggg	CRISPR spacer
ggtggcgatggccccggcgccggcgac	Protospacer
 .*****.**.**************. 

432. spacer 9.4|2780173|27|NC_012943|CRT matches to NC_004688 (Mycobacterium phage Omega, complete genome) position: , mismatch: 6, identity: 0.778

catggcggtgaccccggcgccggcggg	CRISPR spacer
ggtggcgatggccccggcgccggcgac	Protospacer
 .*****.**.**************. 

433. spacer 9.4|2780173|27|NC_012943|CRT matches to MF133445 (Mycobacterium phage Lucky2013, complete genome) position: , mismatch: 6, identity: 0.778

catggcggtgaccccggcgccggcggg	CRISPR spacer
ggtggcgatggccccggcgccggcgac	Protospacer
 .*****.**.**************. 

434. spacer 9.4|2780173|27|NC_012943|CRT matches to MK524516 (Mycobacterium phage Bobby, complete genome) position: , mismatch: 6, identity: 0.778

catggcggtgaccccggcgccggcggg	CRISPR spacer
ggtggcgatggccccggcgccggcgac	Protospacer
 .*****.**.**************. 

435. spacer 9.4|2780173|27|NC_012943|CRT matches to MF072690 (Mycobacterium phage Porcelain, complete genome) position: , mismatch: 6, identity: 0.778

catggcggtgaccccggcgccggcggg	CRISPR spacer
ggtggcgatggccccggcgccggcgac	Protospacer
 .*****.**.**************. 

436. spacer 9.4|2780173|27|NC_012943|CRT matches to MN062701 (Mycobacterium phage Dallas, complete genome) position: , mismatch: 6, identity: 0.778

catggcggtgaccccggcgccggcggg	CRISPR spacer
ggtggcgatggccccggcgccggcgat	Protospacer
 .*****.**.**************. 

437. spacer 9.4|2780173|27|NC_012943|CRT matches to AY129338 (Mycobacterium virus Omega, complete genome) position: , mismatch: 6, identity: 0.778

catggcggtgaccccggcgccggcggg	CRISPR spacer
ggtggcgatggccccggcgccggcgac	Protospacer
 .*****.**.**************. 

438. spacer 9.4|2780173|27|NC_012943|CRT matches to NC_041844 (Mycobacterium phage Optimus, complete genome) position: , mismatch: 6, identity: 0.778

catggcggtgaccccggcgccggcggg	CRISPR spacer
ggtggcgatggccccggcgccggcgat	Protospacer
 .*****.**.**************. 

439. spacer 9.4|2780173|27|NC_012943|CRT matches to MK524527 (Mycobacterium phage ThreeRngTarjay, complete genome) position: , mismatch: 6, identity: 0.778

catggcggtgaccccggcgccggcggg	CRISPR spacer
ggtggcgatggccccggcgccggcgac	Protospacer
 .*****.**.**************. 

440. spacer 9.4|2780173|27|NC_012943|CRT matches to MK279849 (Mycobacterium phage Duke13, complete genome) position: , mismatch: 6, identity: 0.778

catggcggtgaccccggcgccggcggg	CRISPR spacer
ggtggcgatggccccggcgccggcgat	Protospacer
 .*****.**.**************. 

441. spacer 9.4|2780173|27|NC_012943|CRT matches to JF937101 (Mycobacterium virus LittleE, complete genome) position: , mismatch: 6, identity: 0.778

catggcggtgaccccggcgccggcggg	CRISPR spacer
ggtggcgatggccccggcgccggcgac	Protospacer
 .*****.**.**************. 

442. spacer 9.4|2780173|27|NC_012943|CRT matches to MN183286 (Mycobacteriophage Yeet, complete genome) position: , mismatch: 6, identity: 0.778

catggcggtgaccccggcgccggcggg	CRISPR spacer
ggtggcgatggccccggcgccggcgac	Protospacer
 .*****.**.**************. 

443. spacer 9.4|2780173|27|NC_012943|CRT matches to MK524529 (Mycobacterium phage Phoebus, complete genome) position: , mismatch: 6, identity: 0.778

catggcggtgaccccggcgccggcggg	CRISPR spacer
ggtggcgatggccccggcgccggcgac	Protospacer
 .*****.**.**************. 

444. spacer 9.4|2780173|27|NC_012943|CRT matches to KM400683 (Mycobacterium phage Ariel, complete genome) position: , mismatch: 6, identity: 0.778

catggcggtgaccccggcgccggcggg	CRISPR spacer
ggtggcgatggccccggcgccggcgac	Protospacer
 .*****.**.**************. 

445. spacer 9.4|2780173|27|NC_012943|CRT matches to JN201525 (Mycobacterium phage Thibault, complete genome) position: , mismatch: 6, identity: 0.778

catggcggtgaccccggcgccggcggg	CRISPR spacer
ggtggcgatggccccggcgccggcgac	Protospacer
 .*****.**.**************. 

446. spacer 9.4|2780173|27|NC_012943|CRT matches to MF919512 (Mycobacterium phage Klein, complete genome) position: , mismatch: 6, identity: 0.778

catggcggtgaccccggcgccggcggg	CRISPR spacer
ggtggcgatggccccggcgccggcgat	Protospacer
 .*****.**.**************. 

447. spacer 9.4|2780173|27|NC_012943|CRT matches to MF919534 (Mycobacterium phage Superphikiman, complete genome) position: , mismatch: 6, identity: 0.778

catggcggtgaccccggcgccggcggg	CRISPR spacer
ggtggcgatggccccggcgccggcgac	Protospacer
 .*****.**.**************. 

448. spacer 9.4|2780173|27|NC_012943|CRT matches to NC_023690 (Mycobacterium phage Courthouse, complete genome) position: , mismatch: 6, identity: 0.778

catggcggtgaccccggcgccggcggg	CRISPR spacer
ggtggcgatggccccggcgccggcgac	Protospacer
 .*****.**.**************. 

449. spacer 9.4|2780173|27|NC_012943|CRT matches to KF114875 (Mycobacterium phage Redno2, complete genome) position: , mismatch: 6, identity: 0.778

catggcggtgaccccggcgccggcggg	CRISPR spacer
ggtggcgatggccccggcgccggcgat	Protospacer
 .*****.**.**************. 

450. spacer 9.4|2780173|27|NC_012943|CRT matches to NC_022067 (Mycobacterium phage Wanda, complete genome) position: , mismatch: 6, identity: 0.778

catggcggtgaccccggcgccggcggg	CRISPR spacer
ggtggcgatggccccggcgccggcgat	Protospacer
 .*****.**.**************. 

451. spacer 9.4|2780173|27|NC_012943|CRT matches to MK524504 (Mycobacterium phage Hughesyang, complete genome) position: , mismatch: 6, identity: 0.778

catggcggtgaccccggcgccggcggg	CRISPR spacer
ggtggcgatggccccggcgccggcgac	Protospacer
 .*****.**.**************. 

452. spacer 9.4|2780173|27|NC_012943|CRT matches to MK967379 (Mycobacterium phage HokkenD, complete genome) position: , mismatch: 6, identity: 0.778

catggcggtgaccccggcgccggcggg	CRISPR spacer
ggtggcgatggccccggcgccggcgac	Protospacer
 .*****.**.**************. 

453. spacer 9.4|2780173|27|NC_012943|CRT matches to NC_028953 (Mycobacterium phage MiaZeal, complete genome) position: , mismatch: 6, identity: 0.778

catggcggtgaccccggcgccggcggg	CRISPR spacer
ggtggcgatggccccggcgccggcgac	Protospacer
 .*****.**.**************. 

454. spacer 9.4|2780173|27|NC_012943|CRT matches to MF668284 (Mycobacterium phage Squint, complete genome) position: , mismatch: 6, identity: 0.778

catggcggtgaccccggcgccggcggg	CRISPR spacer
ggtggcgatggccccggcgccggcgac	Protospacer
 .*****.**.**************. 

455. spacer 9.4|2780173|27|NC_012943|CRT matches to NC_023285 (Streptomyces sp. F8 plasmid pFRL5, complete sequence) position: , mismatch: 6, identity: 0.778

catggcggtgaccccggcgccggcggg	CRISPR spacer
ggtggcggtgaccccgacgccgggcgc	Protospacer
 .**************.******  * 

456. spacer 9.13|2780767|30|NC_012943|CRT matches to KF692088 (Arthrobacter phage vB_ArS-ArV2, complete genome) position: , mismatch: 6, identity: 0.8

aagggcacgttcgataacggcggcgatgga	CRISPR spacer
acggcgacgttcgataacgacggcgatgtc	Protospacer
* **  *************.********  

457. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP050092 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence) position: , mismatch: 6, identity: 0.778

aacggcggtagccgcggcatcggtggt	CRISPR spacer
cgtggcggaagcctcggcatcggtgga	Protospacer
 ..***** **** ************ 

458. spacer 10.7|3736956|31|NC_012943|CRT matches to NC_009478 (Clavibacter michiganensis subsp. michiganensis NCPPB 382 plasmid pCM1, complete sequence) position: , mismatch: 6, identity: 0.806

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgaccacttcaccgccgtcgccgccggcg	Protospacer
. ** ***************.******* *.

459. spacer 1.4|369548|27|NC_012943|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.741

aagccgcccgagttcgcgagaccgaag	CRISPR spacer
tgaccgcccgagttcgcgagacgttgg	Protospacer
 ..*******************   .*

460. spacer 2.2|631597|30|NC_012943|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
taggcgccggtgaccccgccgccgacgatg	Protospacer
   .*********** *******.****.*

461. spacer 2.2|631597|30|NC_012943|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
tgcgtggcggtgaccacgccgccaatggcg	Protospacer
  *..* ******************.*.**

462. spacer 2.2|631597|30|NC_012943|CRT matches to LR134127 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7) position: , mismatch: 7, identity: 0.767

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
atagcgccggtcaccgcgccgccaacgata	Protospacer
*. .******* ***.************..

463. spacer 2.2|631597|30|NC_012943|CRT matches to NC_005241 (Cupriavidus necator H16 megaplasmid pHG1, complete sequence) position: , mismatch: 7, identity: 0.767

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
acctcgtcggtgaccacgccgccgtgcagg	Protospacer
*** **.****************.   * *

464. spacer 2.2|631597|30|NC_012943|CRT matches to NZ_CP012477 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
accacgccggtgacctcaccgcccgctgtg	Protospacer
*************** *.***** .* ..*

465. spacer 2.2|631597|30|NC_012943|CRT matches to NZ_CP012478 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
accacgccggtgacctcaccgcccgctgtg	Protospacer
*************** *.***** .* ..*

466. spacer 2.2|631597|30|NC_012943|CRT matches to NZ_CP039289 (Cupriavidus necator H16 plasmid pHG1, complete sequence) position: , mismatch: 7, identity: 0.767

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
acctcgtcggtgaccacgccgccgtgcagg	Protospacer
*** **.****************.   * *

467. spacer 2.2|631597|30|NC_012943|CRT matches to NZ_CP014600 (Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.767

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
ccggcgccggtgaccgcgccgccaaggcag	Protospacer
 * .***********.********* *  *

468. spacer 2.2|631597|30|NC_012943|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 7, identity: 0.767

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
ggcccgccgatggccacgccgccaacggca	Protospacer
. * *****.**.**************.*.

469. spacer 2.2|631597|30|NC_012943|CRT matches to NC_042034 (Mycobacterium phage ChrisnMich, complete sequence) position: , mismatch: 7, identity: 0.767

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
gtcgaggcggtgaccacgccgccgccgacg	Protospacer
..*. * ****************. *****

470. spacer 3.1|692300|31|NC_012943|CRISPRCasFinder matches to MK977708 (Mycobacterium phage Fulbright, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

471. spacer 3.1|692300|31|NC_012943|CRISPRCasFinder matches to MG099948 (Mycobacterium phage Philonius, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

472. spacer 3.1|692300|31|NC_012943|CRISPRCasFinder matches to MH926055 (Mycobacterium phage Chewbacca, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

473. spacer 3.1|692300|31|NC_012943|CRISPRCasFinder matches to MT723932 (Mycobacterium phage Schnauzer, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

474. spacer 3.1|692300|31|NC_012943|CRISPRCasFinder matches to KU935726 (Mycobacterium phage Xerxes, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

475. spacer 3.1|692300|31|NC_012943|CRISPRCasFinder matches to KU935730 (Mycobacterium phage Pipsqueaks, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

476. spacer 3.1|692300|31|NC_012943|CRISPRCasFinder matches to MH316570 (Mycobacterium phage Silvafighter, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

477. spacer 3.1|692300|31|NC_012943|CRISPRCasFinder matches to MK524518 (Mycobacterium phage Smurph, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

478. spacer 3.1|692300|31|NC_012943|CRISPRCasFinder matches to MK524515 (Mycobacterium phage Parmesanjohn, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

479. spacer 3.1|692300|31|NC_012943|CRISPRCasFinder matches to MH697585 (Mycobacterium phage Gex, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

480. spacer 3.1|692300|31|NC_012943|CRISPRCasFinder matches to KM588359 (Mycobacterium phage Carcharodon, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

481. spacer 3.1|692300|31|NC_012943|CRISPRCasFinder matches to MH697576 (Mycobacterium phage Aggie, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

482. spacer 3.1|692300|31|NC_012943|CRISPRCasFinder matches to MH697593 (Mycobacterium phage Tapioca, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

483. spacer 3.1|692300|31|NC_012943|CRISPRCasFinder matches to MG099936 (Mycobacterium phage Andies, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

484. spacer 3.1|692300|31|NC_012943|CRISPRCasFinder matches to NC_031243 (Mycobacterium phage Xeno, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

485. spacer 3.1|692300|31|NC_012943|CRISPRCasFinder matches to JN256079 (Mycobacterium phage Charlie, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

486. spacer 4.6|926762|27|NC_012943|CRT matches to NZ_CP010614 (Phaeobacter inhibens strain P92 plasmid pP92_d, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
gattcgcggcggggctggcggggatct	Protospacer
 .*. *******************   

487. spacer 4.6|926762|27|NC_012943|CRT matches to NZ_CP010626 (Phaeobacter inhibens strain P51 plasmid pP51_c, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
gattcgcggcggggctggcggggatct	Protospacer
 .*. *******************   

488. spacer 4.6|926762|27|NC_012943|CRT matches to NZ_CP010671 (Phaeobacter inhibens strain P57 plasmid pP57_c, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
gattcgcggcggggctggcggggatct	Protospacer
 .*. *******************   

489. spacer 4.6|926762|27|NC_012943|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
cgtcagcggcgggggtggcggcacacc	Protospacer
************** ****** . .  

490. spacer 4.6|926762|27|NC_012943|CRT matches to NZ_CP010598 (Phaeobacter inhibens strain P10 plasmid pP10_c, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
gattcgcggcggggctggcggggatct	Protospacer
 .*. *******************   

491. spacer 4.6|926762|27|NC_012943|CRT matches to NC_018288 (Phaeobacter inhibens DSM 17395 plasmid pPGA1_65, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
gattcgcggcggggctggcggggatct	Protospacer
 .*. *******************   

492. spacer 4.6|926762|27|NC_012943|CRT matches to NZ_CP031955 (Phaeobacter inhibens strain 2.10 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
gattcgcggcggggctggcggggatct	Protospacer
 .*. *******************   

493. spacer 4.6|926762|27|NC_012943|CRT matches to NZ_CP016368 (Phaeobacter porticola strain P97 plasmid pP97_d, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
gattggcggcggggctggcggggatct	Protospacer
 .*..*******************   

494. spacer 4.6|926762|27|NC_012943|CRT matches to NC_018422 (Phaeobacter inhibens 2.10 plasmid pPGA2_71, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
gattcgcggcggggctggcggggatct	Protospacer
 .*. *******************   

495. spacer 4.6|926762|27|NC_012943|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
cgtcagcggcgggggtggcggcacacc	Protospacer
************** ****** . .  

496. spacer 4.6|926762|27|NC_012943|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
cgtcagcggcgggggtggcggcacacc	Protospacer
************** ****** . .  

497. spacer 4.6|926762|27|NC_012943|CRT matches to NZ_CP010605 (Phaeobacter inhibens strain P83 plasmid pP83_f, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
gattcgcggcggggctggcggggatct	Protospacer
 .*. *******************   

498. spacer 4.6|926762|27|NC_012943|CRT matches to NZ_CP010744 (Phaeobacter inhibens strain P59 plasmid pP59_c, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
gattcgcggcggggctggcggggatct	Protospacer
 .*. *******************   

499. spacer 4.6|926762|27|NC_012943|CRT matches to NZ_CP010622 (Phaeobacter inhibens strain P30 isolate M4-3.1A plasmid pP30_e, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
gattcgcggcggggctggcggggatct	Protospacer
 .*. *******************   

500. spacer 4.6|926762|27|NC_012943|CRT matches to NZ_CP010732 (Phaeobacter inhibens strain P88 plasmid pP88_g, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
gattcgcggcggggctggcggggatct	Protospacer
 .*. *******************   

501. spacer 4.6|926762|27|NC_012943|CRT matches to NZ_CP010655 (Phaeobacter inhibens strain P54 plasmid pP54_e, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
gattcgcggcggggctggcggggatct	Protospacer
 .*. *******************   

502. spacer 4.6|926762|27|NC_012943|CRT matches to NZ_CP010711 (Phaeobacter inhibens strain P66 plasmid pP66_f, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
gattcgcggcggggctggcggggatct	Protospacer
 .*. *******************   

503. spacer 4.6|926762|27|NC_012943|CRT matches to NZ_CP010702 (Phaeobacter inhibens strain P24 plasmid pP24_f, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
gattcgcggcggggctggcggggatct	Protospacer
 .*. *******************   

504. spacer 4.6|926762|27|NC_012943|CRT matches to NZ_CP010748 (Phaeobacter inhibens strain P48 isolate M21-2.3 plasmid pP48_c, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
gattcgcggcggggctggcggggatct	Protospacer
 .*. *******************   

505. spacer 4.6|926762|27|NC_012943|CRT matches to NZ_CP010739 (Phaeobacter inhibens strain P72 plasmid pP72_d, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
gattcgcggcggggctggcggggatct	Protospacer
 .*. *******************   

506. spacer 4.13|927059|30|NC_012943|CRT matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggtcgccggcctgctggtcgggttcggatc	Protospacer
 * ****************** *.***   

507. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

508. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

509. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ctgctgcagcctgctggtcagctccggcgc	Protospacer
* .*  *.***********.********* 

510. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

511. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

512. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ctgctgcagcctgctggtcagctccggcgc	Protospacer
* .*  *.***********.********* 

513. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

514. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

515. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

516. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

517. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

518. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

519. spacer 4.13|927059|30|NC_012943|CRT matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgggaccggcccgctggtcggccccggctt	Protospacer
**. .******.**********.*****  

520. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
gctgggcggcctgctggtcggctggggcgg	Protospacer
    * *****************  *****

521. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

522. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

523. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

524. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

525. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

526. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

527. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgcaggtcggcttcacctt	Protospacer
 ************* ********.*. *  

528. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

529. spacer 4.13|927059|30|NC_012943|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

530. spacer 4.13|927059|30|NC_012943|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

531. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

532. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

533. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

534. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

535. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

536. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

537. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

538. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

539. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

540. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

541. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

542. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

543. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

544. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

545. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

546. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

547. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

548. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

549. spacer 4.13|927059|30|NC_012943|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

550. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

551. spacer 4.13|927059|30|NC_012943|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

552. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

553. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

554. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

555. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

556. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

557. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

558. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

559. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

560. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

561. spacer 4.13|927059|30|NC_012943|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

562. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

563. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

564. spacer 4.13|927059|30|NC_012943|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

565. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

566. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

567. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

568. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

569. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

570. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

571. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

572. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

573. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

574. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

575. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

576. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

577. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

578. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

579. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

580. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

581. spacer 4.13|927059|30|NC_012943|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

582. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

583. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

584. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

585. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

586. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

587. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

588. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

589. spacer 4.13|927059|30|NC_012943|CRT matches to HM560026 (Uncultured bacterium plasmid pTRACA45, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
acacgccgccctgctggtcggcttaggtcg	Protospacer
  ****** **************. **. *

590. spacer 4.13|927059|30|NC_012943|CRT matches to NC_010867 (Neisseria lactamica plasmid pNL3.1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
gaacgccgccctgctggtcggcttagtcgc	Protospacer
 .****** **************. * ** 

591. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP020471 (Rhodobacter blasticus strain 28/5 plasmid pRsa, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
agacgccggcctgctgttcggcctcgaccc	Protospacer
 *************** *****..**.*  

592. spacer 4.13|927059|30|NC_012943|CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgggctcggcctgctgctcggcttcggcga	Protospacer
**.  .********** ******.*****.

593. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggc-tccggcgg	CRISPR spacer
gtcggccggcctgctggtcggcgcccggct-	Protospacer
    ****************** .*****  

594. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP035710 (Sphaerotilus natans subsp. sulfidivorans strain D-507 plasmid pSna507_unt10, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgacgacggcctgctggtcgacttcatccc	Protospacer
***** **************.**.*. *  

595. spacer 4.13|927059|30|NC_012943|CRT matches to KT997827 (Uncultured Mediterranean phage uvDeep-CGR0-KM15-C219, complete genome) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
gttcgccggcctgctggaccgctccgtggg	Protospacer
   ************** * ******  **

596. spacer 4.13|927059|30|NC_012943|CRT matches to AP021850 (Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgtgtccggcctgctggtcgggttcggcac	Protospacer
**   **************** *.****. 

597. spacer 4.13|927059|30|NC_012943|CRT matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
tgacgccgccctgctggtcggcaaagtcga	Protospacer
.******* *************   * **.

598. spacer 4.13|927059|30|NC_012943|CRT matches to KT997829 (Uncultured Mediterranean phage uvDeep-CGR0-KM22-C158, complete genome) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
gttcgccggcctgctggaccgctccgtggg	Protospacer
   ************** * ******  **

599. spacer 4.15|927155|30|NC_012943|CRT matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tttcggggtcggctccggcggcgctggcga	Protospacer
..*   * *********************.

600. spacer 4.15|927155|30|NC_012943|CRT matches to NZ_CP035001 (Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tttcggggtcggctccggcggcgctggcga	Protospacer
..*   * *********************.

601. spacer 4.15|927155|30|NC_012943|CRT matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
ctccgcgctcggctccggcggcggtggcgg	Protospacer
*..  .*.*************** ******

602. spacer 4.15|927155|30|NC_012943|CRT matches to NC_007765 (Rhizobium etli CFN 42 plasmid p42e, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tttccggctcggcgccggcggcgctggcga	Protospacer
..* * *.***** ***************.

603. spacer 4.15|927155|30|NC_012943|CRT matches to NZ_CP006989 (Rhizobium sp. IE4771 plasmid pRetIE4771c, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tttccggctcggcgccggcggcgctggcga	Protospacer
..* * *.***** ***************.

604. spacer 4.15|927155|30|NC_012943|CRT matches to NZ_CP020909 (Rhizobium etli strain NXC12 plasmid pRetNXC12c, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tttccggctcggcgccggcggcgctggcga	Protospacer
..* * *.***** ***************.

605. spacer 4.15|927155|30|NC_012943|CRT matches to NZ_CP024423 (Paracoccus yeei strain TT13 plasmid pTT13-1, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tctcgggctcggccccggcggcgctggcgc	Protospacer
.**   *.*****.*************** 

606. spacer 4.15|927155|30|NC_012943|CRT matches to NZ_CP020951 (Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tttccggctcggcgccggcggcgctggcga	Protospacer
..* * *.***** ***************.

607. spacer 4.15|927155|30|NC_012943|CRT matches to NC_021908 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1d, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tttccggctcggcgccggcggcgctggcga	Protospacer
..* * *.***** ***************.

608. spacer 4.15|927155|30|NC_012943|CRT matches to NZ_CP020441 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tctcgggctcggccccggcggcgctggcgc	Protospacer
.**   *.*****.*************** 

609. spacer 4.15|927155|30|NC_012943|CRT matches to CP007642 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803a, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tttccggctcggcgccggcggcgctggcga	Protospacer
..* * *.***** ***************.

610. spacer 4.15|927155|30|NC_012943|CRT matches to NZ_CP044080 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tctcgggctcggccccggcggcgctggcgc	Protospacer
.**   *.*****.*************** 

611. spacer 4.15|927155|30|NC_012943|CRT matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg	Protospacer
*.  *** ***************** *. *

612. spacer 4.15|927155|30|NC_012943|CRT matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg	Protospacer
*.  *** ***************** *. *

613. spacer 4.15|927155|30|NC_012943|CRT matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg-	CRISPR spacer
actgctgtccggctccggcggca-tgatgtc	Protospacer
 *******.*************. **..*  

614. spacer 4.15|927155|30|NC_012943|CRT matches to MN582086 (Siphoviridae sp. ctdEk19, complete genome) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gccggccttcgacttcggcggcgctggcgg	Protospacer
 *.* . ****.**.***************

615. spacer 4.15|927155|30|NC_012943|CRT matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg	Protospacer
*.  *** ***************** *. *

616. spacer 4.15|927155|30|NC_012943|CRT matches to NZ_CP022700 (Acetobacter tropicalis strain BDGP1 plasmid pAtBDGP1A, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gttcctccacggttccggcggcgctggcgg	Protospacer
 .* ** . ***.*****************

617. spacer 4.15|927155|30|NC_012943|CRT matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg	Protospacer
*.  *** ***************** *. *

618. spacer 4.15|927155|30|NC_012943|CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg	Protospacer
*.  *** ***************** *. *

619. spacer 4.15|927155|30|NC_012943|CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg	Protospacer
*.  *** ***************** *. *

620. spacer 4.15|927155|30|NC_012943|CRT matches to NZ_CP031082 (Paracoccus yeei strain CCUG 32053 plasmid pYEE4, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tctcgggctcggccccggcggcgctggcgc	Protospacer
.**   *.*****.*************** 

621. spacer 4.17|927245|36|NC_012943|CRT matches to NC_022087 (Mycobacterium phage AnnaL29, complete genome) position: , mismatch: 7, identity: 0.806

gctgatcggcaacggcggtaacggcggggccggcgg	CRISPR spacer
cgtgatcggcaacggcggaaacggcgggagctgggg	Protospacer
  **************** *********. * * **

622. spacer 8.6|2360894|27|NC_012943|CRT matches to NZ_CP015006 (Aminobacter aminovorans strain KCTC 2477 plasmid pAA01, complete sequence) position: , mismatch: 7, identity: 0.741

gtcggcggactcgcggctgacgccggt	CRISPR spacer
acacaccgactcgcggctgacgccggc	Protospacer
..  .* *******************.

623. spacer 9.1|2780038|27|NC_012943|CRT matches to NZ_CP025409 (Paracoccus sp. BM15 plasmid pBM151, complete sequence) position: , mismatch: 7, identity: 0.741

ctgatcagcctgctgggcggccaaggc	CRISPR spacer
cgtcgttacctgctgggcggccaaggc	Protospacer
*    . .*******************

624. spacer 9.1|2780038|27|NC_012943|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 7, identity: 0.741

ctgatcagcctgctgggcggccaaggc	CRISPR spacer
ctgatcagcctgctgggcgttcccctg	Protospacer
******************* .*     

625. spacer 9.2|2780083|27|NC_012943|CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 7, identity: 0.741

accggcggggccggcggtgttggcggt	CRISPR spacer
gacccaggggccggcggtgttggcgac	Protospacer
. *   *******************..

626. spacer 9.2|2780083|27|NC_012943|CRT matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 7, identity: 0.741

accggcggggccggcggtgttggcggt	CRISPR spacer
gacccaggggccggcggtgttggcgac	Protospacer
. *   *******************..

627. spacer 9.2|2780083|27|NC_012943|CRT matches to LN997844 (Streptomyces reticuli genome assembly TUE45, plasmid : III) position: , mismatch: 7, identity: 0.741

accggcggggccggcggtgttggcggt	CRISPR spacer
ctgcacggggccggcggtgttcgcggc	Protospacer
 .  .**************** ****.

628. spacer 9.3|2780128|27|NC_012943|CRT matches to NZ_CP048637 (Rhizobium oryzihabitans strain M15 plasmid p5, complete sequence) position: , mismatch: 7, identity: 0.741

cccggcaaccaggccttcaacgcaggt	CRISPR spacer
ggcggcaaccaggccttctacgcgccg	Protospacer
  **************** ****.   

629. spacer 9.13|2780767|30|NC_012943|CRT matches to NZ_CP045361 (Roseivivax sp. THAF40 plasmid pTHAF40_a, complete sequence) position: , mismatch: 7, identity: 0.767

aagggcacgttcgataacggcggcgatgga	CRISPR spacer
tcgtccacgctcgatgacggcggcgatggc	Protospacer
  *  ****.*****.************* 

630. spacer 9.13|2780767|30|NC_012943|CRT matches to NZ_CP045319 (Roseivivax sp. THAF197b plasmid pTHAF197b_a, complete sequence) position: , mismatch: 7, identity: 0.767

aagggcacgttcgataacggcggcgatgga	CRISPR spacer
tcgtccacgctcgatgacggcggcgatggc	Protospacer
  *  ****.*****.************* 

631. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP029833 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.741

aacggcggtagccgcggcatcggtggt	CRISPR spacer
ctcggcggcagccgcggcatcggcaag	Protospacer
  ******.**************... 

632. spacer 9.14|2780815|27|NC_012943|CRT matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 7, identity: 0.741

aacggcggtagccgcggcatcggtggt	CRISPR spacer
ctcggcggcagccgcggcatcggcaag	Protospacer
  ******.**************... 

633. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.741

aacggcggtagccgcggcatcggtggt	CRISPR spacer
gtcggcggtcgccgcggcatcggccag	Protospacer
. ******* *************. . 

634. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.741

aacggcggtagccgcggcatcggtggt	CRISPR spacer
ctcggcggcagccgcggcatcggcaag	Protospacer
  ******.**************... 

635. spacer 9.14|2780815|27|NC_012943|CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 7, identity: 0.741

aacggcggtagccgcggcatcggtggt	CRISPR spacer
gtcggcggtcgccgcggcatcggccag	Protospacer
. ******* *************. . 

636. spacer 10.7|3736956|31|NC_012943|CRT matches to NZ_CP010990 (Pseudonocardia sp. EC080625-04 plasmid pFRP1-1, complete sequence) position: , mismatch: 7, identity: 0.774

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
cccacccacttcaccgacgtcgccgccgacg	Protospacer
  *.************ ***.******* *.

637. spacer 10.7|3736956|31|NC_012943|CRT matches to NZ_CP012186 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-1, complete sequence) position: , mismatch: 7, identity: 0.774

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
cccacccacttcaccgacgtcgccgccgacg	Protospacer
  *.************ ***.******* *.

638. spacer 10.7|3736956|31|NC_012943|CRT matches to NZ_CP042263 (Litoreibacter sp. LN3S51 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.774

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
atccgccatttcaccgccgttgccgacgccg	Protospacer
* *  ***.**************** **.*.

639. spacer 1.6|369683|33|NC_012943|CRISPRCasFinder matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 8, identity: 0.758

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
ttggtgtcgatctcgatctggccgttgcccgca	Protospacer
  * **.*****.**************** *..

640. spacer 1.6|369683|33|NC_012943|CRISPRCasFinder matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 8, identity: 0.758

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
agctggttgatgccgatctggccgctgccggtc	Protospacer
** . *..*** ************.******* 

641. spacer 1.6|369683|33|NC_012943|CRISPRCasFinder matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
atgctgccgaccccgatctggtcgttttcgact	Protospacer
* ********.**********.**** .**.. 

642. spacer 1.6|369683|33|NC_012943|CRISPRCasFinder matches to CP007644 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence) position: , mismatch: 8, identity: 0.758

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
cggctgccgatcccgatcaggacgtcgaccttc	Protospacer
 ***************** ** ***.* *  * 

643. spacer 1.6|369683|33|NC_012943|CRISPRCasFinder matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.758

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
agctggttgatgccgatctggccgctgccggtc	Protospacer
** . *..*** ************.******* 

644. spacer 2.2|631597|30|NC_012943|CRT matches to NZ_CP045074 (Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
cagacctcggtgaccacgccggcaacgatc	Protospacer
   ** .************** ******. 

645. spacer 2.2|631597|30|NC_012943|CRT matches to NZ_CP015269 (Mycobacterium chimaera strain ZUERICH-2 plasmid unnamed 2, complete sequence) position: , mismatch: 8, identity: 0.733

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
ggttggccggtgaccactccgccagcgatg	Protospacer
. .  ************ ******.***.*

646. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgacgccggcctgctggtcgggctgacctc	Protospacer
********************* .. . *  

647. spacer 4.13|927059|30|NC_012943|CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ccgcaaactcctgctggtcggcgccggcgg	Protospacer
* .*.    ************* *******

648. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgatgccggcctgctggtcggggttcccag	Protospacer
***.*****************  ..  *.*

649. spacer 4.13|927059|30|NC_012943|CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ccgcaaactcctgctggtcggcgccggcgg	Protospacer
* .*.    ************* *******

650. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ccttcagggcgtgctggtcggctccggcgc	Protospacer
*  .   *** ****************** 

651. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_KY126370 (Enterobacter cloacae subsp. cloacae strain MN201516 plasmid pOP-I, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
catggccggcctgctgctcggcaccgggac	Protospacer
*.  ************ ***** **** . 

652. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP054625 (Cupriavidus gilardii strain FDAARGOS_639 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggccgccggcctgctgtgcggctccgcgct	Protospacer
 * *************  ********    

653. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgatgccggcctgctggtcggggttcccag	Protospacer
***.*****************  ..  *.*

654. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_LT960615 (Hartmannibacter diazotrophicus strain E19T plasmid HDIAp1, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
gttcaccgccctgctgatcggctccggcat	Protospacer
   *.*** *******.***********. 

655. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP046347 (Citrobacter portucalensis strain FDAARGOS_738 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
catggccggcctgctgctcggcaccgggac	Protospacer
*.  ************ ***** **** . 

656. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP044100 (Citrobacter werkmanii strain FDAARGOS_616 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
catggccggcctgctgctcggcaccgggac	Protospacer
*.  ************ ***** **** . 

657. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP032156 (Mycobacterium sp. ELW1 plasmid pELW1-1, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
aatcgccggcctgctggtcggtgccgcggt	Protospacer
 . ******************. ***  * 

658. spacer 4.13|927059|30|NC_012943|CRT matches to KY555144 (Caulobacter phage Ccr5, complete genome) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggtgatcggcctgctggtcgtcgccggcgc	Protospacer
 *  ..************** * ****** 

659. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_KP873172 (Pseudomonas aeruginosa PAO1 plasmid pAMBL1, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
catggccggcctgctgctcggcaccgggac	Protospacer
*.  ************ ***** **** . 

660. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP045203 (Citrobacter sp. NMI7904_11 plasmid pCTEL-2, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
catggccggcctgctgctcggcaccgggac	Protospacer
*.  ************ ***** **** . 

661. spacer 4.13|927059|30|NC_012943|CRT matches to NC_021492 (Enterobacter sp. R4-368 plasmid pENT01, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
catggccggcctgctgctcggcaccgggac	Protospacer
*.  ************ ***** **** . 

662. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP022156 (Escherichia coli strain ABWA45 plasmid pABWA45_2, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
catggccggcctgctgctcggcaccgggac	Protospacer
*.  ************ ***** **** . 

663. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP024682 (Citrobacter freundii strain UMH14 plasmid pUMH14_2, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
catggccggcctgctgctcggcaccgggac	Protospacer
*.  ************ ***** **** . 

664. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgatgccggcctgctggtcggggttcccag	Protospacer
***.*****************  ..  *.*

665. spacer 4.15|927155|30|NC_012943|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cgaccatctcggctccgacggcgctggcgc	Protospacer
*   *  .*********.*********** 

666. spacer 4.15|927155|30|NC_012943|CRT matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcgccggcggcgctggcga	Protospacer
. *   *.***** ***************.

667. spacer 4.15|927155|30|NC_012943|CRT matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gccaccccgcggctccggaggcgctggcgg	Protospacer
 *..*. . ********* ***********

668. spacer 4.15|927155|30|NC_012943|CRT matches to NZ_CP013525 (Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcaccggcggcgctggcga	Protospacer
. *   *.***** ***************.

669. spacer 4.15|927155|30|NC_012943|CRT matches to NZ_CP013588 (Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcaccggcggcgctggcga	Protospacer
. *   *.***** ***************.

670. spacer 4.15|927155|30|NC_012943|CRT matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcgccggcggcgctggcga	Protospacer
. *   *.***** ***************.

671. spacer 4.15|927155|30|NC_012943|CRT matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcgccggcggcgctggcga	Protospacer
. *   *.***** ***************.

672. spacer 4.15|927155|30|NC_012943|CRT matches to NZ_CP013529 (Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcgccggcggcgctggcga	Protospacer
. *   *.***** ***************.

673. spacer 4.15|927155|30|NC_012943|CRT matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcgccggcggcgctggcga	Protospacer
. *   *.***** ***************.

674. spacer 4.15|927155|30|NC_012943|CRT matches to NZ_CP013539 (Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcgccggcggcgctggcga	Protospacer
. *   *.***** ***************.

675. spacer 4.15|927155|30|NC_012943|CRT matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcgccggcggcgctggcga	Protospacer
. *   *.***** ***************.

676. spacer 4.15|927155|30|NC_012943|CRT matches to NZ_CP013582 (Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcgccggcggcgctggcga	Protospacer
. *   *.***** ***************.

677. spacer 4.15|927155|30|NC_012943|CRT matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcgccggcggcgctggcga	Protospacer
. *   *.***** ***************.

678. spacer 4.15|927155|30|NC_012943|CRT matches to NC_010998 (Rhizobium etli CIAT 652 plasmid pA, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcaccggcggcgctggcga	Protospacer
. *   *.***** ***************.

679. spacer 4.15|927155|30|NC_012943|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cctgctgatcggctccggcgccggcttctc	Protospacer
******* ************ ** .  *  

680. spacer 4.15|927155|30|NC_012943|CRT matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gctgctgtgcggctccggcggcaaccccga	Protospacer
 ******* *************. .  **.

681. spacer 4.15|927155|30|NC_012943|CRT matches to NZ_LR134452 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cctgatgttcgactccggcggcgacgcacc	Protospacer
**** ******.*********** .*    

682. spacer 4.15|927155|30|NC_012943|CRT matches to NZ_AP014706 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_2p, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gcaccgcgccggctccggcggcggtggcgg	Protospacer
 *  *   .************** ******

683. spacer 4.17|927245|36|NC_012943|CRT matches to MG770216 (Mycobacterium phage Rem711, complete genome) position: , mismatch: 8, identity: 0.778

gctgatcggcaacggcggtaacggcggggccggcgg	CRISPR spacer
attcggcggcaacggcggcaacggcgcggccggcgc	Protospacer
..* . ************.******* ******** 

684. spacer 4.17|927245|36|NC_012943|CRT matches to KY087993 (Mycobacterium phage Hammy, complete genome) position: , mismatch: 8, identity: 0.778

gctgatcggcaacggcggtaacggcggggccggcgg	CRISPR spacer
gcagatcggcaccggcggtaacggcggcggtgcagc	Protospacer
** ******** *************** * .*  * 

685. spacer 4.17|927245|36|NC_012943|CRT matches to MF140406 (Mycobacterium phage DarthP, complete genome) position: , mismatch: 8, identity: 0.778

gctgatcggcaacggcggtaacggcggggccggcgg	CRISPR spacer
gcagatcggcaccggcggtaacggcggcggtgcagc	Protospacer
** ******** *************** * .*  * 

686. spacer 5.16|1291401|29|NC_012943|PILER-CR matches to MK599315 (Pseudomonas phage PA1C, complete genome) position: , mismatch: 8, identity: 0.724

cttgaataacgcgcagtgaatttcgcgga	CRISPR spacer
tgaaaataaagcgcagtgtatttcgcgtc	Protospacer
.  .***** ******** ********  

687. spacer 10.7|3736956|31|NC_012943|CRT matches to CP033373 (Lactobacillus fermentum strain DR9 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
ttagcccacttcacggccgttgccgacgcgg	Protospacer
   *********** ********** **. .

688. spacer 10.7|3736956|31|NC_012943|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg	Protospacer
. *******.********** *****  * .

689. spacer 10.7|3736956|31|NC_012943|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg	Protospacer
. *******.********** *****  * .

690. spacer 10.7|3736956|31|NC_012943|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg	Protospacer
. *******.********** *****  * .

691. spacer 10.7|3736956|31|NC_012943|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg	Protospacer
. *******.********** *****  * .

692. spacer 10.7|3736956|31|NC_012943|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg	Protospacer
. *******.********** *****  * .

693. spacer 10.7|3736956|31|NC_012943|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg	Protospacer
. *******.********** *****  * .

694. spacer 10.7|3736956|31|NC_012943|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg	Protospacer
. *******.********** *****  * .

695. spacer 10.7|3736956|31|NC_012943|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg	Protospacer
. *******.********** *****  * .

696. spacer 10.7|3736956|31|NC_012943|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg	Protospacer
. *******.********** *****  * .

697. spacer 10.7|3736956|31|NC_012943|CRT matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
cgcaactccttcaccgccgctgccgccgtct	Protospacer
 .*. *. ***********.********** 

698. spacer 10.7|3736956|31|NC_012943|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg	Protospacer
. *******.********** *****  * .

699. spacer 10.7|3736956|31|NC_012943|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg	Protospacer
. *******.********** *****  * .

700. spacer 10.7|3736956|31|NC_012943|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg	Protospacer
. *******.********** *****  * .

701. spacer 10.7|3736956|31|NC_012943|CRT matches to NZ_CP027299 (Streptomyces sp. SGAir0924 plasmid unnamed_5) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
ctcggtggcttcgccgccgtcgccgccgtca	Protospacer
  ** . .****.*******.**********

702. spacer 10.7|3736956|31|NC_012943|CRT matches to NC_014213 (Meiothermus silvanus DSM 9946 plasmid pMESIL01, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
atcgcccacttcaccggcgtttccgaccctt	Protospacer
* ************** **** *** * .. 

703. spacer 12.5|3984467|36|NC_012943|CRISPRCasFinder matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 8, identity: 0.778

atcggcaactccggcaccaacaacatcggcttgttc	CRISPR spacer
agcggcaacaccggcaccaacaacaccggcaccgcc	Protospacer
* ******* ***************.**** .  .*

704. spacer 1.6|369683|33|NC_012943|CRISPRCasFinder matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 9, identity: 0.727

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
ttgtattcgatcccgatctggccgtcgccggcc	Protospacer
  *.  .******************.*****. 

705. spacer 1.6|369683|33|NC_012943|CRISPRCasFinder matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc	Protospacer
 ***************** ** ***.  *  * 

706. spacer 1.6|369683|33|NC_012943|CRISPRCasFinder matches to NZ_CP022565 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence) position: , mismatch: 9, identity: 0.727

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc	Protospacer
 ***************** ** ***.  *  * 

707. spacer 1.6|369683|33|NC_012943|CRISPRCasFinder matches to NZ_CP048281 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence) position: , mismatch: 9, identity: 0.727

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc	Protospacer
 ***************** ** ***.  *  * 

708. spacer 2.2|631597|30|NC_012943|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
cccacgccggtcaccacgccgctgcccggc	Protospacer
 ********** **********.. * .  

709. spacer 3.1|692300|31|NC_012943|CRISPRCasFinder matches to NZ_CP014964 (Geobacter anodireducens strain SD-1 plasmid pSD, complete sequence) position: , mismatch: 9, identity: 0.71

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
ggaacgaacggcaagccgaaatgttggtgga	Protospacer
.* .**************** .*****    

710. spacer 3.1|692300|31|NC_012943|CRISPRCasFinder matches to NC_015974 (Sphingobium sp. SYK-6 plasmid pSLPG, complete sequence) position: , mismatch: 9, identity: 0.71

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
taagcgaacggtaagccgaaccgctgaggcg	Protospacer
 . ********.***********.**.. * 

711. spacer 3.1|692300|31|NC_012943|CRISPRCasFinder matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.71

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
taagcgaacggtaagccgaaccgctgaggcg	Protospacer
 . ********.***********.**.. * 

712. spacer 4.13|927059|30|NC_012943|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.7

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggcgccggcctgctggtcggactgctcac	Protospacer
**.****************** ..   *. 

713. spacer 4.15|927155|30|NC_012943|CRT matches to NC_005241 (Cupriavidus necator H16 megaplasmid pHG1, complete sequence) position: , mismatch: 9, identity: 0.7

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gaccacgttcggctccggccgcgctcgcgt	Protospacer
  .  .************* ***** *** 

714. spacer 4.15|927155|30|NC_012943|CRT matches to NZ_CP039289 (Cupriavidus necator H16 plasmid pHG1, complete sequence) position: , mismatch: 9, identity: 0.7

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gaccacgttcggctccggccgcgctcgcgt	Protospacer
  .  .************* ***** *** 

715. spacer 4.17|927245|36|NC_012943|CRT matches to MF140398 (Mycobacterium phage Amohnition, complete genome) position: , mismatch: 9, identity: 0.75

gctgatcggcaacggcggtaacggcggggccggcgg	CRISPR spacer
gcagatcggcaccggcggtaacggcggcggtacggc	Protospacer
** ******** *************** * ..  * 

716. spacer 8.7|2360939|30|NC_012943|CRT matches to NZ_CP022197 (Celeribacter ethanolicus strain TSPH2 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

gacggcgggttgttcttcggcgtgggcggt	CRISPR spacer
cggagcgggttgttcgtcggcgtggagcga	Protospacer
 . .*********** *********.  * 

717. spacer 9.13|2780767|30|NC_012943|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7

aagggcacgttcgataacggcggcgatgga	CRISPR spacer
aagggcgcgttggataacggcggttgcttc	Protospacer
******.**** ***********. ..   

718. spacer 9.13|2780767|30|NC_012943|CRT matches to MK069556 (Microcystis phage Me-ZS1, complete genome) position: , mismatch: 9, identity: 0.7

aagggcacgttcgataacggcggcgatgga	CRISPR spacer
ttcaccacgttcgataaggtcggcgatgtg	Protospacer
   . ************ * ******** .

719. spacer 10.5|3736815|34|NC_012943|CRT matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.735

gttttctcccgcgacggtgggggtggcgccggca	CRISPR spacer
attgagatccgcgacgatgggtgtggcgccggcg	Protospacer
.**    .********.**** ***********.

720. spacer 10.5|3736815|34|NC_012943|CRT matches to MG812496 (Gordonia phage SallySpecial, complete genome) position: , mismatch: 9, identity: 0.735

gttttctcccgcgacggtgggggtggcgccggca	CRISPR spacer
gcgcaccaccgcggcggtgcgggtggcgccggcg	Protospacer
*. . *. *****.***** *************.

721. spacer 1.6|369683|33|NC_012943|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.697

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
ttgtactcgatgccgatctggccgtcgccggcc	Protospacer
  *.  .**** *************.*****. 

722. spacer 1.6|369683|33|NC_012943|CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.697

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
ttgtactcgatgccgatctggccgtcgccggcc	Protospacer
  *.  .**** *************.*****. 

723. spacer 1.6|369683|33|NC_012943|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 10, identity: 0.697

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
ttgtattcgatgccgatctggccgtcgccggcc	Protospacer
  *.  .**** *************.*****. 

724. spacer 4.2|926555|39|NC_012943|CRT matches to NZ_CP044080 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.744

cggcgcgggcggggccgtcacgggaaccggcgccaccgg	CRISPR spacer
cacgggggccggggccgccacgggaaccggcgccccgcc	Protospacer
*.  * ** ********.**************** *   

725. spacer 4.5|926708|36|NC_012943|CRT matches to KX683875 (Mycobacterium phage Baehexic, complete genome) position: , mismatch: 10, identity: 0.722

aggggccggtgggctgttcaacggcggcggggccgg	CRISPR spacer
ccttgccggtgggctgttcagcggcgggggtggcct	Protospacer
    ****************.****** ** * *  

726. spacer 4.5|926708|36|NC_012943|CRT matches to KM197169 (Mycobacterium phage Piro94, complete genome) position: , mismatch: 10, identity: 0.722

aggggccggtgggctgttcaacggcggcggggccgg	CRISPR spacer
ccttgccggtgggctgttcagcggcgggggtggcct	Protospacer
    ****************.****** ** * *  

727. spacer 4.5|926708|36|NC_012943|CRT matches to MF668269 (Mycobacterium phage Drake55, complete genome) position: , mismatch: 10, identity: 0.722

aggggccggtgggctgttcaacggcggcggggccgg	CRISPR spacer
ccttgccggtgggctgttcagcggcgggggtggcct	Protospacer
    ****************.****** ** * *  

728. spacer 4.5|926708|36|NC_012943|CRT matches to MK284522 (Mycobacterium phage Malec, complete genome) position: , mismatch: 10, identity: 0.722

aggggccggtgggctgttcaacggcggcggggccgg	CRISPR spacer
ccttgccggtgggctgttcagcggcgggggtggcct	Protospacer
    ****************.****** ** * *  

729. spacer 4.5|926708|36|NC_012943|CRT matches to KM677210 (Mycobacterium phage Larenn, complete genome) position: , mismatch: 10, identity: 0.722

aggggccggtgggctgttcaacggcggcggggccgg	CRISPR spacer
ccttgccggtgggctgttcagcggcgggggtggcct	Protospacer
    ****************.****** ** * *  

730. spacer 4.17|927245|36|NC_012943|CRT matches to MN369764 (Mycobacterium phage Rahalelujah, complete genome) position: , mismatch: 10, identity: 0.722

gctgatcggcaacggcggtaacggcggggccggcgg	CRISPR spacer
atctggaggcaacggcggtaacggcggggccagcac	Protospacer
... .  ************************.**. 

731. spacer 4.17|927245|36|NC_012943|CRT matches to NZ_CP025548 (Mycobacterium paragordonae strain 49061 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.722

gctgatcggcaacggcggtaacggcggggccggcgg	CRISPR spacer
gaccggcggcaacggcggaaacggcggcgccgcagc	Protospacer
* . . ************ ******** ****  * 

732. spacer 5.4|1290519|34|NC_012943|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022335 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49c, complete sequence) position: , mismatch: 10, identity: 0.706

tcgcaagcgccgtgcttccagtgatcgccttcta	CRISPR spacer
gtgccgccgccgagcttccactgatcgccttgcc	Protospacer
 .** . ***** ******* ********** . 

733. spacer 6.10|1293884|35|NC_012943|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 10, identity: 0.714

gccccgtggatggcggatgcgttgtgcgcgcaagt	CRISPR spacer
accgtgtggatggcgaatgtgttgtgcgcggtgac	Protospacer
.** .**********.***.**********  ...

734. spacer 10.5|3736815|34|NC_012943|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 10, identity: 0.706

gttttctcccgcgacggtgggggtggcgccggca	CRISPR spacer
cagcgcggccgcgtcggtgggggtggcgcccgcc	Protospacer
   . *  ***** **************** ** 

735. spacer 10.5|3736815|34|NC_012943|CRT matches to NZ_CP024986 (Streptomyces lavendulae subsp. lavendulae strain CCM 3239 plasmid pSA3239, complete sequence) position: , mismatch: 10, identity: 0.706

gttttctcccgcgacggtgggggtggcgccggca	CRISPR spacer
gagaccgcccgcgatggagggggtggcgccgagc	Protospacer
*   .* *******.** *************.  

736. spacer 10.5|3736815|34|NC_012943|CRT matches to NC_024970 (Streptomyces aureofaciens strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 10, identity: 0.706

gttttctcccgcgacggtgggggtggcgccggca	CRISPR spacer
gagaccgcccgcgatggagggggtggcgccgagc	Protospacer
*   .* *******.** *************.  

737. spacer 10.5|3736815|34|NC_012943|CRT matches to NZ_KJ396772 (Streptomyces lavendulae subsp. lavendulae strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 10, identity: 0.706

gttttctcccgcgacggtgggggtggcgccggca	CRISPR spacer
gagaccgcccgcgatggagggggtggcgccgagc	Protospacer
*   .* *******.** *************.  

738. spacer 10.9|3737088|37|NC_012943|CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 10, identity: 0.73

cttgccggcggtgccggcgaccgcggtgccgccggtg	CRISPR spacer
ggagacggcggtgccggagaccgcggtgtcgctgccc	Protospacer
   * ************ **********.***.* . 

739. spacer 10.5|3736815|34|NC_012943|CRT matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 11, identity: 0.676

gttttctcccgcgacggtgggggtggcgccggca	CRISPR spacer
cgcccccggcgtgacggtggaggtggcgccggcc	Protospacer
  ...*.  **.********.************ 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1291903 : 1331380 40 Burkholderia_virus(40.0%) integrase,tRNA,transposase attL 1291853:1291912|attR 1331749:1333104
DBSCAN-SWA_2 1430518 : 1443264 20 Mycobacterium_phage(57.14%) protease,terminase,integrase,capsid,head attL 1434175:1434202|attR 1443799:1443826
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage