Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_013166 Kangiella koreensis DSM 16069, complete sequence 1 crisprs WYL,DEDDh,cas3,DinG,csa3 0 1 1 0

Results visualization

1. NC_013166
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_013166_1 829985-830097 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_013166_1 1.1|830026|31|NC_013166|CRISPRCasFinder 830026-830056 31 NZ_CP045274 Bacillus megaterium strain FDU301 plasmid pFDU301B, complete sequence 60748-60778 7 0.774
NC_013166_1 1.1|830026|31|NC_013166|CRISPRCasFinder 830026-830056 31 AP014279 Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S30-C67, *** SEQUENCING IN PROGRESS *** 18480-18510 8 0.742

1. spacer 1.1|830026|31|NC_013166|CRISPRCasFinder matches to NZ_CP045274 (Bacillus megaterium strain FDU301 plasmid pFDU301B, complete sequence) position: , mismatch: 7, identity: 0.774

gggtgctttctttttagcaggagcctttttc	CRISPR spacer
gtgggctttcttcttagctggagccttctgt	Protospacer
* * ********.***** ********.* .

2. spacer 1.1|830026|31|NC_013166|CRISPRCasFinder matches to AP014279 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S30-C67, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.742

gggtgctttctttttagcaggagcctttttc	CRISPR spacer
aacaactttctttttagcaggtgctttttta	Protospacer
..  .**************** **.***** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1192878 : 1202440 9 Paramecium_bursaria_Chlorella_virus(33.33%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage