Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_013222 Robiginitalea biformata HTCC2501, complete sequence 4 crisprs csa3,WYL,DEDDh,PrimPol 0 1 1 0

Results visualization

1. NC_013222
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_013222_1 307767-307882 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_013222_2 440758-440871 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_013222_3 921305-921681 Orphan NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_013222_4 2963072-2963154 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_013222_3 3.4|921601|34|NC_013222|CRISPRCasFinder 921601-921634 34 NC_008712 Paenarthrobacter aurescens TC1 plasmid pTC1, complete sequence 131642-131675 7 0.794
NC_013222_3 3.4|921601|34|NC_013222|CRISPRCasFinder 921601-921634 34 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 2079101-2079134 10 0.706
NC_013222_3 3.4|921601|34|NC_013222|CRISPRCasFinder 921601-921634 34 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 1007958-1007991 10 0.706

1. spacer 3.4|921601|34|NC_013222|CRISPRCasFinder matches to NC_008712 (Paenarthrobacter aurescens TC1 plasmid pTC1, complete sequence) position: , mismatch: 7, identity: 0.794

--ttaaaggcttccagtccggcaacttcggggcagg	CRISPR spacer
cctcgcagg--tccagtccggcaactccgggggagg	Protospacer
  *.. ***  ***************.***** ***

2. spacer 3.4|921601|34|NC_013222|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 10, identity: 0.706

ttaaaggcttccagtccggcaacttcggggcagg	CRISPR spacer
acaccgccttccaggccggcaccttcggggcgct	Protospacer
 .*  * ******* ****** *********.  

3. spacer 3.4|921601|34|NC_013222|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706

ttaaaggcttccagtccggcaacttcggggcagg	CRISPR spacer
acaccgccttccaggccggcaccttcggggcgct	Protospacer
 .*  * ******* ****** *********.  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 3116121 : 3123518 7 Cellulophaga_phage(66.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage