Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_013223 Desulfohalobium retbaense DSM 5692, complete sequence 1 crisprs RT,Cas9_archaeal,cas3HD,cas3,cas8u1,cas7,csb2gr5,csa3,cas2,DEDDh 0 2 5 0
NC_013224 Desulfohalobium retbaense DSM 5692 plasmid pDRET01, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NC_013223
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_013223_1 1876848-1877552 Unclear NA
9 spacers
csb2gr5,cas7,cas8u1,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_013223_1 1.5|1877195|34|NC_013223|CRISPRCasFinder,PILER-CR,CRT 1877195-1877228 34 NZ_CP012941 Ralstonia solanacearum strain UW163 plasmid pUW163a, complete sequence 45922-45955 7 0.794
NC_013223_1 1.3|1877050|34|NC_013223|CRISPRCasFinder,PILER-CR,CRT 1877050-1877083 34 CP002294 Geobacillus sp. Y4.1MC1 plasmid pGY4MC101, complete sequence 45997-46030 9 0.735
NC_013223_1 1.3|1877050|34|NC_013223|CRISPRCasFinder,PILER-CR,CRT 1877050-1877083 34 NZ_CP016623 Parageobacillus thermoglucosidasius strain Wild Type plasmid pNCI001, complete sequence 68994-69027 9 0.735

1. spacer 1.5|1877195|34|NC_013223|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP012941 (Ralstonia solanacearum strain UW163 plasmid pUW163a, complete sequence) position: , mismatch: 7, identity: 0.794

tcgttaactggagcacacccggcggctggaacca	CRISPR spacer
gctttttctggagcacacccggcgggtggaagcc	Protospacer
 * **  ****************** ***** * 

2. spacer 1.3|1877050|34|NC_013223|CRISPRCasFinder,PILER-CR,CRT matches to CP002294 (Geobacillus sp. Y4.1MC1 plasmid pGY4MC101, complete sequence) position: , mismatch: 9, identity: 0.735

gatgggagcggcccacaaaatacgcagtgatgaa	CRISPR spacer
tatggaagcggcccaaaaaatacgcagcgcaatc	Protospacer
 ****.********* ***********.*  .  

3. spacer 1.3|1877050|34|NC_013223|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP016623 (Parageobacillus thermoglucosidasius strain Wild Type plasmid pNCI001, complete sequence) position: , mismatch: 9, identity: 0.735

gatgggagcggcccacaaaatacgcagtgatgaa	CRISPR spacer
tatggaagcggcccaaaaaatacgcagcgcaatc	Protospacer
 ****.********* ***********.*  .  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 423781 : 487504 50 Burkholderia_virus(22.22%) transposase NA
DBSCAN-SWA_2 720314 : 765393 37 Pseudomonas_phage(20.0%) transposase,integrase attL 720308:720344|attR 772677:772713
DBSCAN-SWA_3 1128017 : 1178732 49 uncultured_Mediterranean_phage(18.18%) protease,transposase,integrase,tRNA attL 1119231:1119248|attR 1179171:1179188
DBSCAN-SWA_4 1647202 : 1657484 10 Staphylococcus_phage(50.0%) tRNA NA
DBSCAN-SWA_5 1850492 : 1858365 9 Staphylococcus_phage(16.67%) integrase attL 1844494:1844506|attR 1860545:1860557
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage