Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_013532 Anaplasma centrale str. Israel, complete sequence 5 crisprs NA 6 0 0 0

Results visualization

1. NC_013532
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_013532_1 284809-284888 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_013532_2 425537-425776 Orphan NA
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_013532_3 425842-426003 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_013532_4 426585-426746 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_013532_5 652621-652881 Orphan NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_013532_2 2.4|425687|30|NC_013532|CRT 425687-425716 30 NC_013532.1 425414-425443 0 1.0
NC_013532_5 5.4|652840|18|NC_013532|CRISPRCasFinder 652840-652857 18 NC_013532.1 670452-670469 0 1.0
NC_013532_3 3.1|425863|30|NC_013532|CRT 425863-425892 30 NC_013532.1 425416-425445 1 0.967
NC_013532_3 3.3|425953|30|NC_013532|CRT 425953-425982 30 NC_013532.1 425416-425445 1 0.967
NC_013532_4 4.1|426606|30|NC_013532|CRT 426606-426635 30 NC_013532.1 425416-425445 1 0.967
NC_013532_4 4.3|426696|30|NC_013532|CRT 426696-426725 30 NC_013532.1 425416-425445 1 0.967

1. spacer 2.4|425687|30|NC_013532|CRT matches to position: 425414-425443, mismatch: 0, identity: 1.0

cgctgagtggaagcctaggattgagctctg	CRISPR spacer
cgctgagtggaagcctaggattgagctctg	Protospacer
******************************

2. spacer 5.4|652840|18|NC_013532|CRISPRCasFinder matches to position: 670452-670469, mismatch: 0, identity: 1.0

gaggctggtgtatatgct	CRISPR spacer
gaggctggtgtatatgct	Protospacer
******************

3. spacer 3.1|425863|30|NC_013532|CRT matches to position: 425416-425445, mismatch: 1, identity: 0.967

ctgagtggaagcctaggattgagctcagga	CRISPR spacer
ctgagtggaagcctaggattgagctctgga	Protospacer
************************** ***

4. spacer 3.3|425953|30|NC_013532|CRT matches to position: 425416-425445, mismatch: 1, identity: 0.967

ctgagtggaagcctaggattgagctcagga	CRISPR spacer
ctgagtggaagcctaggattgagctctgga	Protospacer
************************** ***

5. spacer 4.1|426606|30|NC_013532|CRT matches to position: 425416-425445, mismatch: 1, identity: 0.967

ctgagtggaagcctaggattgagctcagga	CRISPR spacer
ctgagtggaagcctaggattgagctctgga	Protospacer
************************** ***

6. spacer 4.3|426696|30|NC_013532|CRT matches to position: 425416-425445, mismatch: 1, identity: 0.967

ctgagtggaagcctaggattgagctcagga	CRISPR spacer
ctgagtggaagcctaggattgagctctgga	Protospacer
************************** ***

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage