Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_013521 Sanguibacter keddieii DSM 10542, complete sequence 4 crisprs cas3,csa3,DEDDh,WYL,cas4,DinG,PD-DExK 0 6 1 0

Results visualization

1. NC_013521
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_013521_1 291042-291425 Orphan NA
7 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_013521_2 1096750-1096839 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_013521_3 2612416-2612519 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_013521_4 4114984-4115070 Orphan NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_013521_1 1.3|291171|27|NC_013521|CRISPRCasFinder 291171-291197 27 NC_013858 Azospirillum sp. B510 plasmid pAB510d, complete sequence 461239-461265 3 0.889
NC_013521_1 1.4|291222|27|NC_013521|CRISPRCasFinder 291222-291248 27 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 95489-95515 4 0.852
NC_013521_1 1.6|291324|27|NC_013521|CRISPRCasFinder 291324-291350 27 NC_019848 Sinorhizobium meliloti GR4 plasmid pRmeGR4c, complete sequence 82489-82515 4 0.852
NC_013521_1 1.6|291324|27|NC_013521|CRISPRCasFinder 291324-291350 27 NZ_CP009145 Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence 69663-69689 4 0.852
NC_013521_1 1.6|291324|27|NC_013521|CRISPRCasFinder 291324-291350 27 NZ_CP021827 Sinorhizobium meliloti strain KH35c plasmid psymA, complete sequence 268399-268425 4 0.852
NC_013521_1 1.6|291324|27|NC_013521|CRISPRCasFinder 291324-291350 27 NZ_CP021824 Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence 1542887-1542913 4 0.852
NC_013521_1 1.6|291324|27|NC_013521|CRISPRCasFinder 291324-291350 27 NZ_CP019486 Sinorhizobium meliloti strain B399 plasmid pSymA, complete sequence 1046816-1046842 4 0.852
NC_013521_1 1.3|291171|27|NC_013521|CRISPRCasFinder 291171-291197 27 NC_016585 Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence 174898-174924 5 0.815
NC_013521_1 1.3|291171|27|NC_013521|CRISPRCasFinder 291171-291197 27 NZ_CP013855 Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence 111255-111281 5 0.815
NC_013521_1 1.3|291171|27|NC_013521|CRISPRCasFinder 291171-291197 27 NZ_CP047896 Sphingomonas sp. C33 plasmid pC33, complete sequence 27935-27961 5 0.815
NC_013521_1 1.3|291171|27|NC_013521|CRISPRCasFinder 291171-291197 27 NZ_CP039912 Agrobacterium tumefaciens strain CFBP6625 plasmid pAtCFBP6625a, complete sequence 168772-168798 5 0.815
NC_013521_1 1.3|291171|27|NC_013521|CRISPRCasFinder 291171-291197 27 NC_015169 Deinococcus proteolyticus MRP plasmid pDEIPR01, complete sequence 134386-134412 5 0.815
NC_013521_1 1.3|291171|27|NC_013521|CRISPRCasFinder 291171-291197 27 NZ_CP038031 Rhodococcus ruber strain R1 plasmid unnamed1, complete sequence 103599-103625 5 0.815
NC_013521_1 1.4|291222|27|NC_013521|CRISPRCasFinder 291222-291248 27 NZ_KY349138 Mycolicibacterium sp. CBMA 213 plasmid pCBMA213_2, complete sequence 102669-102695 5 0.815
NC_013521_1 1.5|291273|27|NC_013521|CRISPRCasFinder 291273-291299 27 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 1522431-1522457 5 0.815
NC_013521_1 1.6|291324|27|NC_013521|CRISPRCasFinder 291324-291350 27 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 891353-891379 5 0.815
NC_013521_1 1.6|291324|27|NC_013521|CRISPRCasFinder 291324-291350 27 NZ_CP029833 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence 288759-288785 5 0.815
NC_013521_1 1.6|291324|27|NC_013521|CRISPRCasFinder 291324-291350 27 MF140401 Arthrobacter phage Caterpillar, complete genome 9784-9810 5 0.815
NC_013521_1 1.6|291324|27|NC_013521|CRISPRCasFinder 291324-291350 27 MN284902 Arthrobacter phage Makai, complete genome 10758-10784 5 0.815
NC_013521_1 1.6|291324|27|NC_013521|CRISPRCasFinder 291324-291350 27 MF140423 Arthrobacter phage Nightmare, complete genome 10621-10647 5 0.815
NC_013521_1 1.6|291324|27|NC_013521|CRISPRCasFinder 291324-291350 27 MH450125 Arthrobacter phage MediumFry, complete genome 9813-9839 5 0.815
NC_013521_1 1.1|291066|27|NC_013521|CRISPRCasFinder 291066-291092 27 NZ_CP023408 Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence 480864-480890 6 0.778
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 1830069-1830098 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 1216426-1216455 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 1813117-1813146 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 226345-226374 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 268824-268853 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 1174589-1174618 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 1149550-1149579 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 1263746-1263775 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 916823-916852 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 1177532-1177561 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 1177532-1177561 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 MH155873 Microbacterium phage Paschalis, complete genome 44701-44730 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 MH590600 Microbacterium phage KaiHaiDragon, complete genome 44608-44637 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 MK977698 Microbacterium phage Busephilis, complete genome 44617-44646 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 MK875798 Microbacterium phage Piperis, complete genome 44609-44638 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 MT818415 Microbacterium phage Scumberland, complete genome 44925-44954 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NC_047993 Microbacterium phage Quhwah, complete genome 45300-45329 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 MN062719 Microbacterium phage PiperSansNom, complete genome 44986-45015 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 MN444877 Microbacterium phage Antares, complete genome 44910-44939 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 760737-760766 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 811396-811425 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 1455423-1455452 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 725679-725708 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 884016-884045 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 1473019-1473048 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 901723-901752 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1077624-1077653 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 639824-639853 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 1230584-1230613 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 800846-800875 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 888362-888391 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 1210439-1210468 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP022773 Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence 609291-609320 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 814902-814931 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 714236-714265 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 813504-813533 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 1001748-1001777 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 810708-810737 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 888351-888380 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 1001715-1001744 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 876690-876719 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 921416-921445 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 1001716-1001745 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 781308-781337 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 876690-876719 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 921416-921445 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 1001729-1001758 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 876690-876719 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 781331-781360 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 876694-876723 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 921416-921445 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 921416-921445 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 921416-921445 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 1001729-1001758 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 1001718-1001747 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 781331-781360 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 817225-817254 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 797917-797946 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 852152-852181 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 889034-889063 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 1001718-1001747 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 781331-781360 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 876690-876719 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 1001714-1001743 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 781331-781360 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 781331-781360 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 1001729-1001758 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 921418-921447 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 1001740-1001769 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 1001718-1001747 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 1218573-1218602 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 907663-907692 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 675869-675898 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 907670-907699 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 1179255-1179284 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 1179200-1179229 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 667833-667862 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP039426 Citricoccus sp. SGAir0253 plasmid unnamed2, complete sequence 1140-1169 6 0.8
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP039431 Citricoccus sp. SGAir0453 plasmid unnamed2, complete sequence 1140-1169 6 0.8
NC_013521_1 1.3|291171|27|NC_013521|CRISPRCasFinder 291171-291197 27 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 48276-48302 6 0.778
NC_013521_1 1.3|291171|27|NC_013521|CRISPRCasFinder 291171-291197 27 CP036360 Agrobacterium sp. 33MFTa1.1 plasmid p_JBx_073812, complete sequence 142416-142442 6 0.778
NC_013521_1 1.3|291171|27|NC_013521|CRISPRCasFinder 291171-291197 27 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 96655-96681 6 0.778
NC_013521_1 1.3|291171|27|NC_013521|CRISPRCasFinder 291171-291197 27 NZ_CP032919 Agrobacterium tumefaciens strain 15955 plasmid pAt15955, complete sequence 48037-48063 6 0.778
NC_013521_1 1.3|291171|27|NC_013521|CRISPRCasFinder 291171-291197 27 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 48121-48147 6 0.778
NC_013521_1 1.3|291171|27|NC_013521|CRISPRCasFinder 291171-291197 27 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 249337-249363 6 0.778
NC_013521_1 1.6|291324|27|NC_013521|CRISPRCasFinder 291324-291350 27 NZ_CP045095 Streptomyces sp. GY16 plasmid unnamed1, complete sequence 15439-15465 6 0.778
NC_013521_1 1.6|291324|27|NC_013521|CRISPRCasFinder 291324-291350 27 NZ_CP032678 Pseudomonas sp. Leaf58 plasmid pBASL58, complete sequence 720948-720974 6 0.778
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP031166 Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence 545373-545402 7 0.767
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_LR594673 Variovorax sp. PBL-E5 plasmid 3 436278-436307 7 0.767
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 762823-762852 7 0.767
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 759899-759928 7 0.767
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 658005-658034 7 0.767
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 733232-733261 7 0.767
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 657120-657149 7 0.767
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 659955-659984 7 0.767
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 659945-659974 7 0.767
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 657993-658022 7 0.767
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 658011-658040 7 0.767
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 657990-658019 7 0.767
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 762887-762916 7 0.767
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 762887-762916 7 0.767
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 762873-762902 7 0.767
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 MH155873 Microbacterium phage Paschalis, complete genome 46786-46815 8 0.733
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 MK977698 Microbacterium phage Busephilis, complete genome 46702-46731 8 0.733
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 MK875798 Microbacterium phage Piperis, complete genome 46694-46723 8 0.733
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NC_047993 Microbacterium phage Quhwah, complete genome 47415-47444 8 0.733
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 MN444877 Microbacterium phage Antares, complete genome 46995-47024 8 0.733
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP032686 Rhizobium sp. CCGE531 plasmid pRCCGE531c, complete sequence 392692-392721 8 0.733
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP032691 Rhizobium sp. CCGE532 plasmid pRCCGE532c, complete sequence 384009-384038 8 0.733
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 MT657336 Microbacterium phage ClearAsMud, complete genome 47023-47052 8 0.733
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 NZ_CP025613 Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed1, complete sequence 497025-497054 8 0.733
NC_013521_1 1.2|291117|30|NC_013521|CRISPRCasFinder 291117-291146 30 MF417880 Uncultured Caudovirales phage clone 9F_5, partial genome 22813-22842 8 0.733

1. spacer 1.3|291171|27|NC_013521|CRISPRCasFinder matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 3, identity: 0.889

cccgtctcgtcggtccgggtgccggag	CRISPR spacer
gccatctcgacggtccgggtgccggag	Protospacer
 **.***** *****************

2. spacer 1.4|291222|27|NC_013521|CRISPRCasFinder matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.852

accgtctcgtcggagtagacgcccgcg	CRISPR spacer
agcgtctcgtcggagtagaccccctcc	Protospacer
* ****************** *** * 

3. spacer 1.6|291324|27|NC_013521|CRISPRCasFinder matches to NC_019848 (Sinorhizobium meliloti GR4 plasmid pRmeGR4c, complete sequence) position: , mismatch: 4, identity: 0.852

accccgtcgatgacgtaggtgccggag	CRISPR spacer
gcgccgtcgacgatgtaggtgccggag	Protospacer
.* *******.**.*************

4. spacer 1.6|291324|27|NC_013521|CRISPRCasFinder matches to NZ_CP009145 (Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence) position: , mismatch: 4, identity: 0.852

accccgtcgatgacgtaggtgccggag	CRISPR spacer
gcgccgtcgacgatgtaggtgccggag	Protospacer
.* *******.**.*************

5. spacer 1.6|291324|27|NC_013521|CRISPRCasFinder matches to NZ_CP021827 (Sinorhizobium meliloti strain KH35c plasmid psymA, complete sequence) position: , mismatch: 4, identity: 0.852

accccgtcgatgacgtaggtgccggag	CRISPR spacer
gcgccgtcgacgatgtaggtgccggag	Protospacer
.* *******.**.*************

6. spacer 1.6|291324|27|NC_013521|CRISPRCasFinder matches to NZ_CP021824 (Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence) position: , mismatch: 4, identity: 0.852

accccgtcgatgacgtaggtgccggag	CRISPR spacer
gcgccgtcgacgatgtaggtgccggag	Protospacer
.* *******.**.*************

7. spacer 1.6|291324|27|NC_013521|CRISPRCasFinder matches to NZ_CP019486 (Sinorhizobium meliloti strain B399 plasmid pSymA, complete sequence) position: , mismatch: 4, identity: 0.852

accccgtcgatgacgtaggtgccggag	CRISPR spacer
gcgccgtcgacgatgtaggtgccggag	Protospacer
.* *******.**.*************

8. spacer 1.3|291171|27|NC_013521|CRISPRCasFinder matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 5, identity: 0.815

cccgtctcgtcggtccgggtgccggag	CRISPR spacer
accgtctcgtcggtcacggtgccggcc	Protospacer
 **************  ********  

9. spacer 1.3|291171|27|NC_013521|CRISPRCasFinder matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 5, identity: 0.815

cccgtctcgtcggtccgggtgccggag	CRISPR spacer
cccgtctcgtcggtgcgggtggcgagc	Protospacer
************** ****** **.. 

10. spacer 1.3|291171|27|NC_013521|CRISPRCasFinder matches to NZ_CP047896 (Sphingomonas sp. C33 plasmid pC33, complete sequence) position: , mismatch: 5, identity: 0.815

cccgtctcgtcggtccgggtgccggag	CRISPR spacer
cccgtctcatcgttccgggtgccgctc	Protospacer
********.*** ***********   

11. spacer 1.3|291171|27|NC_013521|CRISPRCasFinder matches to NZ_CP039912 (Agrobacterium tumefaciens strain CFBP6625 plasmid pAtCFBP6625a, complete sequence) position: , mismatch: 5, identity: 0.815

cccgtctcgtcggtccgggtgccggag	CRISPR spacer
cccgtgtcgtcggtcggggtgcctacg	Protospacer
***** ********* ******* . *

12. spacer 1.3|291171|27|NC_013521|CRISPRCasFinder matches to NC_015169 (Deinococcus proteolyticus MRP plasmid pDEIPR01, complete sequence) position: , mismatch: 5, identity: 0.815

cccgtctcgtcggtccgggtgccggag	CRISPR spacer
aacatctcgtcggtcagggtgccgtag	Protospacer
  *.*********** ******** **

13. spacer 1.3|291171|27|NC_013521|CRISPRCasFinder matches to NZ_CP038031 (Rhodococcus ruber strain R1 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815

cccgtctcgtcggtccgggtgccggag	CRISPR spacer
ccggtctcgtcggtgcgggtgccctcg	Protospacer
** *********** ********   *

14. spacer 1.4|291222|27|NC_013521|CRISPRCasFinder matches to NZ_KY349138 (Mycolicibacterium sp. CBMA 213 plasmid pCBMA213_2, complete sequence) position: , mismatch: 5, identity: 0.815

accgtctcgtcggagtagacgcccgcg	CRISPR spacer
cgcatcgcgtcggagtaggcgcccgcg	Protospacer
  *.** ***********.********

15. spacer 1.5|291273|27|NC_013521|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 5, identity: 0.815

acggtgtcgctcgagtacacgcccgac	CRISPR spacer
tcagggtcgctcgagttcacgcccgat	Protospacer
 *.* *********** *********.

16. spacer 1.6|291324|27|NC_013521|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 5, identity: 0.815

accccgtcgatgacgtaggtgccggag	CRISPR spacer
gcggcctcgatgacgaaggtgccggag	Protospacer
.*  * ********* ***********

17. spacer 1.6|291324|27|NC_013521|CRISPRCasFinder matches to NZ_CP029833 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.815

accccgtcgatgacgtaggtgccggag	CRISPR spacer
gcggcctcgatgacgaaggtgccggag	Protospacer
.*  * ********* ***********

18. spacer 1.6|291324|27|NC_013521|CRISPRCasFinder matches to MF140401 (Arthrobacter phage Caterpillar, complete genome) position: , mismatch: 5, identity: 0.815

accccgtcgatgacgtaggtgccggag	CRISPR spacer
atgtcgtcgatgccgtaggtgccggcg	Protospacer
*. .******** ************ *

19. spacer 1.6|291324|27|NC_013521|CRISPRCasFinder matches to MN284902 (Arthrobacter phage Makai, complete genome) position: , mismatch: 5, identity: 0.815

accccgtcgatgacgtaggtgccggag	CRISPR spacer
atgtcgtcgatgccgtaggtgccggcg	Protospacer
*. .******** ************ *

20. spacer 1.6|291324|27|NC_013521|CRISPRCasFinder matches to MF140423 (Arthrobacter phage Nightmare, complete genome) position: , mismatch: 5, identity: 0.815

accccgtcgatgacgtaggtgccggag	CRISPR spacer
atgtcgtcgatgccgtaggtgccggcg	Protospacer
*. .******** ************ *

21. spacer 1.6|291324|27|NC_013521|CRISPRCasFinder matches to MH450125 (Arthrobacter phage MediumFry, complete genome) position: , mismatch: 5, identity: 0.815

accccgtcgatgacgtaggtgccggag	CRISPR spacer
atgtcgtcgatgccgtaggtgccggcg	Protospacer
*. .******** ************ *

22. spacer 1.1|291066|27|NC_013521|CRISPRCasFinder matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.778

atgagaccgtcggtgtagatgcccgag	CRISPR spacer
atgagaccgtcggtgtagagggcgacc	Protospacer
******************* * * .  

23. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctcgccggtgtagaccttgagc	Protospacer
 ***** *****************..*..*

24. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctcgccggtgtagaccttgagc	Protospacer
 ***** *****************..*..*

25. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctcgccggtgtagaccttgagc	Protospacer
 ***** *****************..*..*

26. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctcgccggtgtagaccttgagc	Protospacer
 ***** *****************..*..*

27. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctcgccggtgtagaccttgagc	Protospacer
 ***** *****************..*..*

28. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctcgccggtgtagaccttgagc	Protospacer
 ***** *****************..*..*

29. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctcgccggtgtagaccttgagc	Protospacer
 ***** *****************..*..*

30. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctcgccggtgtagaccttgagc	Protospacer
 ***** *****************..*..*

31. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctcgccggtgtagaccttgagc	Protospacer
 ***** *****************..*..*

32. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctcgccggtgtagaccttgagc	Protospacer
 ***** *****************..*..*

33. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctcgccggtgtagaccttgagc	Protospacer
 ***** *****************..*..*

34. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to MH155873 (Microbacterium phage Paschalis, complete genome) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
atgccgtcctcgccgttgtagacccgccag	Protospacer
*.************* *********   * 

35. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to MH590600 (Microbacterium phage KaiHaiDragon, complete genome) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
atgccgtcctcgccgttgtagacccgccag	Protospacer
*.************* *********   * 

36. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to MK977698 (Microbacterium phage Busephilis, complete genome) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
atgccgtcctcgccgttgtagacccgccag	Protospacer
*.************* *********   * 

37. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to MK875798 (Microbacterium phage Piperis, complete genome) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
atgccgtcctcgccgttgtagacccgccag	Protospacer
*.************* *********   * 

38. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to MT818415 (Microbacterium phage Scumberland, complete genome) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
atgccgtcctcgccgttgtagacccgccag	Protospacer
*.************* *********   * 

39. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NC_047993 (Microbacterium phage Quhwah, complete genome) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
atgccgtcctcgccgttgtagacccgccag	Protospacer
*.************* *********   * 

40. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to MN062719 (Microbacterium phage PiperSansNom, complete genome) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
atgccgtcctcgccgttgtagacccgccag	Protospacer
*.************* *********   * 

41. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to MN444877 (Microbacterium phage Antares, complete genome) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
atgccgtcctcgccgttgtagacccgccag	Protospacer
*.************* *********   * 

42. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctcgccggtgtagaccttgagc	Protospacer
 ***** *****************..*..*

43. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctcgccggtgtagaccttgagc	Protospacer
 ***** *****************..*..*

44. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctcgccggtgtagaccttgagc	Protospacer
 ***** *****************..*..*

45. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctcgccggtgtagaccttgagc	Protospacer
 ***** *****************..*..*

46. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctcgccggtgtagaccttgagc	Protospacer
 ***** *****************..*..*

47. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctcgccggtgtagaccttgagc	Protospacer
 ***** *****************..*..*

48. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctcgccggtgtagaccttgagc	Protospacer
 ***** *****************..*..*

49. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctcgccggtgtagaccttgagc	Protospacer
 ***** *****************..*..*

50. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctcgccggtgtagaccttgagc	Protospacer
 ***** *****************..*..*

51. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctcgccggtgtagaccttgagc	Protospacer
 ***** *****************..*..*

52. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctcgccggtgtagaccttgagc	Protospacer
 ***** *****************..*..*

53. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctcgccggtgtagaccttgagc	Protospacer
 ***** *****************..*..*

54. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctcgccggtgtagaccttgagc	Protospacer
 ***** *****************..*..*

55. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctcgccggtgtagaccttgagc	Protospacer
 ***** *****************..*..*

56. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctcgccggtgtagaccttgagc	Protospacer
 ***** *****************..*..*

57. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctcgccggtgtagaccttgagc	Protospacer
 ***** *****************..*..*

58. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctcgccggtgtagaccttgagc	Protospacer
 ***** *****************..*..*

59. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctcgccggtgtagaccttgagc	Protospacer
 ***** *****************..*..*

60. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctcgccggtgtagaccttgagc	Protospacer
 ***** *****************..*..*

61. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctcgccggtgtagaccttgagc	Protospacer
 ***** *****************..*..*

62. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctcgccggtgtagaccttgagc	Protospacer
 ***** *****************..*..*

63. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctcgccggtgtagaccttgagc	Protospacer
 ***** *****************..*..*

64. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctcgccggtgtagaccttgagc	Protospacer
 ***** *****************..*..*

65. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctcgccggtgtagaccttgagc	Protospacer
 ***** *****************..*..*

66. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctcgccggtgtagaccttgagc	Protospacer
 ***** *****************..*..*

67. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctcgccggtgtagaccttgagc	Protospacer
 ***** *****************..*..*

68. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctcgccggtgtagaccttgagc	Protospacer
 ***** *****************..*..*

69. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctcgccggtgtagaccttgagc	Protospacer
 ***** *****************..*..*

70. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctcgccggtgtagaccttgagc	Protospacer
 ***** *****************..*..*

71. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctcgccggtgtagaccttgagc	Protospacer
 ***** *****************..*..*

72. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctcgccggtgtagaccttgagc	Protospacer
 ***** *****************..*..*

73. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctcgccggtgtagaccttgagc	Protospacer
 ***** *****************..*..*

74. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctcgccggtgtagaccttgagc	Protospacer
 ***** *****************..*..*

75. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctcgccggtgtagaccttgagc	Protospacer
 ***** *****************..*..*

76. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctcgccggtgtagaccttgagc	Protospacer
 ***** *****************..*..*

77. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctcgccggtgtagaccttgagc	Protospacer
 ***** *****************..*..*

78. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctcgccggtgtagaccttgagc	Protospacer
 ***** *****************..*..*

79. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctcgccggtgtagaccttgagc	Protospacer
 ***** *****************..*..*

80. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctcgccggtgtagaccttgagc	Protospacer
 ***** *****************..*..*

81. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctcgccggtgtagaccttgagc	Protospacer
 ***** *****************..*..*

82. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctcgccggtgtagaccttgagc	Protospacer
 ***** *****************..*..*

83. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctcgccggtgtagaccttgagc	Protospacer
 ***** *****************..*..*

84. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctcgccggtgtagaccttgagc	Protospacer
 ***** *****************..*..*

85. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctcgccggtgtagaccttgagc	Protospacer
 ***** *****************..*..*

86. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctcgccggtgtagaccttgagc	Protospacer
 ***** *****************..*..*

87. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctcgccggtgtagaccttgagc	Protospacer
 ***** *****************..*..*

88. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctcgccggtgtagaccttgagc	Protospacer
 ***** *****************..*..*

89. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctcgccggtgtagaccttgagc	Protospacer
 ***** *****************..*..*

90. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctcgccggtgtagaccttgagc	Protospacer
 ***** *****************..*..*

91. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctcgccggtgtagaccttgagc	Protospacer
 ***** *****************..*..*

92. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctcgccggtgtagaccttgagc	Protospacer
 ***** *****************..*..*

93. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctggccggtgtagaccctgagc	Protospacer
 ***** *** **************.*..*

94. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctggccggtgtagaccctgagc	Protospacer
 ***** *** **************.*..*

95. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctggccggtgtagaccctgagc	Protospacer
 ***** *** **************.*..*

96. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctggccggtgtagaccctgagc	Protospacer
 ***** *** **************.*..*

97. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctggccggtgtagaccctgagc	Protospacer
 ***** *** **************.*..*

98. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctggccggtgtagaccctgagc	Protospacer
 ***** *** **************.*..*

99. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctggccggtgtagaccctgagc	Protospacer
 ***** *** **************.*..*

100. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP039426 (Citricoccus sp. SGAir0253 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
accccgtcctcgccggtgtaggcggtgggc	Protospacer
** ******************.*  .**.*

101. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP039431 (Citricoccus sp. SGAir0453 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.8

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
accccgtcctcgccggtgtaggcggtgggc	Protospacer
** ******************.*  .**.*

102. spacer 1.3|291171|27|NC_013521|CRISPRCasFinder matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 6, identity: 0.778

cccgtctcgtcggtccgggtgccggag	CRISPR spacer
tgcgtctcgtcgatccgcgtgccggcc	Protospacer
. **********.**** *******  

103. spacer 1.3|291171|27|NC_013521|CRISPRCasFinder matches to CP036360 (Agrobacterium sp. 33MFTa1.1 plasmid p_JBx_073812, complete sequence) position: , mismatch: 6, identity: 0.778

cccgtctcgtcggtccgggtgccggag	CRISPR spacer
tgcgtctcgtcgatccgcgtgccggcc	Protospacer
. **********.**** *******  

104. spacer 1.3|291171|27|NC_013521|CRISPRCasFinder matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 6, identity: 0.778

cccgtctcgtcggtccgggtgccggag	CRISPR spacer
tgcgtctcgtcgatccgcgtgccggcc	Protospacer
. **********.**** *******  

105. spacer 1.3|291171|27|NC_013521|CRISPRCasFinder matches to NZ_CP032919 (Agrobacterium tumefaciens strain 15955 plasmid pAt15955, complete sequence) position: , mismatch: 6, identity: 0.778

cccgtctcgtcggtccgggtgccggag	CRISPR spacer
tgcgtctcgtcgatccgcgtgccggcc	Protospacer
. **********.**** *******  

106. spacer 1.3|291171|27|NC_013521|CRISPRCasFinder matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 6, identity: 0.778

cccgtctcgtcggtccgggtgccggag	CRISPR spacer
tgcgtctcgtcgatccgcgtgccggcc	Protospacer
. **********.**** *******  

107. spacer 1.3|291171|27|NC_013521|CRISPRCasFinder matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 6, identity: 0.778

cccgtctcgtcggtccgggtgccggag	CRISPR spacer
tgcgtctcgtcgatccgcgtgccggcc	Protospacer
. **********.**** *******  

108. spacer 1.6|291324|27|NC_013521|CRISPRCasFinder matches to NZ_CP045095 (Streptomyces sp. GY16 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.778

accccgtcgatgacgtaggtgccggag	CRISPR spacer
aagccgtcgatgtcgtaggtgccgcgc	Protospacer
*  ********* *********** . 

109. spacer 1.6|291324|27|NC_013521|CRISPRCasFinder matches to NZ_CP032678 (Pseudomonas sp. Leaf58 plasmid pBASL58, complete sequence) position: , mismatch: 6, identity: 0.778

accccgtcgatgacgtaggtgccggag	CRISPR spacer
accccgtcgattacataggtgccaccc	Protospacer
*********** **.********.   

110. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP031166 (Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence) position: , mismatch: 7, identity: 0.767

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
acgccgtcctcgccggtgtggatgcagtgg	Protospacer
*******************.**. * * . 

111. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 7, identity: 0.767

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctggccggtgtagaccttgagc	Protospacer
 ***** *** *************..*..*

112. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctggccggtgtagaccttgagc	Protospacer
 ***** *** *************..*..*

113. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 7, identity: 0.767

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctggccggtgtagaccttgagc	Protospacer
 ***** *** *************..*..*

114. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctggccggtgtagaccttgagc	Protospacer
 ***** *** *************..*..*

115. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctggccggtgtagaccttgagc	Protospacer
 ***** *** *************..*..*

116. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 7, identity: 0.767

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctggccggtgtagaccttgagc	Protospacer
 ***** *** *************..*..*

117. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctggccggtgtagaccttgagc	Protospacer
 ***** *** *************..*..*

118. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctggccggtgtagaccttgagc	Protospacer
 ***** *** *************..*..*

119. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctggccggtgtagaccttgagc	Protospacer
 ***** *** *************..*..*

120. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctggccggtgtagaccttgagc	Protospacer
 ***** *** *************..*..*

121. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctggccggtgtagaccttgagc	Protospacer
 ***** *** *************..*..*

122. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctggccggtgtagaccttgagc	Protospacer
 ***** *** *************..*..*

123. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctggccggtgtagaccttgagc	Protospacer
 ***** *** *************..*..*

124. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccgccggcctggccggtgtagaccttgagc	Protospacer
 ***** *** *************..*..*

125. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to MH155873 (Microbacterium phage Paschalis, complete genome) position: , mismatch: 8, identity: 0.733

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
gcattgtcctcgtcggtgtagacctcgggg	Protospacer
.*...*******.***********.***. 

126. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to MK977698 (Microbacterium phage Busephilis, complete genome) position: , mismatch: 8, identity: 0.733

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
gcattgtcctcgtcggtgtagacctcgggg	Protospacer
.*...*******.***********.***. 

127. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to MK875798 (Microbacterium phage Piperis, complete genome) position: , mismatch: 8, identity: 0.733

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
gcattgtcctcgtcggtgtagacctcgggg	Protospacer
.*...*******.***********.***. 

128. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NC_047993 (Microbacterium phage Quhwah, complete genome) position: , mismatch: 8, identity: 0.733

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
gcattgtcctcgtcggtgtagacctcgggg	Protospacer
.*...*******.***********.***. 

129. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to MN444877 (Microbacterium phage Antares, complete genome) position: , mismatch: 8, identity: 0.733

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
gcattgtcctcgtcggtgtagacctcgggg	Protospacer
.*...*******.***********.***. 

130. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP032686 (Rhizobium sp. CCGE531 plasmid pRCCGE531c, complete sequence) position: , mismatch: 8, identity: 0.733

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccatcgtcctcgccggtgtcgaccccatca	Protospacer
 *..*************** ******.   

131. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP032691 (Rhizobium sp. CCGE532 plasmid pRCCGE532c, complete sequence) position: , mismatch: 8, identity: 0.733

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
ccatcgtcctcgccggtgtcgaccccatca	Protospacer
 *..*************** ******.   

132. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to MT657336 (Microbacterium phage ClearAsMud, complete genome) position: , mismatch: 8, identity: 0.733

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
gcattgtcctcgtcggtgtagacctcgggg	Protospacer
.*...*******.***********.***. 

133. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to NZ_CP025613 (Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
tcgccgtcctcgtcggtgtagagtgggctc	Protospacer
 ***********.********* .  *  *

134. spacer 1.2|291117|30|NC_013521|CRISPRCasFinder matches to MF417880 (Uncultured Caudovirales phage clone 9F_5, partial genome) position: , mismatch: 8, identity: 0.733

acgccgtcctcgccggtgtagaccccggac	CRISPR spacer
tttccatcatcgccggtgtagaccccaaag	Protospacer
 . **.** *****************..* 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2955872 : 2967969 11 Bacillus_phage(50.0%) tail,plate NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage