Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_013942 Escherichia coli O55:H7 str. CB9615 plasmid pO55, complete sequence 0 crisprs NA 0 0 0 0
NC_013941 Escherichia coli O55:H7 str. CB9615, complete sequence 4 crisprs DinG,cas3,DEDDh,c2c9_V-U4,csa3,cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,PD-DExK 0 4 15 0

Results visualization

1. NC_013941
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_013941_1 71451-71585 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_013941_2 3436173-3436386 TypeI-E I-E
3 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_013941_3 3462080-3462293 Unclear I-E
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_013941_4 5188346-5188495 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_013941_1 1.1|71501|35|NC_013941|CRISPRCasFinder 71501-71535 35 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 101196-101230 2 0.943
NC_013941_1 1.1|71501|35|NC_013941|CRISPRCasFinder 71501-71535 35 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 165464-165498 3 0.914
NC_013941_1 1.1|71501|35|NC_013941|CRISPRCasFinder 71501-71535 35 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 14239-14273 5 0.857
NC_013941_1 1.1|71501|35|NC_013941|CRISPRCasFinder 71501-71535 35 NZ_CP044308 Escherichia coli strain C27A plasmid pC27A-3, complete sequence 56080-56114 5 0.857
NC_013941_1 1.1|71501|35|NC_013941|CRISPRCasFinder 71501-71535 35 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 6804-6838 6 0.829
NC_013941_1 1.1|71501|35|NC_013941|CRISPRCasFinder 71501-71535 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 208981-209015 6 0.829
NC_013941_1 1.1|71501|35|NC_013941|CRISPRCasFinder 71501-71535 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 219475-219509 6 0.829
NC_013941_1 1.1|71501|35|NC_013941|CRISPRCasFinder 71501-71535 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 210309-210343 6 0.829
NC_013941_1 1.1|71501|35|NC_013941|CRISPRCasFinder 71501-71535 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 191264-191298 6 0.829
NC_013941_1 1.1|71501|35|NC_013941|CRISPRCasFinder 71501-71535 35 NZ_CP010208 Escherichia coli strain M11 plasmid B, complete sequence 30177-30211 6 0.829
NC_013941_1 1.1|71501|35|NC_013941|CRISPRCasFinder 71501-71535 35 MT230312 Escherichia coli strain DH5alpha plasmid pESBL31, complete sequence 170-204 6 0.829
NC_013941_1 1.1|71501|35|NC_013941|CRISPRCasFinder 71501-71535 35 NZ_AP023209 Escherichia coli strain TUM18781 plasmid pMTY18781-4, complete sequence 88-122 6 0.829
NC_013941_1 1.1|71501|35|NC_013941|CRISPRCasFinder 71501-71535 35 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 87137-87171 7 0.8
NC_013941_1 1.1|71501|35|NC_013941|CRISPRCasFinder 71501-71535 35 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 138033-138067 7 0.8
NC_013941_1 1.1|71501|35|NC_013941|CRISPRCasFinder 71501-71535 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 43-77 7 0.8
NC_013941_1 1.1|71501|35|NC_013941|CRISPRCasFinder 71501-71535 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 3372-3406 7 0.8
NC_013941_1 1.1|71501|35|NC_013941|CRISPRCasFinder 71501-71535 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 208887-208921 7 0.8
NC_013941_1 1.1|71501|35|NC_013941|CRISPRCasFinder 71501-71535 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 42-76 7 0.8
NC_013941_1 1.1|71501|35|NC_013941|CRISPRCasFinder 71501-71535 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 3371-3405 7 0.8
NC_013941_1 1.1|71501|35|NC_013941|CRISPRCasFinder 71501-71535 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 219381-219415 7 0.8
NC_013941_1 1.1|71501|35|NC_013941|CRISPRCasFinder 71501-71535 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 42-76 7 0.8
NC_013941_1 1.1|71501|35|NC_013941|CRISPRCasFinder 71501-71535 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 3371-3405 7 0.8
NC_013941_1 1.1|71501|35|NC_013941|CRISPRCasFinder 71501-71535 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 210215-210249 7 0.8
NC_013941_1 1.1|71501|35|NC_013941|CRISPRCasFinder 71501-71535 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 42-76 7 0.8
NC_013941_1 1.1|71501|35|NC_013941|CRISPRCasFinder 71501-71535 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 3371-3405 7 0.8
NC_013941_1 1.1|71501|35|NC_013941|CRISPRCasFinder 71501-71535 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 191170-191204 7 0.8
NC_013941_1 1.1|71501|35|NC_013941|CRISPRCasFinder 71501-71535 35 NZ_CP010208 Escherichia coli strain M11 plasmid B, complete sequence 27246-27280 7 0.8
NC_013941_1 1.1|71501|35|NC_013941|CRISPRCasFinder 71501-71535 35 NZ_CP044307 Escherichia coli strain C27A plasmid pC27A-2, complete sequence 18350-18384 7 0.8
NC_013941_1 1.1|71501|35|NC_013941|CRISPRCasFinder 71501-71535 35 NZ_CP044307 Escherichia coli strain C27A plasmid pC27A-2, complete sequence 15018-15052 7 0.8
NC_013941_2 2.1|3436204|30|NC_013941|CRISPRCasFinder,CRT 3436204-3436233 30 NC_015512 Haliscomenobacter hydrossis DSM 1100 plasmid pHALHY02, complete sequence 90202-90231 7 0.767
NC_013941_1 1.1|71501|35|NC_013941|CRISPRCasFinder 71501-71535 35 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 61916-61950 8 0.771
NC_013941_1 1.1|71501|35|NC_013941|CRISPRCasFinder 71501-71535 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 4114-4148 8 0.771
NC_013941_1 1.1|71501|35|NC_013941|CRISPRCasFinder 71501-71535 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229148-229182 8 0.771
NC_013941_1 1.1|71501|35|NC_013941|CRISPRCasFinder 71501-71535 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229249-229283 8 0.771
NC_013941_1 1.1|71501|35|NC_013941|CRISPRCasFinder 71501-71535 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229350-229384 8 0.771
NC_013941_1 1.1|71501|35|NC_013941|CRISPRCasFinder 71501-71535 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229451-229485 8 0.771
NC_013941_1 1.1|71501|35|NC_013941|CRISPRCasFinder 71501-71535 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 203852-203886 8 0.771
NC_013941_1 1.1|71501|35|NC_013941|CRISPRCasFinder 71501-71535 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 204038-204072 8 0.771
NC_013941_1 1.1|71501|35|NC_013941|CRISPRCasFinder 71501-71535 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 204131-204165 8 0.771
NC_013941_1 1.1|71501|35|NC_013941|CRISPRCasFinder 71501-71535 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 4113-4147 8 0.771
NC_013941_1 1.1|71501|35|NC_013941|CRISPRCasFinder 71501-71535 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239642-239676 8 0.771
NC_013941_1 1.1|71501|35|NC_013941|CRISPRCasFinder 71501-71535 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239743-239777 8 0.771
NC_013941_1 1.1|71501|35|NC_013941|CRISPRCasFinder 71501-71535 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239844-239878 8 0.771
NC_013941_1 1.1|71501|35|NC_013941|CRISPRCasFinder 71501-71535 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239945-239979 8 0.771
NC_013941_1 1.1|71501|35|NC_013941|CRISPRCasFinder 71501-71535 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 214346-214380 8 0.771
NC_013941_1 1.1|71501|35|NC_013941|CRISPRCasFinder 71501-71535 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 214532-214566 8 0.771
NC_013941_1 1.1|71501|35|NC_013941|CRISPRCasFinder 71501-71535 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 214625-214659 8 0.771
NC_013941_1 1.1|71501|35|NC_013941|CRISPRCasFinder 71501-71535 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 4113-4147 8 0.771
NC_013941_1 1.1|71501|35|NC_013941|CRISPRCasFinder 71501-71535 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230554-230588 8 0.771
NC_013941_1 1.1|71501|35|NC_013941|CRISPRCasFinder 71501-71535 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230655-230689 8 0.771
NC_013941_1 1.1|71501|35|NC_013941|CRISPRCasFinder 71501-71535 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230756-230790 8 0.771
NC_013941_1 1.1|71501|35|NC_013941|CRISPRCasFinder 71501-71535 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230857-230891 8 0.771
NC_013941_1 1.1|71501|35|NC_013941|CRISPRCasFinder 71501-71535 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 205180-205214 8 0.771
NC_013941_1 1.1|71501|35|NC_013941|CRISPRCasFinder 71501-71535 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 205366-205400 8 0.771
NC_013941_1 1.1|71501|35|NC_013941|CRISPRCasFinder 71501-71535 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 205459-205493 8 0.771
NC_013941_1 1.1|71501|35|NC_013941|CRISPRCasFinder 71501-71535 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 4113-4147 8 0.771
NC_013941_1 1.1|71501|35|NC_013941|CRISPRCasFinder 71501-71535 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211524-211558 8 0.771
NC_013941_1 1.1|71501|35|NC_013941|CRISPRCasFinder 71501-71535 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211625-211659 8 0.771
NC_013941_1 1.1|71501|35|NC_013941|CRISPRCasFinder 71501-71535 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211726-211760 8 0.771
NC_013941_1 1.1|71501|35|NC_013941|CRISPRCasFinder 71501-71535 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211827-211861 8 0.771
NC_013941_1 1.1|71501|35|NC_013941|CRISPRCasFinder 71501-71535 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 186135-186169 8 0.771
NC_013941_1 1.1|71501|35|NC_013941|CRISPRCasFinder 71501-71535 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 186321-186355 8 0.771
NC_013941_1 1.1|71501|35|NC_013941|CRISPRCasFinder 71501-71535 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 186414-186448 8 0.771
NC_013941_1 1.1|71501|35|NC_013941|CRISPRCasFinder 71501-71535 35 NZ_CP044307 Escherichia coli strain C27A plasmid pC27A-2, complete sequence 14272-14306 8 0.771
NC_013941_1 1.1|71501|35|NC_013941|CRISPRCasFinder 71501-71535 35 NZ_CP044147 Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2 6744-6778 8 0.771
NC_013941_1 1.1|71501|35|NC_013941|CRISPRCasFinder 71501-71535 35 NZ_CP044147 Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2 7392-7426 8 0.771
NC_013941_1 1.1|71501|35|NC_013941|CRISPRCasFinder 71501-71535 35 CP044351 Escherichia coli strain 194195 plasmid p194195_1, complete sequence 83590-83624 8 0.771
NC_013941_1 1.1|71501|35|NC_013941|CRISPRCasFinder 71501-71535 35 CP044351 Escherichia coli strain 194195 plasmid p194195_1, complete sequence 84216-84250 8 0.771
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_CP033467 Enterobacter cloacae strain E3442 plasmid p3442-FRI-1, complete sequence 31628-31658 8 0.742
NC_013941_1 1.1|71501|35|NC_013941|CRISPRCasFinder 71501-71535 35 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 386558-386592 9 0.743
NC_013941_1 1.1|71501|35|NC_013941|CRISPRCasFinder 71501-71535 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 4013-4047 9 0.743
NC_013941_1 1.1|71501|35|NC_013941|CRISPRCasFinder 71501-71535 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 4012-4046 9 0.743
NC_013941_1 1.1|71501|35|NC_013941|CRISPRCasFinder 71501-71535 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 4012-4046 9 0.743
NC_013941_1 1.1|71501|35|NC_013941|CRISPRCasFinder 71501-71535 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 4012-4046 9 0.743
NC_013941_1 1.1|71501|35|NC_013941|CRISPRCasFinder 71501-71535 35 NZ_CP044308 Escherichia coli strain C27A plasmid pC27A-3, complete sequence 13988-14022 9 0.743
NC_013941_1 1.1|71501|35|NC_013941|CRISPRCasFinder 71501-71535 35 NZ_CP019246 Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence 41415-41449 9 0.743
NC_013941_2 2.1|3436204|30|NC_013941|CRISPRCasFinder,CRT 3436204-3436233 30 NC_007959 Nitrobacter hamburgensis X14 plasmid 1, complete sequence 105803-105832 9 0.7
NC_013941_2 2.3|3436326|30|NC_013941|CRISPRCasFinder,CRT,PILER-CR 3436326-3436355 30 NZ_CP024200 Thalassospira marina strain CSC3H3 plasmid pCSC3H3, complete sequence 819687-819716 9 0.7
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_CP050075 Enterobacter kobei strain 070 plasmid p070_A-KPC-2, complete sequence 53286-53316 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_KY020154 Klebsiella pneumoniae strain Kpn-431cz plasmid pKpn-431cz, complete sequence 6248-6278 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_KY399975 Enterobacter cloacae strain EClY2403 plasmid pNDM1_EClY2403, complete sequence 48844-48874 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_KY399974 Enterobacter cloacae strain EClY2402 plasmid pNDM1_EClY2402, complete sequence 48844-48874 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_KY986974 Citrobacter freundii strain 112298 plasmid p112298-tetA, complete sequence 113932-113962 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_LC511995 Enterobacter hormaechei subsp. xiangfangensis strain MY146 plasmid pMY146-rmtE, complete sequence 58738-58768 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_KY270850 Klebsiella pneumoniae strain 12181 plasmid p12181-KPC, complete sequence 125850-125880 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_KY270849 Klebsiella pneumoniae strain 0716 plasmid p0716-KPC, complete sequence 129293-129323 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_KR351290 Klebsiella pneumoniae subsp. pneumoniae strain K351 plasmid pK351, complete sequence 33203-33233 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_KJ812998 Enterobacter cloacae isolate GN574 plasmid pNDM-Ec1GN574, complete sequence 37223-37253 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_KP900016 Leclercia adecarboxylata strain P10164 plasmid pP10164-NDM, complete sequence 57706-57736 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_KP868647 Enterobacter cloacae strain WCHECl-14653 plasmid pNDM1_EC14653, complete sequence 48845-48875 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_CP040123 Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-1, complete sequence 146401-146431 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_CP026131 Klebsiella pneumoniae strain F1 plasmid pF1_1, complete sequence 20317-20347 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_CP029731 Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed3, complete sequence 21125-21155 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_KC887916 Escherichia coli strain ARL10/167 isolate EC4 plasmid pEC4-NDM-6, complete sequence 37223-37253 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_KC887917 Enterobacter cloacae isolate ECL3 plasmid pECL3-NDM-1, complete sequence 32073-32103 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_CP036301 Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid pKPC2_015093, complete sequence 94196-94226 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 CP044029 Klebsiella pneumoniae strain RJY9645 plasmid pY9645-166, complete sequence 41480-41510 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 MN891681 Klebsiella pneumoniae strain 14899 plasmid p14899-KPC, complete sequence 55332-55362 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_CP042480 Citrobacter freundii strain C50 plasmid pC50_002, complete sequence 134154-134184 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NC_025184 Klebsiella pneumoniae strain RJF866 plasmid pRJF866, complete sequence 7570-7600 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_CP042483 Klebsiella pneumoniae strain C51 plasmid pC51_002, complete sequence 101543-101573 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_CP034324 Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-KPC, complete sequence 20319-20349 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_CP040547 Klebsiella pneumoniae strain CR-HvKP5 plasmid pCR-HvKP5-KPC, complete sequence 135589-135619 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_CP022350 Klebsiella michiganensis strain K516 plasmid pK516_NDM1, complete sequence 82373-82403 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_CP039820 Klebsiella pneumoniae strain C2414 plasmid pC2414-2-KPC, complete sequence 154699-154729 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_CP044259 Klebsiella pneumoniae strain KP65 plasmid pKPC-2-KP65, complete sequence 122675-122705 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_CP039810 Klebsiella pneumoniae strain C2660 plasmid pC2660-3-KPC, complete sequence 93035-93065 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 CP038003 Klebsiella pneumoniae strain SCKP020009 plasmid pKPC2_020009, complete sequence 119443-119473 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_CP033404 Klebsiella pneumoniae strain WCHKP115069 plasmid pKPC2_115069, complete sequence 93362-93392 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_CP036306 Klebsiella pneumoniae strain WCHKP020098 plasmid pKPC2_020098, complete sequence 119444-119474 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 CP028790 Klebsiella pneumoniae strain WCHKP020030 plasmid pKPC2_020030, complete sequence 88108-88138 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_CP018999 Escherichia coli strain Ecol_AZ153 plasmid pECAZ153_KPC, complete sequence 117662-117692 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_CP042553 Enterobacter hormaechei strain C45 plasmid pC45_002, complete sequence 131512-131542 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 MK933278 Enterobacter hormaechei strain SCNJ07 plasmid pNDM-SCNJ07, complete sequence 7570-7600 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_CP026141 Klebsiella pneumoniae strain F127 plasmid pF127_1, complete sequence 85866-85896 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_CP026147 Klebsiella pneumoniae strain F132 plasmid pF132_2, complete sequence 44606-44636 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_CP026152 Klebsiella pneumoniae strain F138 plasmid pF138_3, complete sequence 82258-82288 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_CP023725 Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed3, complete sequence 9028-9058 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_CP026137 Klebsiella pneumoniae strain F77 plasmid pF77_1, complete sequence 38151-38181 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_CP042519 Citrobacter freundii strain E33 plasmid pE33_002, complete sequence 134154-134184 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 MN823990 Klebsiella pneumoniae strain 120314013 plasmid p314013-FII, complete sequence 10450-10480 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 MN842295 Klebsiella pneumoniae strain 08291 plasmid pW08291-KPC, complete sequence 51751-51781 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_CP018366 Klebsiella pneumoniae strain Kp_Goe_62629 plasmid pKp_Goe_629-2, complete sequence 2013-2043 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_AP018674 Klebsiella pneumoniae strain GSU10-3 plasmid pGSU10-3-3, complete sequence 51107-51137 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_CP023187 Klebsiella michiganensis strain K518 plasmid pK518_NDM1, complete sequence 14334-14364 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_CP043515 Enterobacter kobei strain EB_P8_L5_01.19 plasmid unnamed4, complete sequence 111144-111174 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 CP028547 Klebsiella pneumoniae subsp. pneumoniae strain SCKP020143 plasmid pKPC2_020143, complete sequence 53129-53159 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_AP018835 Enterobacter hormaechei subsp. xiangfangensis strain M324 plasmid pM324-NDM1, complete sequence 32483-32513 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_AP018832 Enterobacter hormaechei subsp. xiangfangensis strain M308 plasmid pM308-NDM1, complete sequence 32483-32513 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_CP023942 Klebsiella pneumoniae strain FDAARGOS_444 plasmid unnamed2 24525-24555 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_MH909345 Klebsiella pneumoniae strain N201205880 plasmid p205880-NDM, complete sequence 69149-69179 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_MH477636 Klebsiella pneumoniae strain 130504051 plasmid p504051-KPC, complete sequence 131158-131188 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_MK036888 Klebsiella pneumoniae strain 911021 plasmid p911021-KPC, complete sequence 153082-153112 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_MK036886 Klebsiella pneumoniae strain 283149 plasmid p283149-KPC, complete sequence 119578-119608 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_MF156695 Klebsiella pneumoniae strain 1642 plasmid p1642-1, complete sequence 50344-50374 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_MF168406 Klebsiella pneumoniae strain 283747 plasmid p283747-KPC, complete sequence 98298-98328 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_LC511996 Enterobacter hormaechei subsp. xiangfangensis strain MY458 plasmid pMY458-rmtE, complete sequence 58147-58177 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_MG462729 Escherichia coli strain AMA1742 plasmid pAMA1742, complete sequence 37224-37254 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_MH325469 Enterobacter hormaechei strain Ec13 plasmid pEc13, complete sequence 63968-63998 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_CP026698 Citrobacter koseri strain AR_0025 plasmid unitig_2_pilon, complete sequence 9374-9404 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_CP030133 Klebsiella pneumoniae strain 160111 plasmid pIncFII_L111, complete sequence 18874-18904 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_CP025463 Klebsiella pneumoniae strain F44 plasmid p44-2, complete sequence 155758-155788 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 MT108206 Klebsiella pneumoniae strain A1743 plasmid pA1743-KPC, complete sequence 51158-51188 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 MT108207 Klebsiella pneumoniae strain A1750 plasmid pA1750-KPC, complete sequence 19805-19835 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 MT108208 Klebsiella pneumoniae strain BJ20 plasmid pBJ20-KPC, complete sequence 28123-28153 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_MF042356 Enterobacter cloacae strain 20ES plasmid pNDM_20ES, complete sequence 103167-103197 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_MF042359 Serratia marcescens strain 7209 plasmid pNDM_7209, complete sequence 79993-80023 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_CP028541 Klebsiella pneumoniae strain WCHKP2 plasmid pKPC2_020002, complete sequence 146219-146249 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_CP034756 Enterobacter hormaechei subsp. hoffmannii strain Eh1 plasmid p2, complete sequence 67001-67031 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_CP016763 Citrobacter freundii strain B38 plasmid pOZ172, complete sequence 54201-54231 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_KP893385 Klebsiella pneumoniae subsp. pneumoniae strain KP1034 plasmid pKP1034, complete sequence 35851-35881 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_CP026133 Klebsiella pneumoniae strain F5 plasmid pF5_1, complete sequence 72642-72672 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_CP033962 Klebsiella pneumoniae strain L482 plasmid p3_L382, complete sequence 104862-104892 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_CP017059 Citrobacter freundii strain SL151 plasmid unnamed2, complete sequence 72031-72061 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_CP026241 Citrobacter freundii complex sp. CFNIH9 plasmid pCFR-e790, complete sequence 43466-43496 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_CP033394 Klebsiella pneumoniae strain WCHKP015625 plasmid pCTXM65_015625, complete sequence 26599-26629 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_CP036362 Klebsiella pneumoniae strain WCHKP2080 plasmid pKPC2_095080, complete sequence 35652-35682 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 MT066418 Klebsiella pneumoniae strain ST11 plasmid p158590-KPC, complete sequence 126985-127015 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_CP025952 Klebsiella pneumoniae subsp. pneumoniae strain GD4 plasmid pKPGD4, complete sequence 32555-32585 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_CP036372 Klebsiella pneumoniae strain WCHKP020037 plasmid pKPC2_020037, complete sequence 141473-141503 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 MN891684 Klebsiella pneumoniae strain BJ107 plasmid pBJ107-KPC, complete sequence 109257-109287 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 MN891685 Klebsiella pneumoniae strain BJ119 plasmid pBJ119-KPC, complete sequence 42378-42408 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_CP026551 Citrobacter sp. SL156 plasmid unnamed2 202844-202874 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_CP035386 Enterobacter hormaechei strain S11_16 plasmid unnamed1, complete sequence 102076-102106 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_CP022697 Citrobacter farmeri strain AUSMDU00008141 plasmid pAUSMDU8141-2, complete sequence 120093-120123 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_CP021538 Escherichia coli strain AR_0119 plasmid unitig_4, complete sequence 57594-57624 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_CP035277 Citrobacter freundii strain R17 plasmid pCFR17_1, complete sequence 177632-177662 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_CP017850 Klebsiella variicola strain GJ2 plasmid pKPGJ-2a, complete sequence 7442-7472 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_CP017285 Klebsiella variicola strain GJ3 plasmid pKPGJ-3a, complete sequence 14835-14865 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_CP044035 Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed1, complete sequence 90147-90177 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_CP017283 Klebsiella variicola strain GJ1 plasmid pKPGJ-1a, complete sequence 27972-28002 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NC_021501 Klebsiella michiganensis E718 plasmid pKOX_NDM1, complete sequence 103182-103212 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_CP023914 Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed3, complete sequence 42487-42517 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_CP040541 Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-pKPC, complete sequence 146288-146318 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_CP026584 Klebsiella pneumoniae strain WCHKP649 plasmid pKPC2_095649, complete sequence 83789-83819 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_CP028582 Klebsiella pneumoniae strain WCHKP36 plasmid pKPC2_020036, complete sequence 41858-41888 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_CP036366 Klebsiella pneumoniae strain WCHKP115068 plasmid pCTXM65_115068, complete sequence 15003-15033 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 MN842291 Klebsiella pneumoniae strain 11935 plasmid p11935-KPC, complete sequence 58045-58075 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 MN842292 Klebsiella pneumoniae strain 12085 plasmid p12085-KPC, complete sequence 32256-32286 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 CP016403 Klebsiella pneumoniae subsp. pneumoniae strain F5 plasmid pF5, complete sequence 5831-5861 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_CP016402 Klebsiella pneumoniae subsp. pneumoniae strain F77 plasmid pF77, complete sequence 6143-6173 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_CP040598 Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15_NDM-1, complete sequence 50194-50224 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_CP014296 Klebsiella pneumoniae strain KP38731 plasmid unnamed11 sequence 38807-38837 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_CP026025 Klebsiella pneumoniae strain 11420 plasmid p11420-KPC, complete sequence 44620-44650 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_CP030345 Enterobacter hormaechei strain AR_038 plasmid unnamed1 117619-117649 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_CP026589 Klebsiella pneumoniae strain NUHL30457 plasmid p3, complete sequence 60862-60892 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 MN891678 Klebsiella pneumoniae strain Kpn47 plasmid pKpn47-KPC, complete sequence 26770-26800 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_MH909344 Enterobacter cloacae strain 12949 plasmid p12949-FIIY, complete sequence 72983-73013 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_MH255827 Klebsiella pneumoniae subsp. pneumoniae strain SH9 plasmid pSH9-KPC, complete sequence 40270-40300 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_MH917285 Klebsiella pneumoniae strain 427113 plasmid p427113-Ct1/2, complete sequence 147742-147772 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_MH909327 Klebsiella pneumoniae strain 526316 plasmid p526316-KPC, complete sequence 109061-109091 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_MK124610 Citrobacter werkmanii strain Cb_CB1_SE1_NDM_08_2017 plasmid pCB1_SE1_NDM, complete sequence 71931-71961 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_MF133495 Klebsiella pneumoniae strain 675920 plasmid p675920-1, complete sequence 135467-135497 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_MF168403 Klebsiella pneumoniae strain 12139 plasmid p12139-KPC, complete sequence 96619-96649 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_MF168405 Klebsiella pneumoniae strain 64917 plasmid p64917-KPC, complete sequence 96616-96646 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_LC511997 Enterobacter hormaechei subsp. xiangfangensis strain MY460 plasmid pMY460-rmtE, complete sequence 251169-251199 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_CP032893 Enterobacter kobei strain WCHEK045523 plasmid p1_045523, complete sequence 144679-144709 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_CP018455 Klebsiella pneumoniae strain SWU01 plasmid unnamed, complete sequence 71827-71857 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 MT109193 Klebsiella pneumoniae strain 156070 plasmid p156070-KPC, complete sequence 379-409 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_CP035537 Klebsiella pneumoniae subsp. pneumoniae strain CCRI-22199 plasmid pKp199-2, complete sequence 41001-41031 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_MF042350 Klebsiella pneumoniae strain 18ES plasmid pNDM_18ES, complete sequence 102832-102862 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_MF042351 Serratia marcescens strain 12TM plasmid pNDM_12TM, complete sequence 102594-102624 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_MF042358 Enterobacter cloacae strain 22ES plasmid pNDM_22ES, complete sequence 92798-92828 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_MF042352 Serratia marcescens strain 4TM plasmid pNDM_4TM, complete sequence 102595-102625 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_MF042357 Serratia marcescens strain 9580 plasmid pNDM_9580, complete sequence 98014-98044 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_MG764553 Klebsiella pneumoniae strain A3295 plasmid pA3295-KPC, complete sequence 124745-124775 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_CP031720 Klebsiella pneumoniae strain SCKP020003 plasmid pKPC2_020003, complete sequence 4947-4977 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 MT108205 Klebsiella pneumoniae strain 71221 plasmid p71221-KPC, complete sequence 62547-62577 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 MT108212 Klebsiella pneumoniae strain 12478 plasmid p12478-KPC, complete sequence 97374-97404 9 0.71
NC_013941_3 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT 3462110-3462140 31 NZ_CP040535 Klebsiella pneumoniae strain CR-HvKP1 plasmid pCR-HvKP1-KPC, complete sequence 35830-35860 9 0.71

1. spacer 1.1|71501|35|NC_013941|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 2, identity: 0.943

agataagacgcgtcagcgtcgcatcaggcgctgaa	CRISPR spacer
tgataagacgcgccagcgtcgcatcaggcgctgaa	Protospacer
 ***********.**********************

2. spacer 1.1|71501|35|NC_013941|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 3, identity: 0.914

agataagacgcgtcagcgtcgcatcaggcgctgaa	CRISPR spacer
agataagacgcgtcagcgtcgcatcaggcgttaca	Protospacer
******************************.*. *

3. spacer 1.1|71501|35|NC_013941|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 5, identity: 0.857

agataagacgcgtcagcgtcgcatcaggcgctgaa	CRISPR spacer
tgataagacgcgacagcggcgcatcaggcgctggt	Protospacer
 *********** ***** **************. 

4. spacer 1.1|71501|35|NC_013941|CRISPRCasFinder matches to NZ_CP044308 (Escherichia coli strain C27A plasmid pC27A-3, complete sequence) position: , mismatch: 5, identity: 0.857

agataagacgcgtcagcgtcgcatcaggcgctgaa	CRISPR spacer
cgctaagacgcgccagcgtcgcatcaggcgttgag	Protospacer
 * *********.*****************.***.

5. spacer 1.1|71501|35|NC_013941|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 6, identity: 0.829

agataagacgcgtcagcgtcgcatcaggcgctgaa	CRISPR spacer
agataagacgcgtcagcgtcgcatctggcataaac	Protospacer
************************* ***.. .* 

6. spacer 1.1|71501|35|NC_013941|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 6, identity: 0.829

agataagacgcgtcagcgtcgcatcaggcgctgaa	CRISPR spacer
tgataagacgcgtcagcgtcgcatcaggcatctga	Protospacer
 ****************************... .*

7. spacer 1.1|71501|35|NC_013941|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 6, identity: 0.829

agataagacgcgtcagcgtcgcatcaggcgctgaa	CRISPR spacer
tgataagacgcgtcagcgtcgcatcaggcatctga	Protospacer
 ****************************... .*

8. spacer 1.1|71501|35|NC_013941|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 6, identity: 0.829

agataagacgcgtcagcgtcgcatcaggcgctgaa	CRISPR spacer
tgataagacgcgtcagcgtcgcatcaggcatctga	Protospacer
 ****************************... .*

9. spacer 1.1|71501|35|NC_013941|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 6, identity: 0.829

agataagacgcgtcagcgtcgcatcaggcgctgaa	CRISPR spacer
tgataagacgcgtcagcgtcgcatcaggcatctga	Protospacer
 ****************************... .*

10. spacer 1.1|71501|35|NC_013941|CRISPRCasFinder matches to NZ_CP010208 (Escherichia coli strain M11 plasmid B, complete sequence) position: , mismatch: 6, identity: 0.829

agataagacgcgtcagcgtcgcatcaggcgctgaa	CRISPR spacer
tgataagacgcgtcagcgtcgcatcaggcatcaga	Protospacer
 ****************************.....*

11. spacer 1.1|71501|35|NC_013941|CRISPRCasFinder matches to MT230312 (Escherichia coli strain DH5alpha plasmid pESBL31, complete sequence) position: , mismatch: 6, identity: 0.829

agataagacgcgtcagcgtcgcatcaggcgctgaa	CRISPR spacer
tgataagacgcgtcagcgtcgcatcaggcttcaat	Protospacer
 **************************** ...* 

12. spacer 1.1|71501|35|NC_013941|CRISPRCasFinder matches to NZ_AP023209 (Escherichia coli strain TUM18781 plasmid pMTY18781-4, complete sequence) position: , mismatch: 6, identity: 0.829

agataagacgcgtcagcgtcgcatcaggcgctgaa	CRISPR spacer
tgataagacgcgtcagcgtcgcatcaggcatcggc	Protospacer
 ****************************...*. 

13. spacer 1.1|71501|35|NC_013941|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 7, identity: 0.8

agataagacgcgtcagcgtcgcatcaggcgctgaa	CRISPR spacer
tgataagacgcggcagcgtcgcatcaggcatcgtg	Protospacer
 *********** ****************...* .

14. spacer 1.1|71501|35|NC_013941|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 7, identity: 0.8

agataagacgcgtcagcgtcgcatcaggcgctgaa	CRISPR spacer
tgataagacgcattagcgtcgcatcaggcagcgca	Protospacer
 **********.*.***************. .* *

15. spacer 1.1|71501|35|NC_013941|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 7, identity: 0.8

agataagacgcgtcagcgtcgcatcaggcgctgaa	CRISPR spacer
tgataagacgcgtcagcgtcgcatcaggcatcagc	Protospacer
 ****************************..... 

16. spacer 1.1|71501|35|NC_013941|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 7, identity: 0.8

agataagacgcgtcagcgtcgcatcaggcgctgaa	CRISPR spacer
tgataagacgcgccagcgtcgcatcaggcacctgc	Protospacer
 ***********.****************.*. . 

17. spacer 1.1|71501|35|NC_013941|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 7, identity: 0.8

agataagacgcgtcagcgtcgcatcaggcgctgaa	CRISPR spacer
tgataaaacgcgtcagcgtcgcatcaggcatcggc	Protospacer
 *****.**********************...*. 

18. spacer 1.1|71501|35|NC_013941|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 7, identity: 0.8

agataagacgcgtcagcgtcgcatcaggcgctgaa	CRISPR spacer
tgataagacgcgtcagcgtcgcatcaggcatcagc	Protospacer
 ****************************..... 

19. spacer 1.1|71501|35|NC_013941|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 7, identity: 0.8

agataagacgcgtcagcgtcgcatcaggcgctgaa	CRISPR spacer
tgataagacgcgccagcgtcgcatcaggcacctgc	Protospacer
 ***********.****************.*. . 

20. spacer 1.1|71501|35|NC_013941|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 7, identity: 0.8

agataagacgcgtcagcgtcgcatcaggcgctgaa	CRISPR spacer
tgataaaacgcgtcagcgtcgcatcaggcatcggc	Protospacer
 *****.**********************...*. 

21. spacer 1.1|71501|35|NC_013941|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 7, identity: 0.8

agataagacgcgtcagcgtcgcatcaggcgctgaa	CRISPR spacer
tgataagacgcgtcagcgtcgcatcaggcatcagc	Protospacer
 ****************************..... 

22. spacer 1.1|71501|35|NC_013941|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 7, identity: 0.8

agataagacgcgtcagcgtcgcatcaggcgctgaa	CRISPR spacer
tgataagacgcgccagcgtcgcatcaggcacctgc	Protospacer
 ***********.****************.*. . 

23. spacer 1.1|71501|35|NC_013941|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 7, identity: 0.8

agataagacgcgtcagcgtcgcatcaggcgctgaa	CRISPR spacer
tgataaaacgcgtcagcgtcgcatcaggcatcggc	Protospacer
 *****.**********************...*. 

24. spacer 1.1|71501|35|NC_013941|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 7, identity: 0.8

agataagacgcgtcagcgtcgcatcaggcgctgaa	CRISPR spacer
tgataagacgcgtcagcgtcgcatcaggcatcagc	Protospacer
 ****************************..... 

25. spacer 1.1|71501|35|NC_013941|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 7, identity: 0.8

agataagacgcgtcagcgtcgcatcaggcgctgaa	CRISPR spacer
tgataagacgcgccagcgtcgcatcaggcacctgc	Protospacer
 ***********.****************.*. . 

26. spacer 1.1|71501|35|NC_013941|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 7, identity: 0.8

agataagacgcgtcagcgtcgcatcaggcgctgaa	CRISPR spacer
tgataaaacgcgtcagcgtcgcatcaggcatcggc	Protospacer
 *****.**********************...*. 

27. spacer 1.1|71501|35|NC_013941|CRISPRCasFinder matches to NZ_CP010208 (Escherichia coli strain M11 plasmid B, complete sequence) position: , mismatch: 7, identity: 0.8

agataagacgcgtcagcgtcgcatcaggcgctgaa	CRISPR spacer
tgataagacgcgtctgcgtcgcatctggcaccggt	Protospacer
 ************* ********** ***.*.*. 

28. spacer 1.1|71501|35|NC_013941|CRISPRCasFinder matches to NZ_CP044307 (Escherichia coli strain C27A plasmid pC27A-2, complete sequence) position: , mismatch: 7, identity: 0.8

agataagacgcgtcagcgtcgcatcaggcgctgaa	CRISPR spacer
tgataagacgcgtcagcgtcgcatcaggcatcagc	Protospacer
 ****************************..... 

29. spacer 1.1|71501|35|NC_013941|CRISPRCasFinder matches to NZ_CP044307 (Escherichia coli strain C27A plasmid pC27A-2, complete sequence) position: , mismatch: 7, identity: 0.8

agataagacgcgtcagcgtcgcatcaggcgctgaa	CRISPR spacer
tgataagacgcgccagcgtcgcatcaggcacctgg	Protospacer
 ***********.****************.*. ..

30. spacer 2.1|3436204|30|NC_013941|CRISPRCasFinder,CRT matches to NC_015512 (Haliscomenobacter hydrossis DSM 1100 plasmid pHALHY02, complete sequence) position: , mismatch: 7, identity: 0.767

agcggcacgctggattgaacaaatccctgg----	CRISPR spacer
tgcggcacgatgggttgaacaaa----tggactt	Protospacer
 ******** ***.*********    ***    

31. spacer 1.1|71501|35|NC_013941|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 8, identity: 0.771

agataagacgcgtcagcgtcgcatcaggcgctgaa	CRISPR spacer
agataagacgcgccagcgtcgcatctggcatctgc	Protospacer
************.************ ***... . 

32. spacer 1.1|71501|35|NC_013941|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 8, identity: 0.771

agataagacgcgtcagcgtcgcatcaggcgctgaa	CRISPR spacer
tgataagacgcgccagcgtcgcatcaggcatctgc	Protospacer
 ***********.****************... . 

33. spacer 1.1|71501|35|NC_013941|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 8, identity: 0.771

agataagacgcgtcagcgtcgcatcaggcgctgaa	CRISPR spacer
tgataagacgcgttagcgtcgcatcaggcatctgc	Protospacer
 ************.***************... . 

34. spacer 1.1|71501|35|NC_013941|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 8, identity: 0.771

agataagacgcgtcagcgtcgcatcaggcgctgaa	CRISPR spacer
tgataagacgcgttagcgtcgcatcaggcatctgc	Protospacer
 ************.***************... . 

35. spacer 1.1|71501|35|NC_013941|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 8, identity: 0.771

agataagacgcgtcagcgtcgcatcaggcgctgaa	CRISPR spacer
tgataagacgcgttagcgtcgcatcaggcatctgc	Protospacer
 ************.***************... . 

36. spacer 1.1|71501|35|NC_013941|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 8, identity: 0.771

agataagacgcgtcagcgtcgcatcaggcgctgaa	CRISPR spacer
tgataagacgcgttagcgtcgcatcaggcatctgc	Protospacer
 ************.***************... . 

37. spacer 1.1|71501|35|NC_013941|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 8, identity: 0.771

agataagacgcgtcagcgtcgcatcaggcgctgaa	CRISPR spacer
tgataagtcgcgtcagcgacgcatcaggcatcggc	Protospacer
 ****** ********** **********...*. 

38. spacer 1.1|71501|35|NC_013941|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 8, identity: 0.771

agataagacgcgtcagcgtcgcatcaggcgctgaa	CRISPR spacer
tgataagtcgcgtcagcggcgcatcaggcatcggt	Protospacer
 ****** ********** **********...*. 

39. spacer 1.1|71501|35|NC_013941|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 8, identity: 0.771

agataagacgcgtcagcgtcgcatcaggcgctgaa	CRISPR spacer
tgataagtcgcgtcagcggcgcatcaggcatcggt	Protospacer
 ****** ********** **********...*. 

40. spacer 1.1|71501|35|NC_013941|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 8, identity: 0.771

agataagacgcgtcagcgtcgcatcaggcgctgaa	CRISPR spacer
tgataagacgcgccagcgtcgcatcaggcatctgc	Protospacer
 ***********.****************... . 

41. spacer 1.1|71501|35|NC_013941|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 8, identity: 0.771

agataagacgcgtcagcgtcgcatcaggcgctgaa	CRISPR spacer
tgataagacgcgttagcgtcgcatcaggcatctgc	Protospacer
 ************.***************... . 

42. spacer 1.1|71501|35|NC_013941|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 8, identity: 0.771

agataagacgcgtcagcgtcgcatcaggcgctgaa	CRISPR spacer
tgataagacgcgttagcgtcgcatcaggcatctgc	Protospacer
 ************.***************... . 

43. spacer 1.1|71501|35|NC_013941|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 8, identity: 0.771

agataagacgcgtcagcgtcgcatcaggcgctgaa	CRISPR spacer
tgataagacgcgttagcgtcgcatcaggcatctgc	Protospacer
 ************.***************... . 

44. spacer 1.1|71501|35|NC_013941|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 8, identity: 0.771

agataagacgcgtcagcgtcgcatcaggcgctgaa	CRISPR spacer
tgataagacgcgttagcgtcgcatcaggcatctgc	Protospacer
 ************.***************... . 

45. spacer 1.1|71501|35|NC_013941|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 8, identity: 0.771

agataagacgcgtcagcgtcgcatcaggcgctgaa	CRISPR spacer
tgataagtcgcgtcagcgacgcatcaggcatcggc	Protospacer
 ****** ********** **********...*. 

46. spacer 1.1|71501|35|NC_013941|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 8, identity: 0.771

agataagacgcgtcagcgtcgcatcaggcgctgaa	CRISPR spacer
tgataagtcgcgtcagcggcgcatcaggcatcggt	Protospacer
 ****** ********** **********...*. 

47. spacer 1.1|71501|35|NC_013941|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 8, identity: 0.771

agataagacgcgtcagcgtcgcatcaggcgctgaa	CRISPR spacer
tgataagtcgcgtcagcggcgcatcaggcatcggt	Protospacer
 ****** ********** **********...*. 

48. spacer 1.1|71501|35|NC_013941|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 8, identity: 0.771

agataagacgcgtcagcgtcgcatcaggcgctgaa	CRISPR spacer
tgataagacgcgccagcgtcgcatcaggcatctgc	Protospacer
 ***********.****************... . 

49. spacer 1.1|71501|35|NC_013941|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 8, identity: 0.771

agataagacgcgtcagcgtcgcatcaggcgctgaa	CRISPR spacer
tgataagacgcgttagcgtcgcatcaggcatctgc	Protospacer
 ************.***************... . 

50. spacer 1.1|71501|35|NC_013941|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 8, identity: 0.771

agataagacgcgtcagcgtcgcatcaggcgctgaa	CRISPR spacer
tgataagacgcgttagcgtcgcatcaggcatctgc	Protospacer
 ************.***************... . 

51. spacer 1.1|71501|35|NC_013941|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 8, identity: 0.771

agataagacgcgtcagcgtcgcatcaggcgctgaa	CRISPR spacer
tgataagacgcgttagcgtcgcatcaggcatctgc	Protospacer
 ************.***************... . 

52. spacer 1.1|71501|35|NC_013941|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 8, identity: 0.771

agataagacgcgtcagcgtcgcatcaggcgctgaa	CRISPR spacer
tgataagacgcgttagcgtcgcatcaggcatctgc	Protospacer
 ************.***************... . 

53. spacer 1.1|71501|35|NC_013941|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 8, identity: 0.771

agataagacgcgtcagcgtcgcatcaggcgctgaa	CRISPR spacer
tgataagtcgcgtcagcgacgcatcaggcatcggc	Protospacer
 ****** ********** **********...*. 

54. spacer 1.1|71501|35|NC_013941|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 8, identity: 0.771

agataagacgcgtcagcgtcgcatcaggcgctgaa	CRISPR spacer
tgataagtcgcgtcagcggcgcatcaggcatcggt	Protospacer
 ****** ********** **********...*. 

55. spacer 1.1|71501|35|NC_013941|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 8, identity: 0.771

agataagacgcgtcagcgtcgcatcaggcgctgaa	CRISPR spacer
tgataagtcgcgtcagcggcgcatcaggcatcggt	Protospacer
 ****** ********** **********...*. 

56. spacer 1.1|71501|35|NC_013941|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 8, identity: 0.771

agataagacgcgtcagcgtcgcatcaggcgctgaa	CRISPR spacer
tgataagacgcgccagcgtcgcatcaggcatctgc	Protospacer
 ***********.****************... . 

57. spacer 1.1|71501|35|NC_013941|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 8, identity: 0.771

agataagacgcgtcagcgtcgcatcaggcgctgaa	CRISPR spacer
tgataagacgcgttagcgtcgcatcaggcatctgc	Protospacer
 ************.***************... . 

58. spacer 1.1|71501|35|NC_013941|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 8, identity: 0.771

agataagacgcgtcagcgtcgcatcaggcgctgaa	CRISPR spacer
tgataagacgcgttagcgtcgcatcaggcatctgc	Protospacer
 ************.***************... . 

59. spacer 1.1|71501|35|NC_013941|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 8, identity: 0.771

agataagacgcgtcagcgtcgcatcaggcgctgaa	CRISPR spacer
tgataagacgcgttagcgtcgcatcaggcatctgc	Protospacer
 ************.***************... . 

60. spacer 1.1|71501|35|NC_013941|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 8, identity: 0.771

agataagacgcgtcagcgtcgcatcaggcgctgaa	CRISPR spacer
tgataagacgcgttagcgtcgcatcaggcatctgc	Protospacer
 ************.***************... . 

61. spacer 1.1|71501|35|NC_013941|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 8, identity: 0.771

agataagacgcgtcagcgtcgcatcaggcgctgaa	CRISPR spacer
tgataagtcgcgtcagcgacgcatcaggcatcggc	Protospacer
 ****** ********** **********...*. 

62. spacer 1.1|71501|35|NC_013941|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 8, identity: 0.771

agataagacgcgtcagcgtcgcatcaggcgctgaa	CRISPR spacer
tgataagtcgcgtcagcggcgcatcaggcatcggt	Protospacer
 ****** ********** **********...*. 

63. spacer 1.1|71501|35|NC_013941|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 8, identity: 0.771

agataagacgcgtcagcgtcgcatcaggcgctgaa	CRISPR spacer
tgataagtcgcgtcagcggcgcatcaggcatcggt	Protospacer
 ****** ********** **********...*. 

64. spacer 1.1|71501|35|NC_013941|CRISPRCasFinder matches to NZ_CP044307 (Escherichia coli strain C27A plasmid pC27A-2, complete sequence) position: , mismatch: 8, identity: 0.771

agataagacgcgtcagcgtcgcatcaggcgctgaa	CRISPR spacer
tgataagatgcgccagcgtcgcatcaggtaattca	Protospacer
 *******.***.***************.. *  *

65. spacer 1.1|71501|35|NC_013941|CRISPRCasFinder matches to NZ_CP044147 (Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2) position: , mismatch: 8, identity: 0.771

agataagacgcgtcagcgtcgcatcaggcgctgaa	CRISPR spacer
tgataagacgcgtcagcgtcgtatcaggcatctgc	Protospacer
 ********************.*******... . 

66. spacer 1.1|71501|35|NC_013941|CRISPRCasFinder matches to NZ_CP044147 (Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2) position: , mismatch: 8, identity: 0.771

agataagacgcgtcagcgtcgcatcaggcgctgaa	CRISPR spacer
tgataagacgcgccagcgtcgcatcaggcatccgg	Protospacer
 ***********.****************... ..

67. spacer 1.1|71501|35|NC_013941|CRISPRCasFinder matches to CP044351 (Escherichia coli strain 194195 plasmid p194195_1, complete sequence) position: , mismatch: 8, identity: 0.771

agataagacgcgtcagcgtcgcatcaggcgctgaa	CRISPR spacer
tgataagacgcgtcagcgtcgtatcaggcatctgc	Protospacer
 ********************.*******... . 

68. spacer 1.1|71501|35|NC_013941|CRISPRCasFinder matches to CP044351 (Escherichia coli strain 194195 plasmid p194195_1, complete sequence) position: , mismatch: 8, identity: 0.771

agataagacgcgtcagcgtcgcatcaggcgctgaa	CRISPR spacer
tgataagacgcgccagcgtcgcatcaggcatccgg	Protospacer
 ***********.****************... ..

69. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_CP033467 (Enterobacter cloacae strain E3442 plasmid p3442-FRI-1, complete sequence) position: , mismatch: 8, identity: 0.742

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
cgccttcgtaatttttttgctgctcgctttt	Protospacer
* *  .. *********.*****.*******

70. spacer 1.1|71501|35|NC_013941|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 9, identity: 0.743

agataagacgcgtcagcgtcgcatcaggcgctgaa	CRISPR spacer
tgataagacgcgttagcatcgcatcaggcatcagc	Protospacer
 ************.***.***********..... 

71. spacer 1.1|71501|35|NC_013941|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 9, identity: 0.743

agataagacgcgtcagcgtcgcatcaggcgctgaa	CRISPR spacer
tgataagacgcgctagcgtcgcatcaggcatctgc	Protospacer
 ***********..***************... . 

72. spacer 1.1|71501|35|NC_013941|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 9, identity: 0.743

agataagacgcgtcagcgtcgcatcaggcgctgaa	CRISPR spacer
tgataagacgcgctagcgtcgcatcaggcatctgc	Protospacer
 ***********..***************... . 

73. spacer 1.1|71501|35|NC_013941|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 9, identity: 0.743

agataagacgcgtcagcgtcgcatcaggcgctgaa	CRISPR spacer
tgataagacgcgctagcgtcgcatcaggcatctgc	Protospacer
 ***********..***************... . 

74. spacer 1.1|71501|35|NC_013941|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 9, identity: 0.743

agataagacgcgtcagcgtcgcatcaggcgctgaa	CRISPR spacer
tgataagacgcgctagcgtcgcatcaggcatctgc	Protospacer
 ***********..***************... . 

75. spacer 1.1|71501|35|NC_013941|CRISPRCasFinder matches to NZ_CP044308 (Escherichia coli strain C27A plasmid pC27A-3, complete sequence) position: , mismatch: 9, identity: 0.743

agataagacgcgtcagcgtcgcatcaggcgctgaa	CRISPR spacer
cgataagacgcgccagcgtcgcatcgggcatccgt	Protospacer
 ***********.************.***... . 

76. spacer 1.1|71501|35|NC_013941|CRISPRCasFinder matches to NZ_CP019246 (Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence) position: , mismatch: 9, identity: 0.743

agataagacgcgtcagcgtcgcatcaggcgctgaa	CRISPR spacer
tgataagacgcgccagcgtcgcatcagacatcagc	Protospacer
 ***********.**************.*..... 

77. spacer 2.1|3436204|30|NC_013941|CRISPRCasFinder,CRT matches to NC_007959 (Nitrobacter hamburgensis X14 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.7

agcggcacgctggattgaacaaatccctgg	CRISPR spacer
ataacgccgctggcttgaacaaatcccttt	Protospacer
*  .   ****** **************  

78. spacer 2.3|3436326|30|NC_013941|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024200 (Thalassospira marina strain CSC3H3 plasmid pCSC3H3, complete sequence) position: , mismatch: 9, identity: 0.7

cacaaaccgcccatcttcccgattactgca	CRISPR spacer
cacaaaccgcccatcttcgcggacaaccgg	Protospacer
****************** **. .* .  .

79. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_CP050075 (Enterobacter kobei strain 070 plasmid p070_A-KPC-2, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

80. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_KY020154 (Klebsiella pneumoniae strain Kpn-431cz plasmid pKpn-431cz, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

81. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_KY399975 (Enterobacter cloacae strain EClY2403 plasmid pNDM1_EClY2403, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

82. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_KY399974 (Enterobacter cloacae strain EClY2402 plasmid pNDM1_EClY2402, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

83. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_KY986974 (Citrobacter freundii strain 112298 plasmid p112298-tetA, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

84. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_LC511995 (Enterobacter hormaechei subsp. xiangfangensis strain MY146 plasmid pMY146-rmtE, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

85. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_KY270850 (Klebsiella pneumoniae strain 12181 plasmid p12181-KPC, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

86. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_KY270849 (Klebsiella pneumoniae strain 0716 plasmid p0716-KPC, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

87. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_KR351290 (Klebsiella pneumoniae subsp. pneumoniae strain K351 plasmid pK351, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

88. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_KJ812998 (Enterobacter cloacae isolate GN574 plasmid pNDM-Ec1GN574, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

89. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_KP900016 (Leclercia adecarboxylata strain P10164 plasmid pP10164-NDM, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

90. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_KP868647 (Enterobacter cloacae strain WCHECl-14653 plasmid pNDM1_EC14653, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

91. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_CP040123 (Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-1, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

92. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_CP026131 (Klebsiella pneumoniae strain F1 plasmid pF1_1, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

93. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_CP029731 (Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

94. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_KC887916 (Escherichia coli strain ARL10/167 isolate EC4 plasmid pEC4-NDM-6, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

95. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_KC887917 (Enterobacter cloacae isolate ECL3 plasmid pECL3-NDM-1, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

96. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_CP036301 (Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid pKPC2_015093, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

97. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to CP044029 (Klebsiella pneumoniae strain RJY9645 plasmid pY9645-166, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

98. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to MN891681 (Klebsiella pneumoniae strain 14899 plasmid p14899-KPC, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

99. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_CP042480 (Citrobacter freundii strain C50 plasmid pC50_002, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

100. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NC_025184 (Klebsiella pneumoniae strain RJF866 plasmid pRJF866, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

101. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_CP042483 (Klebsiella pneumoniae strain C51 plasmid pC51_002, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

102. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_CP034324 (Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-KPC, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

103. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_CP040547 (Klebsiella pneumoniae strain CR-HvKP5 plasmid pCR-HvKP5-KPC, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

104. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_CP022350 (Klebsiella michiganensis strain K516 plasmid pK516_NDM1, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

105. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_CP039820 (Klebsiella pneumoniae strain C2414 plasmid pC2414-2-KPC, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

106. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_CP044259 (Klebsiella pneumoniae strain KP65 plasmid pKPC-2-KP65, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

107. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_CP039810 (Klebsiella pneumoniae strain C2660 plasmid pC2660-3-KPC, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

108. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to CP038003 (Klebsiella pneumoniae strain SCKP020009 plasmid pKPC2_020009, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

109. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_CP033404 (Klebsiella pneumoniae strain WCHKP115069 plasmid pKPC2_115069, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

110. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_CP036306 (Klebsiella pneumoniae strain WCHKP020098 plasmid pKPC2_020098, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

111. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to CP028790 (Klebsiella pneumoniae strain WCHKP020030 plasmid pKPC2_020030, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

112. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_CP018999 (Escherichia coli strain Ecol_AZ153 plasmid pECAZ153_KPC, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

113. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_CP042553 (Enterobacter hormaechei strain C45 plasmid pC45_002, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

114. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to MK933278 (Enterobacter hormaechei strain SCNJ07 plasmid pNDM-SCNJ07, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

115. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_CP026141 (Klebsiella pneumoniae strain F127 plasmid pF127_1, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

116. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_CP026147 (Klebsiella pneumoniae strain F132 plasmid pF132_2, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

117. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_CP026152 (Klebsiella pneumoniae strain F138 plasmid pF138_3, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

118. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_CP023725 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

119. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_CP026137 (Klebsiella pneumoniae strain F77 plasmid pF77_1, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

120. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_CP042519 (Citrobacter freundii strain E33 plasmid pE33_002, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

121. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to MN823990 (Klebsiella pneumoniae strain 120314013 plasmid p314013-FII, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

122. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to MN842295 (Klebsiella pneumoniae strain 08291 plasmid pW08291-KPC, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

123. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_CP018366 (Klebsiella pneumoniae strain Kp_Goe_62629 plasmid pKp_Goe_629-2, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

124. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_AP018674 (Klebsiella pneumoniae strain GSU10-3 plasmid pGSU10-3-3, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

125. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_CP023187 (Klebsiella michiganensis strain K518 plasmid pK518_NDM1, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

126. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_CP043515 (Enterobacter kobei strain EB_P8_L5_01.19 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

127. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to CP028547 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020143 plasmid pKPC2_020143, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

128. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_AP018835 (Enterobacter hormaechei subsp. xiangfangensis strain M324 plasmid pM324-NDM1, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

129. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_AP018832 (Enterobacter hormaechei subsp. xiangfangensis strain M308 plasmid pM308-NDM1, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

130. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_CP023942 (Klebsiella pneumoniae strain FDAARGOS_444 plasmid unnamed2) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

131. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_MH909345 (Klebsiella pneumoniae strain N201205880 plasmid p205880-NDM, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

132. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_MH477636 (Klebsiella pneumoniae strain 130504051 plasmid p504051-KPC, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

133. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_MK036888 (Klebsiella pneumoniae strain 911021 plasmid p911021-KPC, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

134. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_MK036886 (Klebsiella pneumoniae strain 283149 plasmid p283149-KPC, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

135. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_MF156695 (Klebsiella pneumoniae strain 1642 plasmid p1642-1, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

136. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_MF168406 (Klebsiella pneumoniae strain 283747 plasmid p283747-KPC, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

137. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_LC511996 (Enterobacter hormaechei subsp. xiangfangensis strain MY458 plasmid pMY458-rmtE, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

138. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_MG462729 (Escherichia coli strain AMA1742 plasmid pAMA1742, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

139. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_MH325469 (Enterobacter hormaechei strain Ec13 plasmid pEc13, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

140. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_CP026698 (Citrobacter koseri strain AR_0025 plasmid unitig_2_pilon, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

141. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_CP030133 (Klebsiella pneumoniae strain 160111 plasmid pIncFII_L111, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

142. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_CP025463 (Klebsiella pneumoniae strain F44 plasmid p44-2, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

143. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to MT108206 (Klebsiella pneumoniae strain A1743 plasmid pA1743-KPC, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

144. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to MT108207 (Klebsiella pneumoniae strain A1750 plasmid pA1750-KPC, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

145. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to MT108208 (Klebsiella pneumoniae strain BJ20 plasmid pBJ20-KPC, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

146. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_MF042356 (Enterobacter cloacae strain 20ES plasmid pNDM_20ES, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

147. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_MF042359 (Serratia marcescens strain 7209 plasmid pNDM_7209, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

148. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_CP028541 (Klebsiella pneumoniae strain WCHKP2 plasmid pKPC2_020002, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

149. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_CP034756 (Enterobacter hormaechei subsp. hoffmannii strain Eh1 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

150. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_CP016763 (Citrobacter freundii strain B38 plasmid pOZ172, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

151. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_KP893385 (Klebsiella pneumoniae subsp. pneumoniae strain KP1034 plasmid pKP1034, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

152. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_CP026133 (Klebsiella pneumoniae strain F5 plasmid pF5_1, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

153. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_CP033962 (Klebsiella pneumoniae strain L482 plasmid p3_L382, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

154. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_CP017059 (Citrobacter freundii strain SL151 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

155. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_CP026241 (Citrobacter freundii complex sp. CFNIH9 plasmid pCFR-e790, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

156. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_CP033394 (Klebsiella pneumoniae strain WCHKP015625 plasmid pCTXM65_015625, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

157. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_CP036362 (Klebsiella pneumoniae strain WCHKP2080 plasmid pKPC2_095080, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

158. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to MT066418 (Klebsiella pneumoniae strain ST11 plasmid p158590-KPC, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

159. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_CP025952 (Klebsiella pneumoniae subsp. pneumoniae strain GD4 plasmid pKPGD4, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

160. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_CP036372 (Klebsiella pneumoniae strain WCHKP020037 plasmid pKPC2_020037, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

161. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to MN891684 (Klebsiella pneumoniae strain BJ107 plasmid pBJ107-KPC, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

162. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to MN891685 (Klebsiella pneumoniae strain BJ119 plasmid pBJ119-KPC, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

163. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_CP026551 (Citrobacter sp. SL156 plasmid unnamed2) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

164. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_CP035386 (Enterobacter hormaechei strain S11_16 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

165. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_CP022697 (Citrobacter farmeri strain AUSMDU00008141 plasmid pAUSMDU8141-2, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

166. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_CP021538 (Escherichia coli strain AR_0119 plasmid unitig_4, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

167. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_CP035277 (Citrobacter freundii strain R17 plasmid pCFR17_1, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

168. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_CP017850 (Klebsiella variicola strain GJ2 plasmid pKPGJ-2a, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

169. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_CP017285 (Klebsiella variicola strain GJ3 plasmid pKPGJ-3a, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

170. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_CP044035 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

171. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_CP017283 (Klebsiella variicola strain GJ1 plasmid pKPGJ-1a, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

172. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NC_021501 (Klebsiella michiganensis E718 plasmid pKOX_NDM1, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

173. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_CP023914 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

174. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_CP040541 (Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-pKPC, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

175. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_CP026584 (Klebsiella pneumoniae strain WCHKP649 plasmid pKPC2_095649, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

176. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_CP028582 (Klebsiella pneumoniae strain WCHKP36 plasmid pKPC2_020036, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

177. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_CP036366 (Klebsiella pneumoniae strain WCHKP115068 plasmid pCTXM65_115068, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

178. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to MN842291 (Klebsiella pneumoniae strain 11935 plasmid p11935-KPC, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

179. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to MN842292 (Klebsiella pneumoniae strain 12085 plasmid p12085-KPC, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

180. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to CP016403 (Klebsiella pneumoniae subsp. pneumoniae strain F5 plasmid pF5, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

181. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_CP016402 (Klebsiella pneumoniae subsp. pneumoniae strain F77 plasmid pF77, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

182. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_CP040598 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15_NDM-1, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

183. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_CP014296 (Klebsiella pneumoniae strain KP38731 plasmid unnamed11 sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

184. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_CP026025 (Klebsiella pneumoniae strain 11420 plasmid p11420-KPC, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

185. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_CP030345 (Enterobacter hormaechei strain AR_038 plasmid unnamed1) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

186. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_CP026589 (Klebsiella pneumoniae strain NUHL30457 plasmid p3, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

187. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to MN891678 (Klebsiella pneumoniae strain Kpn47 plasmid pKpn47-KPC, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

188. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_MH909344 (Enterobacter cloacae strain 12949 plasmid p12949-FIIY, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

189. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_MH255827 (Klebsiella pneumoniae subsp. pneumoniae strain SH9 plasmid pSH9-KPC, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

190. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_MH917285 (Klebsiella pneumoniae strain 427113 plasmid p427113-Ct1/2, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

191. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_MH909327 (Klebsiella pneumoniae strain 526316 plasmid p526316-KPC, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

192. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_MK124610 (Citrobacter werkmanii strain Cb_CB1_SE1_NDM_08_2017 plasmid pCB1_SE1_NDM, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

193. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_MF133495 (Klebsiella pneumoniae strain 675920 plasmid p675920-1, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

194. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_MF168403 (Klebsiella pneumoniae strain 12139 plasmid p12139-KPC, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

195. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_MF168405 (Klebsiella pneumoniae strain 64917 plasmid p64917-KPC, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

196. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_LC511997 (Enterobacter hormaechei subsp. xiangfangensis strain MY460 plasmid pMY460-rmtE, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

197. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_CP032893 (Enterobacter kobei strain WCHEK045523 plasmid p1_045523, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

198. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_CP018455 (Klebsiella pneumoniae strain SWU01 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

199. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to MT109193 (Klebsiella pneumoniae strain 156070 plasmid p156070-KPC, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

200. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_CP035537 (Klebsiella pneumoniae subsp. pneumoniae strain CCRI-22199 plasmid pKp199-2, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

201. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_MF042350 (Klebsiella pneumoniae strain 18ES plasmid pNDM_18ES, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

202. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_MF042351 (Serratia marcescens strain 12TM plasmid pNDM_12TM, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

203. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_MF042358 (Enterobacter cloacae strain 22ES plasmid pNDM_22ES, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

204. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_MF042352 (Serratia marcescens strain 4TM plasmid pNDM_4TM, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

205. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_MF042357 (Serratia marcescens strain 9580 plasmid pNDM_9580, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

206. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_MG764553 (Klebsiella pneumoniae strain A3295 plasmid pA3295-KPC, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

207. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_CP031720 (Klebsiella pneumoniae strain SCKP020003 plasmid pKPC2_020003, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

208. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to MT108205 (Klebsiella pneumoniae strain 71221 plasmid p71221-KPC, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

209. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to MT108212 (Klebsiella pneumoniae strain 12478 plasmid p12478-KPC, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

210. spacer 3.1|3462110|31|NC_013941|CRISPRCasFinder,CRT matches to NZ_CP040535 (Klebsiella pneumoniae strain CR-HvKP1 plasmid pCR-HvKP1-KPC, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgactttaattttttcgctgcccgctttt	CRISPR spacer
tgccttcgtaatttttttgctgctcgctttt	Protospacer
. *  .. *********.*****.*******

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 199837 : 276260 57 uncultured_Caudovirales_phage(20.0%) tRNA,protease,plate,transposase NA
DBSCAN-SWA_2 298717 : 352976 68 Enterobacteria_phage(40.62%) integrase,head,protease,portal,capsid,tail,holin,lysis,terminase attL 314137:314150|attR 355227:355240
DBSCAN-SWA_3 687060 : 755159 79 Enterobacteria_phage(53.57%) tRNA,integrase,transposase,head,protease,portal,capsid,tail,lysis,terminase attL 697221:697267|attR 746636:746682
DBSCAN-SWA_4 980788 : 1026322 63 Enterobacteria_phage(44.44%) integrase,protease,portal,tail,holin,lysis,terminase attL 971318:971332|attR 985756:985770
DBSCAN-SWA_5 1574629 : 1643169 74 Stx2-converting_phage(32.65%) integrase,transposase,head,protease,capsid,tail,holin,terminase attL 1567520:1567533|attR 1584309:1584322
DBSCAN-SWA_6 1726810 : 1778957 65 Escherichia_phage(39.34%) tRNA,integrase,protease,portal,tail,holin,terminase attL 1727635:1727650|attR 1781231:1781246
DBSCAN-SWA_7 1960027 : 2017604 70 Enterobacteria_phage(35.09%) integrase,transposase,head,portal,capsid,tail,holin,terminase attL 1993630:1993645|attR 2025771:2025786
DBSCAN-SWA_8 2149819 : 2195331 62 Enterobacteria_phage(72.0%) tRNA,integrase,head,portal,capsid,tail,holin,plate,terminase attL 2152222:2152246|attR 2187973:2187997
DBSCAN-SWA_9 2440336 : 2516409 69 Enterobacteria_phage(39.02%) integrase,transposase,head,protease,portal,capsid,tail,holin,terminase attL 2459261:2459276|attR 2523230:2523245
DBSCAN-SWA_10 2677587 : 2687033 10 Enterobacteria_phage(85.71%) NA NA
DBSCAN-SWA_11 2932965 : 2938391 6 Enterobacteria_phage(50.0%) integrase attL 2923416:2923432|attR 2935380:2935396
DBSCAN-SWA_12 3124151 : 3200788 81 Salmonella_phage(46.81%) tRNA,capsid,tail,holin,plate,terminase NA
DBSCAN-SWA_13 3214947 : 3315071 115 Enterobacteria_phage(32.1%) tRNA,integrase,transposase,head,protease,capsid,tail,holin,lysis,terminase attL 3254274:3254289|attR 3314995:3315010
DBSCAN-SWA_14 3716164 : 3723565 9 Shigella_phage(16.67%) transposase NA
DBSCAN-SWA_15 5306262 : 5358235 64 Enterobacteria_phage(45.28%) integrase,head,portal,capsid,tail,holin,terminase attL 5303176:5303201|attR 5360309:5360334
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage