Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_013720 Pirellula staleyi DSM 6068, complete sequence 6 crisprs csa3,cas1,cas2,cas10,csm4gr5,csm3gr7,cas3,WYL,Cas9_archaeal,cas4 0 3 2 0

Results visualization

1. NC_013720
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_013720_1 800828-800955 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_013720_2 1403843-1405020 TypeIII NA
16 spacers
cas1,cas2,cas10,csm4gr5,csm3gr7

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_013720_3 1408802-1409837 TypeIII NA
14 spacers
cas2,cas1,cas10,csm4gr5,csm3gr7

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_013720_4 2420487-2420616 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_013720_5 3051289-3051392 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_013720_6 6116233-6116396 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_013720_2 2.9|1404439|35|NC_013720|CRISPRCasFinder,CRT,PILER-CR 1404439-1404473 35 NZ_CP015038 Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence 30932-30966 10 0.714
NC_013720_3 3.8|1409339|35|NC_013720|PILER-CR 1409339-1409373 35 MN693479 Marine virus AFVG_25M465, complete genome 221-255 11 0.686
NC_013720_3 3.15|1409328|35|NC_013720|CRISPRCasFinder,CRT 1409328-1409362 35 MN693479 Marine virus AFVG_25M465, complete genome 221-255 11 0.686

1. spacer 2.9|1404439|35|NC_013720|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015038 (Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence) position: , mismatch: 10, identity: 0.714

ccgccgcgatcggaaagttcaatccgttcacgcct	CRISPR spacer
acgccgcgatccgaaagctcaatccgagtgctgcc	Protospacer
 ********** *****.********  ..*  *.

2. spacer 3.8|1409339|35|NC_013720|PILER-CR matches to MN693479 (Marine virus AFVG_25M465, complete genome) position: , mismatch: 11, identity: 0.686

gatgaggccattaccttcttttctttgccttttag	CRISPR spacer
gccataaagattacctttttttctttgccatttat	Protospacer
* .. ..  ********.*********** **** 

3. spacer 3.15|1409328|35|NC_013720|CRISPRCasFinder,CRT matches to MN693479 (Marine virus AFVG_25M465, complete genome) position: , mismatch: 11, identity: 0.686

gatgaggccattaccttcttttctttgccttttag	CRISPR spacer
gccataaagattacctttttttctttgccatttat	Protospacer
* .. ..  ********.*********** **** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1632271 : 1641367 8 Canarypox_virus(16.67%) NA NA
DBSCAN-SWA_2 2316311 : 2392543 52 Agrobacterium_phage(14.29%) protease,plate NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage