Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 1 crisprs csa3 2 25 0 0
NC_014019 Bacillus megaterium QM B1551, complete sequence 9 crisprs DinG,csa3,cas3,WYL,RT,DEDDh,cas14j 0 0 3 0
NC_014023 Bacillus megaterium QM B1551 plasmid pBM700, complete sequence 0 crisprs RT 0 0 0 0
NC_014031 Bacillus megaterium QM B1551 plasmid pBM600, complete sequence 0 crisprs NA 0 0 1 0
NC_010008 Bacillus megaterium QM B1551 plasmid pBM100, complete sequence 0 crisprs NA 0 0 0 0
NC_010009 Bacillus megaterium QM B1551 plasmid pBM200, complete sequence 0 crisprs NA 0 0 0 0
NC_010010 Bacillus megaterium QM B1551 plasmid pBM300, complete sequence 0 crisprs NA 0 0 0 0
NC_004604 Bacillus megaterium QM B1551 plasmid pBM400, complete sequence 0 crisprs RT 0 0 0 0

Results visualization

1. NC_014025
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014025_1 51459-53316 Orphan NA
25 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_014025_1 1.17|52831|23|NC_014025|CRT 52831-52853 23 NC_014025.1 51436-51458 2 0.913
NC_014025_1 1.19|52921|23|NC_014025|CRT 52921-52943 23 NC_014025.1 51436-51458 2 0.913

1. spacer 1.17|52831|23|NC_014025|CRT matches to position: 51436-51458, mismatch: 2, identity: 0.913

ctaccggaatcactggagctact	CRISPR spacer
ctaccggagtcacgggagctact	Protospacer
********.**** *********

2. spacer 1.19|52921|23|NC_014025|CRT matches to position: 51436-51458, mismatch: 2, identity: 0.913

ctaccggagtcactggggctact	CRISPR spacer
ctaccggagtcacgggagctact	Protospacer
************* **.******

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_014025_1 1.6|52003|59|NC_014025|CRT 52003-52061 59 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 51841-51899 0 1.0
NC_014025_1 1.6|52003|59|NC_014025|CRT 52003-52061 59 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52003-52061 0 1.0
NC_014025_1 1.8|52183|59|NC_014025|CRT 52183-52241 59 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52183-52241 0 1.0
NC_014025_1 1.10|52354|41|NC_014025|CRT 52354-52394 41 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52354-52394 0 1.0
NC_014025_1 1.10|52354|41|NC_014025|CRT 52354-52394 41 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52444-52484 0 1.0
NC_014025_1 1.13|52597|23|NC_014025|CRT 52597-52619 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52597-52619 0 1.0
NC_014025_1 1.14|52642|59|NC_014025|CRT 52642-52700 59 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52642-52700 0 1.0
NC_014025_1 1.15|52723|41|NC_014025|CRT 52723-52763 41 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52489-52529 0 1.0
NC_014025_1 1.15|52723|41|NC_014025|CRT 52723-52763 41 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52723-52763 0 1.0
NC_014025_1 1.16|52786|23|NC_014025|CRT 52786-52808 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52786-52808 0 1.0
NC_014025_1 1.16|52786|23|NC_014025|CRT 52786-52808 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52876-52898 0 1.0
NC_014025_1 1.17|52831|23|NC_014025|CRT 52831-52853 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52174-52196 0 1.0
NC_014025_1 1.17|52831|23|NC_014025|CRT 52831-52853 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52291-52313 0 1.0
NC_014025_1 1.17|52831|23|NC_014025|CRT 52831-52853 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52831-52853 0 1.0
NC_014025_1 1.17|52831|23|NC_014025|CRT 52831-52853 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 53218-53240 0 1.0
NC_014025_1 1.18|52876|23|NC_014025|CRT 52876-52898 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52786-52808 0 1.0
NC_014025_1 1.18|52876|23|NC_014025|CRT 52876-52898 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52876-52898 0 1.0
NC_014025_1 1.19|52921|23|NC_014025|CRT 52921-52943 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52921-52943 0 1.0
NC_014025_1 1.20|52966|32|NC_014025|CRT 52966-52997 32 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52966-52997 0 1.0
NC_014025_1 1.20|52966|32|NC_014025|CRT 52966-52997 32 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 53083-53114 0 1.0
NC_014025_1 1.21|53020|41|NC_014025|CRT 53020-53060 41 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 53020-53060 0 1.0
NC_014025_1 1.21|53020|41|NC_014025|CRT 53020-53060 41 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 53137-53177 0 1.0
NC_014025_1 1.22|53083|32|NC_014025|CRT 53083-53114 32 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52966-52997 0 1.0
NC_014025_1 1.22|53083|32|NC_014025|CRT 53083-53114 32 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 53083-53114 0 1.0
NC_014025_1 1.23|53137|41|NC_014025|CRT 53137-53177 41 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 53020-53060 0 1.0
NC_014025_1 1.23|53137|41|NC_014025|CRT 53137-53177 41 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 53137-53177 0 1.0
NC_014025_1 1.24|53200|50|NC_014025|CRT 53200-53249 50 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 53200-53249 0 1.0
NC_014025_1 1.25|53272|23|NC_014025|CRT 53272-53294 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 53272-53294 0 1.0
NC_014025_1 1.13|52597|23|NC_014025|CRT 52597-52619 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52327-52349 1 0.957
NC_014025_1 1.13|52597|23|NC_014025|CRT 52597-52619 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52552-52574 1 0.957
NC_014025_1 1.13|52597|23|NC_014025|CRT 52597-52619 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52777-52799 1 0.957
NC_014025_1 1.13|52597|23|NC_014025|CRT 52597-52619 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52867-52889 1 0.957
NC_014025_1 1.13|52597|23|NC_014025|CRT 52597-52619 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 53263-53285 1 0.957
NC_014025_1 1.15|52723|41|NC_014025|CRT 52723-52763 41 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52399-52439 1 0.976
NC_014025_1 1.16|52786|23|NC_014025|CRT 52786-52808 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 51427-51449 1 0.957
NC_014025_1 1.16|52786|23|NC_014025|CRT 52786-52808 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52048-52070 1 0.957
NC_014025_1 1.16|52786|23|NC_014025|CRT 52786-52808 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52399-52421 1 0.957
NC_014025_1 1.17|52831|23|NC_014025|CRT 52831-52853 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52345-52367 1 0.957
NC_014025_1 1.17|52831|23|NC_014025|CRT 52831-52853 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52435-52457 1 0.957
NC_014025_1 1.17|52831|23|NC_014025|CRT 52831-52853 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52813-52835 1 0.957
NC_014025_1 1.17|52831|23|NC_014025|CRT 52831-52853 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52903-52925 1 0.957
NC_014025_1 1.17|52831|23|NC_014025|CRT 52831-52853 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 51508-51530 1 0.957
NC_014025_1 1.17|52831|23|NC_014025|CRT 52831-52853 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 51778-51800 1 0.957
NC_014025_1 1.17|52831|23|NC_014025|CRT 52831-52853 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 51940-51962 1 0.957
NC_014025_1 1.17|52831|23|NC_014025|CRT 52831-52853 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52318-52340 1 0.957
NC_014025_1 1.17|52831|23|NC_014025|CRT 52831-52853 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52471-52493 1 0.957
NC_014025_1 1.17|52831|23|NC_014025|CRT 52831-52853 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52858-52880 1 0.957
NC_014025_1 1.18|52876|23|NC_014025|CRT 52876-52898 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 51427-51449 1 0.957
NC_014025_1 1.18|52876|23|NC_014025|CRT 52876-52898 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52048-52070 1 0.957
NC_014025_1 1.18|52876|23|NC_014025|CRT 52876-52898 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52399-52421 1 0.957
NC_014025_1 1.19|52921|23|NC_014025|CRT 52921-52943 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 51472-51494 1 0.957
NC_014025_1 1.19|52921|23|NC_014025|CRT 52921-52943 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 51625-51647 1 0.957
NC_014025_1 1.19|52921|23|NC_014025|CRT 52921-52943 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 51508-51530 1 0.957
NC_014025_1 1.19|52921|23|NC_014025|CRT 52921-52943 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52471-52493 1 0.957
NC_014025_1 1.24|53200|50|NC_014025|CRT 53200-53249 50 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52156-52205 1 0.98
NC_014025_1 1.24|53200|50|NC_014025|CRT 53200-53249 50 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52273-52322 1 0.98
NC_014025_1 1.25|53272|23|NC_014025|CRT 53272-53294 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52129-52151 1 0.957
NC_014025_1 1.25|53272|23|NC_014025|CRT 53272-53294 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52246-52268 1 0.957
NC_014025_1 1.25|53272|23|NC_014025|CRT 53272-53294 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52336-52358 1 0.957
NC_014025_1 1.25|53272|23|NC_014025|CRT 53272-53294 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52660-52682 1 0.957
NC_014025_1 1.25|53272|23|NC_014025|CRT 53272-53294 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52822-52844 1 0.957
NC_014025_1 1.25|53272|23|NC_014025|CRT 53272-53294 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 53056-53078 1 0.957
NC_014025_1 1.25|53272|23|NC_014025|CRT 53272-53294 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 53173-53195 1 0.957
NC_014025_1 1.10|52354|41|NC_014025|CRT 52354-52394 41 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52894-52934 2 0.951
NC_014025_1 1.13|52597|23|NC_014025|CRT 52597-52619 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 51418-51440 2 0.913
NC_014025_1 1.13|52597|23|NC_014025|CRT 52597-52619 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 51679-51701 2 0.913
NC_014025_1 1.13|52597|23|NC_014025|CRT 52597-52619 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 51841-51863 2 0.913
NC_014025_1 1.13|52597|23|NC_014025|CRT 52597-52619 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52003-52025 2 0.913
NC_014025_1 1.13|52597|23|NC_014025|CRT 52597-52619 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 53011-53033 2 0.913
NC_014025_1 1.13|52597|23|NC_014025|CRT 52597-52619 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 53128-53150 2 0.913
NC_014025_1 1.13|52597|23|NC_014025|CRT 52597-52619 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 51742-51764 2 0.913
NC_014025_1 1.13|52597|23|NC_014025|CRT 52597-52619 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 51904-51926 2 0.913
NC_014025_1 1.13|52597|23|NC_014025|CRT 52597-52619 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52183-52205 2 0.913
NC_014025_1 1.13|52597|23|NC_014025|CRT 52597-52619 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52300-52322 2 0.913
NC_014025_1 1.13|52597|23|NC_014025|CRT 52597-52619 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52390-52412 2 0.913
NC_014025_1 1.13|52597|23|NC_014025|CRT 52597-52619 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52840-52862 2 0.913
NC_014025_1 1.16|52786|23|NC_014025|CRT 52786-52808 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 51886-51908 2 0.913
NC_014025_1 1.16|52786|23|NC_014025|CRT 52786-52808 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52336-52358 2 0.913
NC_014025_1 1.16|52786|23|NC_014025|CRT 52786-52808 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52372-52394 2 0.913
NC_014025_1 1.16|52786|23|NC_014025|CRT 52786-52808 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52462-52484 2 0.913
NC_014025_1 1.16|52786|23|NC_014025|CRT 52786-52808 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52489-52511 2 0.913
NC_014025_1 1.16|52786|23|NC_014025|CRT 52786-52808 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52723-52745 2 0.913
NC_014025_1 1.16|52786|23|NC_014025|CRT 52786-52808 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52912-52934 2 0.913
NC_014025_1 1.16|52786|23|NC_014025|CRT 52786-52808 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 51751-51773 2 0.913
NC_014025_1 1.16|52786|23|NC_014025|CRT 52786-52808 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 51913-51935 2 0.913
NC_014025_1 1.16|52786|23|NC_014025|CRT 52786-52808 23 EU744250 Mycobacterium virus Pukovnik, complete genome 3156-3178 2 0.913
NC_014025_1 1.17|52831|23|NC_014025|CRT 52831-52853 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 51580-51602 2 0.913
NC_014025_1 1.17|52831|23|NC_014025|CRT 52831-52853 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52363-52385 2 0.913
NC_014025_1 1.17|52831|23|NC_014025|CRT 52831-52853 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52453-52475 2 0.913
NC_014025_1 1.17|52831|23|NC_014025|CRT 52831-52853 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52768-52790 2 0.913
NC_014025_1 1.17|52831|23|NC_014025|CRT 52831-52853 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 51436-51458 2 0.913
NC_014025_1 1.17|52831|23|NC_014025|CRT 52831-52853 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 51661-51683 2 0.913
NC_014025_1 1.17|52831|23|NC_014025|CRT 52831-52853 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52381-52403 2 0.913
NC_014025_1 1.17|52831|23|NC_014025|CRT 52831-52853 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52705-52727 2 0.913
NC_014025_1 1.17|52831|23|NC_014025|CRT 52831-52853 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52921-52943 2 0.913
NC_014025_1 1.17|52831|23|NC_014025|CRT 52831-52853 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 53254-53276 2 0.913
NC_014025_1 1.17|52831|23|NC_014025|CRT 52831-52853 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 53281-53303 2 0.913
NC_014025_1 1.17|52831|23|NC_014025|CRT 52831-52853 23 NZ_CP009691 Bacillus mycoides strain ATCC 6462 plasmid pBMX_1, complete sequence 122266-122288 2 0.913
NC_014025_1 1.17|52831|23|NC_014025|CRT 52831-52853 23 MT586120 Synechococcus phage S-CAM7 isolate 0809CC03, complete genome 172741-172763 2 0.913
NC_014025_1 1.17|52831|23|NC_014025|CRT 52831-52853 23 MT586120 Synechococcus phage S-CAM7 isolate 0809CC03, complete genome 172849-172871 2 0.913
NC_014025_1 1.17|52831|23|NC_014025|CRT 52831-52853 23 MT586120 Synechococcus phage S-CAM7 isolate 0809CC03, complete genome 172894-172916 2 0.913
NC_014025_1 1.17|52831|23|NC_014025|CRT 52831-52853 23 MT586120 Synechococcus phage S-CAM7 isolate 0809CC03, complete genome 172939-172961 2 0.913
NC_014025_1 1.17|52831|23|NC_014025|CRT 52831-52853 23 MT586120 Synechococcus phage S-CAM7 isolate 0809CC03, complete genome 173260-173282 2 0.913
NC_014025_1 1.17|52831|23|NC_014025|CRT 52831-52853 23 NC_031927 Synechococcus phage S-CAM7 isolate 0910CC49, complete genome 171345-171367 2 0.913
NC_014025_1 1.17|52831|23|NC_014025|CRT 52831-52853 23 NC_031927 Synechococcus phage S-CAM7 isolate 0910CC49, complete genome 171453-171475 2 0.913
NC_014025_1 1.17|52831|23|NC_014025|CRT 52831-52853 23 NC_031927 Synechococcus phage S-CAM7 isolate 0910CC49, complete genome 171498-171520 2 0.913
NC_014025_1 1.17|52831|23|NC_014025|CRT 52831-52853 23 NC_031927 Synechococcus phage S-CAM7 isolate 0910CC49, complete genome 171543-171565 2 0.913
NC_014025_1 1.17|52831|23|NC_014025|CRT 52831-52853 23 NC_031927 Synechococcus phage S-CAM7 isolate 0910CC49, complete genome 171864-171886 2 0.913
NC_014025_1 1.17|52831|23|NC_014025|CRT 52831-52853 23 KU686213 Synechococcus phage S-CAM7 isolate 0910SB42, complete genome 173367-173389 2 0.913
NC_014025_1 1.17|52831|23|NC_014025|CRT 52831-52853 23 KU686213 Synechococcus phage S-CAM7 isolate 0910SB42, complete genome 173475-173497 2 0.913
NC_014025_1 1.17|52831|23|NC_014025|CRT 52831-52853 23 KU686213 Synechococcus phage S-CAM7 isolate 0910SB42, complete genome 173520-173542 2 0.913
NC_014025_1 1.17|52831|23|NC_014025|CRT 52831-52853 23 KU686213 Synechococcus phage S-CAM7 isolate 0910SB42, complete genome 173565-173587 2 0.913
NC_014025_1 1.17|52831|23|NC_014025|CRT 52831-52853 23 KU686213 Synechococcus phage S-CAM7 isolate 0910SB42, complete genome 173886-173908 2 0.913
NC_014025_1 1.17|52831|23|NC_014025|CRT 52831-52853 23 CP013001 Bacillus thuringiensis strain XL6 plasmid, complete sequence 192335-192357 2 0.913
NC_014025_1 1.17|52831|23|NC_014025|CRT 52831-52853 23 LC554890 Ralstonia phage RP13 DNA, nearly complete genome 96485-96507 2 0.913
NC_014025_1 1.18|52876|23|NC_014025|CRT 52876-52898 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 51886-51908 2 0.913
NC_014025_1 1.18|52876|23|NC_014025|CRT 52876-52898 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52336-52358 2 0.913
NC_014025_1 1.18|52876|23|NC_014025|CRT 52876-52898 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52372-52394 2 0.913
NC_014025_1 1.18|52876|23|NC_014025|CRT 52876-52898 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52462-52484 2 0.913
NC_014025_1 1.18|52876|23|NC_014025|CRT 52876-52898 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52489-52511 2 0.913
NC_014025_1 1.18|52876|23|NC_014025|CRT 52876-52898 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52723-52745 2 0.913
NC_014025_1 1.18|52876|23|NC_014025|CRT 52876-52898 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52912-52934 2 0.913
NC_014025_1 1.18|52876|23|NC_014025|CRT 52876-52898 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 51751-51773 2 0.913
NC_014025_1 1.18|52876|23|NC_014025|CRT 52876-52898 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 51913-51935 2 0.913
NC_014025_1 1.18|52876|23|NC_014025|CRT 52876-52898 23 EU744250 Mycobacterium virus Pukovnik, complete genome 3156-3178 2 0.913
NC_014025_1 1.19|52921|23|NC_014025|CRT 52921-52943 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 51580-51602 2 0.913
NC_014025_1 1.19|52921|23|NC_014025|CRT 52921-52943 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 51436-51458 2 0.913
NC_014025_1 1.19|52921|23|NC_014025|CRT 52921-52943 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 51661-51683 2 0.913
NC_014025_1 1.19|52921|23|NC_014025|CRT 52921-52943 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52174-52196 2 0.913
NC_014025_1 1.19|52921|23|NC_014025|CRT 52921-52943 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52291-52313 2 0.913
NC_014025_1 1.19|52921|23|NC_014025|CRT 52921-52943 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52381-52403 2 0.913
NC_014025_1 1.19|52921|23|NC_014025|CRT 52921-52943 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52705-52727 2 0.913
NC_014025_1 1.19|52921|23|NC_014025|CRT 52921-52943 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52831-52853 2 0.913
NC_014025_1 1.19|52921|23|NC_014025|CRT 52921-52943 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 53218-53240 2 0.913
NC_014025_1 1.19|52921|23|NC_014025|CRT 52921-52943 23 NZ_CP015352 Bacillus thuringiensis strain MYBT18246 plasmid p142098, complete sequence 24299-24321 2 0.913
NC_014025_1 1.19|52921|23|NC_014025|CRT 52921-52943 23 NZ_CP015352 Bacillus thuringiensis strain MYBT18246 plasmid p142098, complete sequence 24416-24438 2 0.913
NC_014025_1 1.19|52921|23|NC_014025|CRT 52921-52943 23 NZ_CP015352 Bacillus thuringiensis strain MYBT18246 plasmid p142098, complete sequence 24569-24591 2 0.913
NC_014025_1 1.19|52921|23|NC_014025|CRT 52921-52943 23 NZ_CP015352 Bacillus thuringiensis strain MYBT18246 plasmid p142098, complete sequence 24641-24663 2 0.913
NC_014025_1 1.19|52921|23|NC_014025|CRT 52921-52943 23 NZ_CP015352 Bacillus thuringiensis strain MYBT18246 plasmid p142098, complete sequence 24776-24798 2 0.913
NC_014025_1 1.19|52921|23|NC_014025|CRT 52921-52943 23 KJ019095 Synechococcus phage ACG-2014f isolate Syn7803US34, complete genome 14758-14780 2 0.913
NC_014025_1 1.19|52921|23|NC_014025|CRT 52921-52943 23 KJ019086 Synechococcus phage ACG-2014f isolate Syn7803US17, complete genome 14757-14779 2 0.913
NC_014025_1 1.19|52921|23|NC_014025|CRT 52921-52943 23 KJ019106 Synechococcus phage ACG-2014f isolate Syn7803US50, complete genome 14539-14561 2 0.913
NC_014025_1 1.19|52921|23|NC_014025|CRT 52921-52943 23 KJ019107 Synechococcus phage ACG-2014f isolate Syn7803US52, complete genome 14526-14548 2 0.913
NC_014025_1 1.19|52921|23|NC_014025|CRT 52921-52943 23 KJ019143 Synechococcus phage ACG-2014f isolate Syn7803C12, complete genome 14529-14551 2 0.913
NC_014025_1 1.19|52921|23|NC_014025|CRT 52921-52943 23 KJ019103 Synechococcus phage ACG-2014f isolate Syn7803US44, complete genome 15063-15085 2 0.913
NC_014025_1 1.19|52921|23|NC_014025|CRT 52921-52943 23 KJ019102 Synechococcus phage ACG-2014f isolate Syn7803US43, complete genome 14538-14560 2 0.913
NC_014025_1 1.19|52921|23|NC_014025|CRT 52921-52943 23 KJ019066 Synechococcus phage ACG-2014f isolate Syn7803C9, complete genome 14526-14548 2 0.913
NC_014025_1 1.19|52921|23|NC_014025|CRT 52921-52943 23 KJ019149 Synechococcus phage ACG-2014f isolate Syn7803C21, complete genome 14539-14561 2 0.913
NC_014025_1 1.19|52921|23|NC_014025|CRT 52921-52943 23 KJ019105 Synechococcus phage ACG-2014f isolate Syn7803US4, complete genome 14526-14548 2 0.913
NC_014025_1 1.19|52921|23|NC_014025|CRT 52921-52943 23 KJ019098 Synechococcus phage ACG-2014f isolate Syn7803US39, complete genome 14529-14551 2 0.913
NC_014025_1 1.19|52921|23|NC_014025|CRT 52921-52943 23 KJ019159 Synechococcus phage ACG-2014f isolate Syn7803C34, complete genome 14757-14779 2 0.913
NC_014025_1 1.19|52921|23|NC_014025|CRT 52921-52943 23 KJ019111 Synechococcus phage ACG-2014f isolate Syn7803US57, complete genome 14526-14548 2 0.913
NC_014025_1 1.19|52921|23|NC_014025|CRT 52921-52943 23 KJ019148 Synechococcus phage ACG-2014f isolate Syn7803C19, complete genome 14539-14561 2 0.913
NC_014025_1 1.19|52921|23|NC_014025|CRT 52921-52943 23 NC_047712 Synechococcus phage ACG-2014f isolate Syn7803C7, complete genome 14538-14560 2 0.913
NC_014025_1 1.19|52921|23|NC_014025|CRT 52921-52943 23 KJ019090 Synechococcus phage ACG-2014f isolate Syn7803US24, complete genome 14745-14767 2 0.913
NC_014025_1 1.19|52921|23|NC_014025|CRT 52921-52943 23 KJ019146 Synechococcus phage ACG-2014f isolate Syn7803C16, complete genome 14522-14544 2 0.913
NC_014025_1 1.19|52921|23|NC_014025|CRT 52921-52943 23 KJ019152 Synechococcus phage ACG-2014f isolate Syn7803C25, complete genome 14538-14560 2 0.913
NC_014025_1 1.19|52921|23|NC_014025|CRT 52921-52943 23 KJ019151 Synechococcus phage ACG-2014f isolate Syn7803C24, complete genome 14525-14547 2 0.913
NC_014025_1 1.19|52921|23|NC_014025|CRT 52921-52943 23 KJ019150 Synechococcus phage ACG-2014f isolate Syn7803C22, complete genome 14526-14548 2 0.913
NC_014025_1 1.19|52921|23|NC_014025|CRT 52921-52943 23 NC_026927 Synechococcus phage ACG-2014f isolate Syn7803C90, complete genome 14526-14548 2 0.913
NC_014025_1 1.19|52921|23|NC_014025|CRT 52921-52943 23 KJ019097 Synechococcus phage ACG-2014f isolate Syn7803US37, complete genome 14526-14548 2 0.913
NC_014025_1 1.19|52921|23|NC_014025|CRT 52921-52943 23 KJ019045 Synechococcus phage ACG-2014f isolate Syn7803C6, complete genome 14526-14548 2 0.913
NC_014025_1 1.19|52921|23|NC_014025|CRT 52921-52943 23 KJ019037 Synechococcus phage ACG-2014f isolate Syn7803C58, complete genome 14526-14548 2 0.913
NC_014025_1 1.19|52921|23|NC_014025|CRT 52921-52943 23 KJ019099 Synechococcus phage ACG-2014f isolate Syn7803US3, complete genome 14529-14551 2 0.913
NC_014025_1 1.19|52921|23|NC_014025|CRT 52921-52943 23 KJ019155 Synechococcus phage ACG-2014f isolate Syn7803C29, complete genome 14526-14548 2 0.913
NC_014025_1 1.19|52921|23|NC_014025|CRT 52921-52943 23 KJ019053 Synechococcus phage ACG-2014f isolate Syn7803C80, complete genome 14529-14551 2 0.913
NC_014025_1 1.19|52921|23|NC_014025|CRT 52921-52943 23 KJ019101 Synechococcus phage ACG-2014f isolate Syn7803US42, complete genome 15622-15644 2 0.913
NC_014025_1 1.19|52921|23|NC_014025|CRT 52921-52943 23 KJ019085 Synechococcus phage ACG-2014f isolate Syn7803US13, complete genome 14526-14548 2 0.913
NC_014025_1 1.19|52921|23|NC_014025|CRT 52921-52943 23 KJ019096 Synechococcus phage ACG-2014f isolate Syn7803US36, complete genome 15179-15201 2 0.913
NC_014025_1 1.19|52921|23|NC_014025|CRT 52921-52943 23 KJ019091 Synechococcus phage ACG-2014f isolate Syn7803US26, complete genome 14526-14548 2 0.913
NC_014025_1 1.19|52921|23|NC_014025|CRT 52921-52943 23 KJ019144 Synechococcus phage ACG-2014f isolate Syn7803C14, complete genome 14526-14548 2 0.913
NC_014025_1 1.19|52921|23|NC_014025|CRT 52921-52943 23 KJ019145 Synechococcus phage ACG-2014f isolate Syn7803C15, complete genome 14487-14509 2 0.913
NC_014025_1 1.19|52921|23|NC_014025|CRT 52921-52943 23 KJ019092 Synechococcus phage ACG-2014f isolate Syn7803US2, complete genome 14529-14551 2 0.913
NC_014025_1 1.19|52921|23|NC_014025|CRT 52921-52943 23 CP011076 Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence 188-210 2 0.913
NC_014025_1 1.19|52921|23|NC_014025|CRT 52921-52943 23 CP011076 Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence 692-714 2 0.913
NC_014025_1 1.19|52921|23|NC_014025|CRT 52921-52943 23 CP011076 Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence 881-903 2 0.913
NC_014025_1 1.19|52921|23|NC_014025|CRT 52921-52943 23 CP011076 Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence 1349-1371 2 0.913
NC_014025_1 1.19|52921|23|NC_014025|CRT 52921-52943 23 CP011075 Brevibacillus laterosporus strain B9 plasmid unnamed1, complete sequence 732982-733004 2 0.913
NC_014025_1 1.19|52921|23|NC_014025|CRT 52921-52943 23 CP011075 Brevibacillus laterosporus strain B9 plasmid unnamed1, complete sequence 733090-733112 2 0.913
NC_014025_1 1.20|52966|32|NC_014025|CRT 52966-52997 32 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52156-52187 2 0.938
NC_014025_1 1.20|52966|32|NC_014025|CRT 52966-52997 32 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52273-52304 2 0.938
NC_014025_1 1.20|52966|32|NC_014025|CRT 52966-52997 32 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52687-52718 2 0.938
NC_014025_1 1.20|52966|32|NC_014025|CRT 52966-52997 32 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 53200-53231 2 0.938
NC_014025_1 1.21|53020|41|NC_014025|CRT 53020-53060 41 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52093-52133 2 0.951
NC_014025_1 1.21|53020|41|NC_014025|CRT 53020-53060 41 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52210-52250 2 0.951
NC_014025_1 1.22|53083|32|NC_014025|CRT 53083-53114 32 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52156-52187 2 0.938
NC_014025_1 1.22|53083|32|NC_014025|CRT 53083-53114 32 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52273-52304 2 0.938
NC_014025_1 1.22|53083|32|NC_014025|CRT 53083-53114 32 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52687-52718 2 0.938
NC_014025_1 1.22|53083|32|NC_014025|CRT 53083-53114 32 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 53200-53231 2 0.938
NC_014025_1 1.23|53137|41|NC_014025|CRT 53137-53177 41 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52093-52133 2 0.951
NC_014025_1 1.23|53137|41|NC_014025|CRT 53137-53177 41 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52210-52250 2 0.951
NC_014025_1 1.25|53272|23|NC_014025|CRT 53272-53294 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52165-52187 2 0.913
NC_014025_1 1.25|53272|23|NC_014025|CRT 53272-53294 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52282-52304 2 0.913
NC_014025_1 1.25|53272|23|NC_014025|CRT 53272-53294 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52309-52331 2 0.913
NC_014025_1 1.25|53272|23|NC_014025|CRT 53272-53294 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52849-52871 2 0.913
NC_014025_1 1.25|53272|23|NC_014025|CRT 53272-53294 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52939-52961 2 0.913
NC_014025_1 1.25|53272|23|NC_014025|CRT 53272-53294 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 53209-53231 2 0.913
NC_014025_1 1.25|53272|23|NC_014025|CRT 53272-53294 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 53245-53267 2 0.913
NC_014025_1 1.25|53272|23|NC_014025|CRT 53272-53294 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 51769-51791 2 0.913
NC_014025_1 1.25|53272|23|NC_014025|CRT 53272-53294 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 51850-51872 2 0.913
NC_014025_1 1.25|53272|23|NC_014025|CRT 53272-53294 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 51886-51908 2 0.913
NC_014025_1 1.25|53272|23|NC_014025|CRT 53272-53294 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 51931-51953 2 0.913
NC_014025_1 1.25|53272|23|NC_014025|CRT 53272-53294 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52012-52034 2 0.913
NC_014025_1 1.25|53272|23|NC_014025|CRT 53272-53294 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52354-52376 2 0.913
NC_014025_1 1.25|53272|23|NC_014025|CRT 53272-53294 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52372-52394 2 0.913
NC_014025_1 1.25|53272|23|NC_014025|CRT 53272-53294 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52444-52466 2 0.913
NC_014025_1 1.25|53272|23|NC_014025|CRT 53272-53294 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52462-52484 2 0.913
NC_014025_1 1.25|53272|23|NC_014025|CRT 53272-53294 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52804-52826 2 0.913
NC_014025_1 1.25|53272|23|NC_014025|CRT 53272-53294 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52894-52916 2 0.913
NC_014025_1 1.25|53272|23|NC_014025|CRT 53272-53294 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52912-52934 2 0.913
NC_014025_1 1.13|52597|23|NC_014025|CRT 52597-52619 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52705-52727 3 0.87
NC_014025_1 1.13|52597|23|NC_014025|CRT 52597-52619 23 NC_013085 Synechococcus phage S-RSM4, complete genome 104973-104995 3 0.87
NC_014025_1 1.13|52597|23|NC_014025|CRT 52597-52619 23 FM207411 Synechococcus phage S-RSM4 complete genome 104973-104995 3 0.87
NC_014025_1 1.16|52786|23|NC_014025|CRT 52786-52808 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52309-52331 3 0.87
NC_014025_1 1.16|52786|23|NC_014025|CRT 52786-52808 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52849-52871 3 0.87
NC_014025_1 1.16|52786|23|NC_014025|CRT 52786-52808 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52939-52961 3 0.87
NC_014025_1 1.16|52786|23|NC_014025|CRT 52786-52808 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 53245-53267 3 0.87
NC_014025_1 1.17|52831|23|NC_014025|CRT 52831-52853 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 51841-51863 3 0.87
NC_014025_1 1.17|52831|23|NC_014025|CRT 52831-52853 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52003-52025 3 0.87
NC_014025_1 1.18|52876|23|NC_014025|CRT 52876-52898 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52309-52331 3 0.87
NC_014025_1 1.18|52876|23|NC_014025|CRT 52876-52898 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52849-52871 3 0.87
NC_014025_1 1.18|52876|23|NC_014025|CRT 52876-52898 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52939-52961 3 0.87
NC_014025_1 1.18|52876|23|NC_014025|CRT 52876-52898 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 53245-53267 3 0.87
NC_014025_1 1.19|52921|23|NC_014025|CRT 52921-52943 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 53299-53321 3 0.87
NC_014025_1 1.20|52966|32|NC_014025|CRT 52966-52997 32 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52597-52628 3 0.906
NC_014025_1 1.22|53083|32|NC_014025|CRT 53083-53114 32 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52597-52628 3 0.906
NC_014025_1 1.25|53272|23|NC_014025|CRT 53272-53294 23 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52426-52448 3 0.87
NC_014025_1 1.10|52354|41|NC_014025|CRT 52354-52394 41 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52822-52862 5 0.878
NC_014025_1 1.15|52723|41|NC_014025|CRT 52723-52763 41 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52048-52088 5 0.878
NC_014025_1 1.20|52966|32|NC_014025|CRT 52966-52997 32 NC_014172 Bacillus thuringiensis BMB171 plasmid pBMB171, complete sequence 29931-29962 5 0.844
NC_014025_1 1.20|52966|32|NC_014025|CRT 52966-52997 32 NC_011777 Bacillus cereus AH820 plasmid pAH820_272, complete sequence 124637-124668 5 0.844
NC_014025_1 1.20|52966|32|NC_014025|CRT 52966-52997 32 NC_011777 Bacillus cereus AH820 plasmid pAH820_272, complete sequence 124997-125028 5 0.844
NC_014025_1 1.22|53083|32|NC_014025|CRT 53083-53114 32 NC_014172 Bacillus thuringiensis BMB171 plasmid pBMB171, complete sequence 29931-29962 5 0.844
NC_014025_1 1.22|53083|32|NC_014025|CRT 53083-53114 32 NC_011777 Bacillus cereus AH820 plasmid pAH820_272, complete sequence 124637-124668 5 0.844
NC_014025_1 1.22|53083|32|NC_014025|CRT 53083-53114 32 NC_011777 Bacillus cereus AH820 plasmid pAH820_272, complete sequence 124997-125028 5 0.844
NC_014025_1 1.10|52354|41|NC_014025|CRT 52354-52394 41 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52165-52205 6 0.854
NC_014025_1 1.10|52354|41|NC_014025|CRT 52354-52394 41 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52282-52322 6 0.854
NC_014025_1 1.15|52723|41|NC_014025|CRT 52723-52763 41 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 51751-51791 6 0.854
NC_014025_1 1.15|52723|41|NC_014025|CRT 52723-52763 41 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 51913-51953 6 0.854
NC_014025_1 1.15|52723|41|NC_014025|CRT 52723-52763 41 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52786-52826 6 0.854
NC_014025_1 1.15|52723|41|NC_014025|CRT 52723-52763 41 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52876-52916 6 0.854
NC_014025_1 1.20|52966|32|NC_014025|CRT 52966-52997 32 NC_014172 Bacillus thuringiensis BMB171 plasmid pBMB171, complete sequence 29832-29863 6 0.812
NC_014025_1 1.20|52966|32|NC_014025|CRT 52966-52997 32 NC_011777 Bacillus cereus AH820 plasmid pAH820_272, complete sequence 124142-124173 6 0.812
NC_014025_1 1.20|52966|32|NC_014025|CRT 52966-52997 32 NC_011777 Bacillus cereus AH820 plasmid pAH820_272, complete sequence 124304-124335 6 0.812
NC_014025_1 1.20|52966|32|NC_014025|CRT 52966-52997 32 NC_011777 Bacillus cereus AH820 plasmid pAH820_272, complete sequence 124880-124911 6 0.812
NC_014025_1 1.20|52966|32|NC_014025|CRT 52966-52997 32 NZ_CP016317 Bacillus cereus strain M3 plasmid pBCM301, complete sequence 156426-156457 6 0.812
NC_014025_1 1.22|53083|32|NC_014025|CRT 53083-53114 32 NC_014172 Bacillus thuringiensis BMB171 plasmid pBMB171, complete sequence 29832-29863 6 0.812
NC_014025_1 1.22|53083|32|NC_014025|CRT 53083-53114 32 NC_011777 Bacillus cereus AH820 plasmid pAH820_272, complete sequence 124142-124173 6 0.812
NC_014025_1 1.22|53083|32|NC_014025|CRT 53083-53114 32 NC_011777 Bacillus cereus AH820 plasmid pAH820_272, complete sequence 124304-124335 6 0.812
NC_014025_1 1.22|53083|32|NC_014025|CRT 53083-53114 32 NC_011777 Bacillus cereus AH820 plasmid pAH820_272, complete sequence 124880-124911 6 0.812
NC_014025_1 1.22|53083|32|NC_014025|CRT 53083-53114 32 NZ_CP016317 Bacillus cereus strain M3 plasmid pBCM301, complete sequence 156426-156457 6 0.812
NC_014025_1 1.20|52966|32|NC_014025|CRT 52966-52997 32 MN204498 Streptomyces phage Saftant, complete genome 18776-18807 7 0.781
NC_014025_1 1.22|53083|32|NC_014025|CRT 53083-53114 32 MN204498 Streptomyces phage Saftant, complete genome 18776-18807 7 0.781
NC_014025_1 1.9|52264|68|NC_014025|CRT 52264-52331 68 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52264-52331 8 0.882
NC_014025_1 1.9|52264|68|NC_014025|CRT 52264-52331 68 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52147-52214 8 0.882
NC_014025_1 1.11|52417|68|NC_014025|CRT 52417-52484 68 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52417-52484 8 0.882
NC_014025_1 1.12|52507|68|NC_014025|CRT 52507-52574 68 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52507-52574 8 0.882
NC_014025_1 1.20|52966|32|NC_014025|CRT 52966-52997 32 MN224566 Mycobacterium phage Herbertwm, complete genome 2975-3006 8 0.75
NC_014025_1 1.20|52966|32|NC_014025|CRT 52966-52997 32 AP013956 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5F-MedDCM-OCT-S27-C232, *** SEQUENCING IN PROGRESS *** 1385-1416 8 0.75
NC_014025_1 1.20|52966|32|NC_014025|CRT 52966-52997 32 AP013963 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5F-MedDCM-OCT-S38-C146, *** SEQUENCING IN PROGRESS *** 1385-1416 8 0.75
NC_014025_1 1.20|52966|32|NC_014025|CRT 52966-52997 32 AP013959 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5F-MedDCM-OCT-S31-C107, *** SEQUENCING IN PROGRESS *** 11067-11098 8 0.75
NC_014025_1 1.20|52966|32|NC_014025|CRT 52966-52997 32 AP013565 Uncultured Mediterranean phage uvMED isolate uvMED-CGR-C5F-MedDCM-OCT-S40-C10, *** SEQUENCING IN PROGRESS ***, 2 ordered pieces 40126-40157 8 0.75
NC_014025_1 1.20|52966|32|NC_014025|CRT 52966-52997 32 AP013961 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5F-MedDCM-OCT-S34-C156, *** SEQUENCING IN PROGRESS *** 1357-1388 8 0.75
NC_014025_1 1.22|53083|32|NC_014025|CRT 53083-53114 32 MN224566 Mycobacterium phage Herbertwm, complete genome 2975-3006 8 0.75
NC_014025_1 1.22|53083|32|NC_014025|CRT 53083-53114 32 AP013956 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5F-MedDCM-OCT-S27-C232, *** SEQUENCING IN PROGRESS *** 1385-1416 8 0.75
NC_014025_1 1.22|53083|32|NC_014025|CRT 53083-53114 32 AP013963 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5F-MedDCM-OCT-S38-C146, *** SEQUENCING IN PROGRESS *** 1385-1416 8 0.75
NC_014025_1 1.22|53083|32|NC_014025|CRT 53083-53114 32 AP013959 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5F-MedDCM-OCT-S31-C107, *** SEQUENCING IN PROGRESS *** 11067-11098 8 0.75
NC_014025_1 1.22|53083|32|NC_014025|CRT 53083-53114 32 AP013565 Uncultured Mediterranean phage uvMED isolate uvMED-CGR-C5F-MedDCM-OCT-S40-C10, *** SEQUENCING IN PROGRESS ***, 2 ordered pieces 40126-40157 8 0.75
NC_014025_1 1.22|53083|32|NC_014025|CRT 53083-53114 32 AP013961 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5F-MedDCM-OCT-S34-C156, *** SEQUENCING IN PROGRESS *** 1357-1388 8 0.75
NC_014025_1 1.9|52264|68|NC_014025|CRT 52264-52331 68 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 53191-53258 9 0.868
NC_014025_1 1.24|53200|50|NC_014025|CRT 53200-53249 50 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52453-52502 9 0.82
NC_014025_1 1.3|51706|77|NC_014025|CRT 51706-51782 77 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 51706-51782 17 0.779
NC_014025_1 1.4|51805|77|NC_014025|CRT 51805-51881 77 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 51805-51881 17 0.779
NC_014025_1 1.4|51805|77|NC_014025|CRT 51805-51881 77 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 51967-52043 17 0.779
NC_014025_1 1.5|51904|77|NC_014025|CRT 51904-51980 77 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 51742-51818 17 0.779
NC_014025_1 1.5|51904|77|NC_014025|CRT 51904-51980 77 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 51904-51980 17 0.779
NC_014025_1 1.7|52084|77|NC_014025|CRT 52084-52160 77 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52084-52160 17 0.779
NC_014025_1 1.7|52084|77|NC_014025|CRT 52084-52160 77 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52201-52277 19 0.753
NC_014025_1 1.1|51481|86|NC_014025|CRT 51481-51566 86 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 51481-51566 26 0.698
NC_014025_1 1.2|51589|95|NC_014025|CRT 51589-51683 95 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 51589-51683 35 0.632

1. spacer 1.6|52003|59|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 0, identity: 1.0

tcactggaatcactggagctactggaatcactggagtgacgggaatcactggagctacc	CRISPR spacer
tcactggaatcactggagctactggaatcactggagtgacgggaatcactggagctacc	Protospacer
***********************************************************

2. spacer 1.6|52003|59|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 0, identity: 1.0

tcactggaatcactggagctactggaatcactggagtgacgggaatcactggagctacc	CRISPR spacer
tcactggaatcactggagctactggaatcactggagtgacgggaatcactggagctacc	Protospacer
***********************************************************

3. spacer 1.8|52183|59|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 0, identity: 1.0

tcactggagctactggagctaccggaattaccggagttactggaattaccggagttact	CRISPR spacer
tcactggagctactggagctaccggaattaccggagttactggaattaccggagttact	Protospacer
***********************************************************

4. spacer 1.10|52354|41|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 0, identity: 1.0

tcactggagctaccgggatcactggagctaccggagtcact	CRISPR spacer
tcactggagctaccgggatcactggagctaccggagtcact	Protospacer
*****************************************

5. spacer 1.10|52354|41|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 0, identity: 1.0

tcactggagctaccgggatcactggagctaccggagtcact	CRISPR spacer
tcactggagctaccgggatcactggagctaccggagtcact	Protospacer
*****************************************

6. spacer 1.13|52597|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 0, identity: 1.0

tcactggagtcactggagctacc	CRISPR spacer
tcactggagtcactggagctacc	Protospacer
***********************

7. spacer 1.14|52642|59|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 0, identity: 1.0

ttactggaattaccggagtgactggagttaccggaatcactggagtgacaggagccact	CRISPR spacer
ttactggaattaccggagtgactggagttaccggaatcactggagtgacaggagccact	Protospacer
***********************************************************

8. spacer 1.15|52723|41|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 0, identity: 1.0

ctactggagttaccggagtcacgggagctaccggagctacc	CRISPR spacer
ctactggagttaccggagtcacgggagctaccggagctacc	Protospacer
*****************************************

9. spacer 1.15|52723|41|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 0, identity: 1.0

ctactggagttaccggagtcacgggagctaccggagctacc	CRISPR spacer
ctactggagttaccggagtcacgggagctaccggagctacc	Protospacer
*****************************************

10. spacer 1.16|52786|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 0, identity: 1.0

ttactggagctaccggagtcacg	CRISPR spacer
ttactggagctaccggagtcacg	Protospacer
***********************

11. spacer 1.16|52786|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 0, identity: 1.0

ttactggagctaccggagtcacg	CRISPR spacer
ttactggagctaccggagtcacg	Protospacer
***********************

12. spacer 1.17|52831|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 0, identity: 1.0

ctaccggaatcactggagctact	CRISPR spacer
ctaccggaatcactggagctact	Protospacer
***********************

13. spacer 1.17|52831|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 0, identity: 1.0

ctaccggaatcactggagctact	CRISPR spacer
ctaccggaatcactggagctact	Protospacer
***********************

14. spacer 1.17|52831|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 0, identity: 1.0

ctaccggaatcactggagctact	CRISPR spacer
ctaccggaatcactggagctact	Protospacer
***********************

15. spacer 1.17|52831|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 0, identity: 1.0

ctaccggaatcactggagctact	CRISPR spacer
ctaccggaatcactggagctact	Protospacer
***********************

16. spacer 1.18|52876|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 0, identity: 1.0

ttactggagctaccggagtcacg	CRISPR spacer
ttactggagctaccggagtcacg	Protospacer
***********************

17. spacer 1.18|52876|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 0, identity: 1.0

ttactggagctaccggagtcacg	CRISPR spacer
ttactggagctaccggagtcacg	Protospacer
***********************

18. spacer 1.19|52921|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 0, identity: 1.0

ctaccggagtcactggggctact	CRISPR spacer
ctaccggagtcactggggctact	Protospacer
***********************

19. spacer 1.20|52966|32|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 0, identity: 1.0

tgacaggagccactggagctaccggagttact	CRISPR spacer
tgacaggagccactggagctaccggagttact	Protospacer
********************************

20. spacer 1.20|52966|32|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 0, identity: 1.0

tgacaggagccactggagctaccggagttact	CRISPR spacer
tgacaggagccactggagctaccggagttact	Protospacer
********************************

21. spacer 1.21|53020|41|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 0, identity: 1.0

tcactggagttactggaattaccggagttactggagtgact	CRISPR spacer
tcactggagttactggaattaccggagttactggagtgact	Protospacer
*****************************************

22. spacer 1.21|53020|41|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 0, identity: 1.0

tcactggagttactggaattaccggagttactggagtgact	CRISPR spacer
tcactggagttactggaattaccggagttactggagtgact	Protospacer
*****************************************

23. spacer 1.22|53083|32|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 0, identity: 1.0

tgacaggagccactggagctaccggagttact	CRISPR spacer
tgacaggagccactggagctaccggagttact	Protospacer
********************************

24. spacer 1.22|53083|32|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 0, identity: 1.0

tgacaggagccactggagctaccggagttact	CRISPR spacer
tgacaggagccactggagctaccggagttact	Protospacer
********************************

25. spacer 1.23|53137|41|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 0, identity: 1.0

tcactggagttactggaattaccggagttactggagtgact	CRISPR spacer
tcactggagttactggaattaccggagttactggagtgact	Protospacer
*****************************************

26. spacer 1.23|53137|41|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 0, identity: 1.0

tcactggagttactggaattaccggagttactggagtgact	CRISPR spacer
tcactggagttactggaattaccggagttactggagtgact	Protospacer
*****************************************

27. spacer 1.24|53200|50|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 0, identity: 1.0

tgacaggagccactggagctaccggaatcactggagctactggagctact	CRISPR spacer
tgacaggagccactggagctaccggaatcactggagctactggagctact	Protospacer
**************************************************

28. spacer 1.25|53272|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 0, identity: 1.0

tgactggagctaccggaatcact	CRISPR spacer
tgactggagctaccggaatcact	Protospacer
***********************

29. spacer 1.13|52597|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 1, identity: 0.957

tcactggagtcactggagctacc	CRISPR spacer
tcactggagttactggagctacc	Protospacer
**********.************

30. spacer 1.13|52597|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 1, identity: 0.957

tcactggagtcactggagctacc	CRISPR spacer
tcactggagtcacgggagctacc	Protospacer
************* *********

31. spacer 1.13|52597|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 1, identity: 0.957

tcactggagtcactggagctacc	CRISPR spacer
tcactggagttactggagctacc	Protospacer
**********.************

32. spacer 1.13|52597|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 1, identity: 0.957

tcactggagtcactggagctacc	CRISPR spacer
tcactggagttactggagctacc	Protospacer
**********.************

33. spacer 1.13|52597|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 1, identity: 0.957

tcactggagtcactggagctacc	CRISPR spacer
tcactggagtgactggagctacc	Protospacer
********** ************

34. spacer 1.15|52723|41|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 1, identity: 0.976

ctactggagttaccggagtcacgggagctaccggagctacc	CRISPR spacer
ttactggagttaccggagtcacgggagctaccggagctacc	Protospacer
.****************************************

35. spacer 1.16|52786|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 1, identity: 0.957

ttactggagctaccggagtcacg	CRISPR spacer
tcactggagctaccggagtcacg	Protospacer
*.*********************

36. spacer 1.16|52786|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 1, identity: 0.957

ttactggagctaccggagtcacg	CRISPR spacer
tcactggagctaccggagtcacg	Protospacer
*.*********************

37. spacer 1.16|52786|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 1, identity: 0.957

ttactggagctaccggagtcacg	CRISPR spacer
ttactggagttaccggagtcacg	Protospacer
*********.*************

38. spacer 1.17|52831|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 1, identity: 0.957

ctaccggaatcactggagctact	CRISPR spacer
ctaccggaatcactggagctacc	Protospacer
**********************.

39. spacer 1.17|52831|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 1, identity: 0.957

ctaccggaatcactggagctact	CRISPR spacer
ctaccggaatcactggagctacc	Protospacer
**********************.

40. spacer 1.17|52831|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 1, identity: 0.957

ctaccggaatcactggagctact	CRISPR spacer
ctaccggaatcactggagctacc	Protospacer
**********************.

41. spacer 1.17|52831|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 1, identity: 0.957

ctaccggaatcactggagctact	CRISPR spacer
ctaccggaatcactggagctacc	Protospacer
**********************.

42. spacer 1.17|52831|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 1, identity: 0.957

ctaccggaatcactggagctact	CRISPR spacer
ctaccggagtcactggagctact	Protospacer
********.**************

43. spacer 1.17|52831|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 1, identity: 0.957

ctaccggaatcactggagctact	CRISPR spacer
ctaccggaatcactggagttact	Protospacer
******************.****

44. spacer 1.17|52831|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 1, identity: 0.957

ctaccggaatcactggagctact	CRISPR spacer
ctaccggaatcactggagttact	Protospacer
******************.****

45. spacer 1.17|52831|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 1, identity: 0.957

ctaccggaatcactggagctact	CRISPR spacer
ctaccggaatcactggagttact	Protospacer
******************.****

46. spacer 1.17|52831|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 1, identity: 0.957

ctaccggaatcactggagctact	CRISPR spacer
ctaccggagtcactggagctact	Protospacer
********.**************

47. spacer 1.17|52831|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 1, identity: 0.957

ctaccggaatcactggagctact	CRISPR spacer
ctaccggaatcactggagttact	Protospacer
******************.****

48. spacer 1.18|52876|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 1, identity: 0.957

ttactggagctaccggagtcacg	CRISPR spacer
tcactggagctaccggagtcacg	Protospacer
*.*********************

49. spacer 1.18|52876|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 1, identity: 0.957

ttactggagctaccggagtcacg	CRISPR spacer
tcactggagctaccggagtcacg	Protospacer
*.*********************

50. spacer 1.18|52876|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 1, identity: 0.957

ttactggagctaccggagtcacg	CRISPR spacer
ttactggagttaccggagtcacg	Protospacer
*********.*************

51. spacer 1.19|52921|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 1, identity: 0.957

ctaccggagtcactggggctact	CRISPR spacer
ttaccggagtcactggggctact	Protospacer
.**********************

52. spacer 1.19|52921|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 1, identity: 0.957

ctaccggagtcactggggctact	CRISPR spacer
ttaccggagtcactggggctact	Protospacer
.**********************

53. spacer 1.19|52921|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 1, identity: 0.957

ctaccggagtcactggggctact	CRISPR spacer
ctaccggagtcactggagctact	Protospacer
****************.******

54. spacer 1.19|52921|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 1, identity: 0.957

ctaccggagtcactggggctact	CRISPR spacer
ctaccggagtcactggagctact	Protospacer
****************.******

55. spacer 1.24|53200|50|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 1, identity: 0.98

tgacaggagccactggagctaccggaatcactggagctactggagctact	CRISPR spacer
tgacaggagccactggagctaccggaatcactggagctactggagctacc	Protospacer
*************************************************.

56. spacer 1.24|53200|50|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 1, identity: 0.98

tgacaggagccactggagctaccggaatcactggagctactggagctact	CRISPR spacer
tgacaggagccactggagctaccggaatcactggagctactggagctacc	Protospacer
*************************************************.

57. spacer 1.25|53272|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 1, identity: 0.957

tgactggagctaccggaatcact	CRISPR spacer
tgactggagttaccggaatcact	Protospacer
*********.*************

58. spacer 1.25|53272|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 1, identity: 0.957

tgactggagctaccggaatcact	CRISPR spacer
tgactggagttaccggaatcact	Protospacer
*********.*************

59. spacer 1.25|53272|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 1, identity: 0.957

tgactggagctaccggaatcact	CRISPR spacer
ttactggagctaccggaatcact	Protospacer
* *********************

60. spacer 1.25|53272|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 1, identity: 0.957

tgactggagctaccggaatcact	CRISPR spacer
tgactggagttaccggaatcact	Protospacer
*********.*************

61. spacer 1.25|53272|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 1, identity: 0.957

tgactggagctaccggaatcact	CRISPR spacer
tcactggagctaccggaatcact	Protospacer
* *********************

62. spacer 1.25|53272|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 1, identity: 0.957

tgactggagctaccggaatcact	CRISPR spacer
tgactggagttaccggaatcact	Protospacer
*********.*************

63. spacer 1.25|53272|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 1, identity: 0.957

tgactggagctaccggaatcact	CRISPR spacer
tgactggagttaccggaatcact	Protospacer
*********.*************

64. spacer 1.10|52354|41|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.951

tcactggagctaccgggatcactggagctaccggagtcact	CRISPR spacer
tcacgggagctaccggaatcactggagctaccggagtcact	Protospacer
**** ***********.************************

65. spacer 1.13|52597|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913

tcactggagtcactggagctacc	CRISPR spacer
ccactggaatcactggagctacc	Protospacer
.*******.**************

66. spacer 1.13|52597|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913

tcactggagtcactggagctacc	CRISPR spacer
ccactggaatcactggagctacc	Protospacer
.*******.**************

67. spacer 1.13|52597|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913

tcactggagtcactggagctacc	CRISPR spacer
tcactggaatcactggagctact	Protospacer
********.*************.

68. spacer 1.13|52597|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913

tcactggagtcactggagctacc	CRISPR spacer
tcactggaatcactggagctact	Protospacer
********.*************.

69. spacer 1.13|52597|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913

tcactggagtcactggagctacc	CRISPR spacer
tcactggagtcactggagttact	Protospacer
******************.***.

70. spacer 1.13|52597|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913

tcactggagtcactggagctacc	CRISPR spacer
tcactggagtcactggagttact	Protospacer
******************.***.

71. spacer 1.13|52597|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913

tcactggagtcactggagctacc	CRISPR spacer
tcactggagtgactggagttacc	Protospacer
********** *******.****

72. spacer 1.13|52597|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913

tcactggagtcactggagctacc	CRISPR spacer
tcactggagtgactggagttacc	Protospacer
********** *******.****

73. spacer 1.13|52597|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913

tcactggagtcactggagctacc	CRISPR spacer
tcactggagctactggagctacc	Protospacer
*********..************

74. spacer 1.13|52597|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913

tcactggagtcactggagctacc	CRISPR spacer
tcactggagctactggagctacc	Protospacer
*********..************

75. spacer 1.13|52597|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913

tcactggagtcactggagctacc	CRISPR spacer
tcactggagttactggagttacc	Protospacer
**********.*******.****

76. spacer 1.13|52597|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913

tcactggagtcactggagctacc	CRISPR spacer
tcactggagctactggagctacc	Protospacer
*********..************

77. spacer 1.16|52786|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913

ttactggagctaccggagtcacg	CRISPR spacer
tcactggagctaccggagtcact	Protospacer
*.******************** 

78. spacer 1.16|52786|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913

ttactggagctaccggagtcacg	CRISPR spacer
ttactggagctaccggaatcact	Protospacer
*****************.**** 

79. spacer 1.16|52786|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913

ttactggagctaccggagtcacg	CRISPR spacer
tcactggagctaccggagtcact	Protospacer
*.******************** 

80. spacer 1.16|52786|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913

ttactggagctaccggagtcacg	CRISPR spacer
tcactggagctaccggagtcact	Protospacer
*.******************** 

81. spacer 1.16|52786|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913

ttactggagctaccggagtcacg	CRISPR spacer
ctactggagttaccggagtcacg	Protospacer
.********.*************

82. spacer 1.16|52786|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913

ttactggagctaccggagtcacg	CRISPR spacer
ctactggagttaccggagtcacg	Protospacer
.********.*************

83. spacer 1.16|52786|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913

ttactggagctaccggagtcacg	CRISPR spacer
tcactggagctaccggagtcact	Protospacer
*.******************** 

84. spacer 1.16|52786|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913

ttactggagctaccggagtcacg	CRISPR spacer
tgactggagttaccggagtcacg	Protospacer
* *******.*************

85. spacer 1.16|52786|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913

ttactggagctaccggagtcacg	CRISPR spacer
tgactggagttaccggagtcacg	Protospacer
* *******.*************

86. spacer 1.16|52786|23|NC_014025|CRT matches to EU744250 (Mycobacterium virus Pukovnik, complete genome) position: , mismatch: 2, identity: 0.913

ttactggagctaccggagtcacg	CRISPR spacer
ttaccggagctaccggaggcacg	Protospacer
****.************* ****

87. spacer 1.17|52831|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913

ctaccggaatcactggagctact	CRISPR spacer
ttaccggagtcactggagctact	Protospacer
.*******.**************

88. spacer 1.17|52831|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913

ctaccggaatcactggagctact	CRISPR spacer
ctaccgggatcactggagctacc	Protospacer
*******.**************.

89. spacer 1.17|52831|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913

ctaccggaatcactggagctact	CRISPR spacer
ctaccgggatcactggagctacc	Protospacer
*******.**************.

90. spacer 1.17|52831|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913

ctaccggaatcactggagctact	CRISPR spacer
ttaccggaatcactggagttact	Protospacer
.*****************.****

91. spacer 1.17|52831|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913

ctaccggaatcactggagctact	CRISPR spacer
ctaccggagtcacgggagctact	Protospacer
********.**** *********

92. spacer 1.17|52831|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913

ctaccggaatcactggagctact	CRISPR spacer
ctaccggagtcactggagccact	Protospacer
********.**********.***

93. spacer 1.17|52831|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913

ctaccggaatcactggagctact	CRISPR spacer
ctaccggagtcactggagttact	Protospacer
********.*********.****

94. spacer 1.17|52831|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913

ctaccggaatcactggagctact	CRISPR spacer
ctactggagtcactggagctact	Protospacer
****.***.**************

95. spacer 1.17|52831|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913

ctaccggaatcactggagctact	CRISPR spacer
ctaccggagtcactggggctact	Protospacer
********.*******.******

96. spacer 1.17|52831|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913

ctaccggaatcactggagctact	CRISPR spacer
ctaccggaatcactggagtgact	Protospacer
******************. ***

97. spacer 1.17|52831|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913

ctaccggaatcactggagctact	CRISPR spacer
ctaccggaatcactggagtgact	Protospacer
******************. ***

98. spacer 1.17|52831|23|NC_014025|CRT matches to NZ_CP009691 (Bacillus mycoides strain ATCC 6462 plasmid pBMX_1, complete sequence) position: , mismatch: 2, identity: 0.913

ctaccggaatcactggagctact	CRISPR spacer
ctactggaataactggagctact	Protospacer
****.***** ************

99. spacer 1.17|52831|23|NC_014025|CRT matches to MT586120 (Synechococcus phage S-CAM7 isolate 0809CC03, complete genome) position: , mismatch: 2, identity: 0.913

ctaccggaatcactggagctact	CRISPR spacer
ctactggactcactggagctact	Protospacer
****.*** **************

100. spacer 1.17|52831|23|NC_014025|CRT matches to MT586120 (Synechococcus phage S-CAM7 isolate 0809CC03, complete genome) position: , mismatch: 2, identity: 0.913

ctaccggaatcactggagctact	CRISPR spacer
ctactggactcactggagctact	Protospacer
****.*** **************

101. spacer 1.17|52831|23|NC_014025|CRT matches to MT586120 (Synechococcus phage S-CAM7 isolate 0809CC03, complete genome) position: , mismatch: 2, identity: 0.913

ctaccggaatcactggagctact	CRISPR spacer
ctactggactcactggagctact	Protospacer
****.*** **************

102. spacer 1.17|52831|23|NC_014025|CRT matches to MT586120 (Synechococcus phage S-CAM7 isolate 0809CC03, complete genome) position: , mismatch: 2, identity: 0.913

ctaccggaatcactggagctact	CRISPR spacer
ctactggactcactggagctact	Protospacer
****.*** **************

103. spacer 1.17|52831|23|NC_014025|CRT matches to MT586120 (Synechococcus phage S-CAM7 isolate 0809CC03, complete genome) position: , mismatch: 2, identity: 0.913

ctaccggaatcactggagctact	CRISPR spacer
ctactggactcactggagctact	Protospacer
****.*** **************

104. spacer 1.17|52831|23|NC_014025|CRT matches to NC_031927 (Synechococcus phage S-CAM7 isolate 0910CC49, complete genome) position: , mismatch: 2, identity: 0.913

ctaccggaatcactggagctact	CRISPR spacer
ctactggactcactggagctact	Protospacer
****.*** **************

105. spacer 1.17|52831|23|NC_014025|CRT matches to NC_031927 (Synechococcus phage S-CAM7 isolate 0910CC49, complete genome) position: , mismatch: 2, identity: 0.913

ctaccggaatcactggagctact	CRISPR spacer
ctactggactcactggagctact	Protospacer
****.*** **************

106. spacer 1.17|52831|23|NC_014025|CRT matches to NC_031927 (Synechococcus phage S-CAM7 isolate 0910CC49, complete genome) position: , mismatch: 2, identity: 0.913

ctaccggaatcactggagctact	CRISPR spacer
ctactggactcactggagctact	Protospacer
****.*** **************

107. spacer 1.17|52831|23|NC_014025|CRT matches to NC_031927 (Synechococcus phage S-CAM7 isolate 0910CC49, complete genome) position: , mismatch: 2, identity: 0.913

ctaccggaatcactggagctact	CRISPR spacer
ctactggactcactggagctact	Protospacer
****.*** **************

108. spacer 1.17|52831|23|NC_014025|CRT matches to NC_031927 (Synechococcus phage S-CAM7 isolate 0910CC49, complete genome) position: , mismatch: 2, identity: 0.913

ctaccggaatcactggagctact	CRISPR spacer
ctactggactcactggagctact	Protospacer
****.*** **************

109. spacer 1.17|52831|23|NC_014025|CRT matches to KU686213 (Synechococcus phage S-CAM7 isolate 0910SB42, complete genome) position: , mismatch: 2, identity: 0.913

ctaccggaatcactggagctact	CRISPR spacer
ctactggactcactggagctact	Protospacer
****.*** **************

110. spacer 1.17|52831|23|NC_014025|CRT matches to KU686213 (Synechococcus phage S-CAM7 isolate 0910SB42, complete genome) position: , mismatch: 2, identity: 0.913

ctaccggaatcactggagctact	CRISPR spacer
ctactggactcactggagctact	Protospacer
****.*** **************

111. spacer 1.17|52831|23|NC_014025|CRT matches to KU686213 (Synechococcus phage S-CAM7 isolate 0910SB42, complete genome) position: , mismatch: 2, identity: 0.913

ctaccggaatcactggagctact	CRISPR spacer
ctactggactcactggagctact	Protospacer
****.*** **************

112. spacer 1.17|52831|23|NC_014025|CRT matches to KU686213 (Synechococcus phage S-CAM7 isolate 0910SB42, complete genome) position: , mismatch: 2, identity: 0.913

ctaccggaatcactggagctact	CRISPR spacer
ctactggactcactggagctact	Protospacer
****.*** **************

113. spacer 1.17|52831|23|NC_014025|CRT matches to KU686213 (Synechococcus phage S-CAM7 isolate 0910SB42, complete genome) position: , mismatch: 2, identity: 0.913

ctaccggaatcactggagctact	CRISPR spacer
ctactggactcactggagctact	Protospacer
****.*** **************

114. spacer 1.17|52831|23|NC_014025|CRT matches to CP013001 (Bacillus thuringiensis strain XL6 plasmid, complete sequence) position: , mismatch: 2, identity: 0.913

ctaccggaatcactggagctact	CRISPR spacer
ctaccggaaacactggacctact	Protospacer
********* ******* *****

115. spacer 1.17|52831|23|NC_014025|CRT matches to LC554890 (Ralstonia phage RP13 DNA, nearly complete genome) position: , mismatch: 2, identity: 0.913

ctaccggaatcactggagctact	CRISPR spacer
ctgctggaatcactggagctact	Protospacer
**.*.******************

116. spacer 1.18|52876|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913

ttactggagctaccggagtcacg	CRISPR spacer
tcactggagctaccggagtcact	Protospacer
*.******************** 

117. spacer 1.18|52876|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913

ttactggagctaccggagtcacg	CRISPR spacer
ttactggagctaccggaatcact	Protospacer
*****************.**** 

118. spacer 1.18|52876|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913

ttactggagctaccggagtcacg	CRISPR spacer
tcactggagctaccggagtcact	Protospacer
*.******************** 

119. spacer 1.18|52876|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913

ttactggagctaccggagtcacg	CRISPR spacer
tcactggagctaccggagtcact	Protospacer
*.******************** 

120. spacer 1.18|52876|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913

ttactggagctaccggagtcacg	CRISPR spacer
ctactggagttaccggagtcacg	Protospacer
.********.*************

121. spacer 1.18|52876|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913

ttactggagctaccggagtcacg	CRISPR spacer
ctactggagttaccggagtcacg	Protospacer
.********.*************

122. spacer 1.18|52876|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913

ttactggagctaccggagtcacg	CRISPR spacer
tcactggagctaccggagtcact	Protospacer
*.******************** 

123. spacer 1.18|52876|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913

ttactggagctaccggagtcacg	CRISPR spacer
tgactggagttaccggagtcacg	Protospacer
* *******.*************

124. spacer 1.18|52876|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913

ttactggagctaccggagtcacg	CRISPR spacer
tgactggagttaccggagtcacg	Protospacer
* *******.*************

125. spacer 1.18|52876|23|NC_014025|CRT matches to EU744250 (Mycobacterium virus Pukovnik, complete genome) position: , mismatch: 2, identity: 0.913

ttactggagctaccggagtcacg	CRISPR spacer
ttaccggagctaccggaggcacg	Protospacer
****.************* ****

126. spacer 1.19|52921|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913

ctaccggagtcactggggctact	CRISPR spacer
ttaccggagtcactggagctact	Protospacer
.***************.******

127. spacer 1.19|52921|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913

ctaccggagtcactggggctact	CRISPR spacer
ctaccggagtcacgggagctact	Protospacer
************* **.******

128. spacer 1.19|52921|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913

ctaccggagtcactggggctact	CRISPR spacer
ctaccggagtcactggagccact	Protospacer
****************.**.***

129. spacer 1.19|52921|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913

ctaccggagtcactggggctact	CRISPR spacer
ctaccggaatcactggagctact	Protospacer
********.*******.******

130. spacer 1.19|52921|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913

ctaccggagtcactggggctact	CRISPR spacer
ctaccggaatcactggagctact	Protospacer
********.*******.******

131. spacer 1.19|52921|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913

ctaccggagtcactggggctact	CRISPR spacer
ctaccggagtcactggagttact	Protospacer
****************.*.****

132. spacer 1.19|52921|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913

ctaccggagtcactggggctact	CRISPR spacer
ctactggagtcactggagctact	Protospacer
****.***********.******

133. spacer 1.19|52921|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913

ctaccggagtcactggggctact	CRISPR spacer
ctaccggaatcactggagctact	Protospacer
********.*******.******

134. spacer 1.19|52921|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913

ctaccggagtcactggggctact	CRISPR spacer
ctaccggaatcactggagctact	Protospacer
********.*******.******

135. spacer 1.19|52921|23|NC_014025|CRT matches to NZ_CP015352 (Bacillus thuringiensis strain MYBT18246 plasmid p142098, complete sequence) position: , mismatch: 2, identity: 0.913

ctaccggagtcactggggctact	CRISPR spacer
ctaccggagttactggggctacc	Protospacer
**********.***********.

136. spacer 1.19|52921|23|NC_014025|CRT matches to NZ_CP015352 (Bacillus thuringiensis strain MYBT18246 plasmid p142098, complete sequence) position: , mismatch: 2, identity: 0.913

ctaccggagtcactggggctact	CRISPR spacer
ctaccggagttactggggctacc	Protospacer
**********.***********.

137. spacer 1.19|52921|23|NC_014025|CRT matches to NZ_CP015352 (Bacillus thuringiensis strain MYBT18246 plasmid p142098, complete sequence) position: , mismatch: 2, identity: 0.913

ctaccggagtcactggggctact	CRISPR spacer
ctaccggagttactggggctacc	Protospacer
**********.***********.

138. spacer 1.19|52921|23|NC_014025|CRT matches to NZ_CP015352 (Bacillus thuringiensis strain MYBT18246 plasmid p142098, complete sequence) position: , mismatch: 2, identity: 0.913

ctaccggagtcactggggctact	CRISPR spacer
ctaccggagttactggggctacc	Protospacer
**********.***********.

139. spacer 1.19|52921|23|NC_014025|CRT matches to NZ_CP015352 (Bacillus thuringiensis strain MYBT18246 plasmid p142098, complete sequence) position: , mismatch: 2, identity: 0.913

ctaccggagtcactggggctact	CRISPR spacer
ctaccggagttactggggctacc	Protospacer
**********.***********.

140. spacer 1.19|52921|23|NC_014025|CRT matches to KJ019095 (Synechococcus phage ACG-2014f isolate Syn7803US34, complete genome) position: , mismatch: 2, identity: 0.913

ctaccggagtcactggggctact	CRISPR spacer
ctaccggagccactggtgctact	Protospacer
*********.****** ******

141. spacer 1.19|52921|23|NC_014025|CRT matches to KJ019086 (Synechococcus phage ACG-2014f isolate Syn7803US17, complete genome) position: , mismatch: 2, identity: 0.913

ctaccggagtcactggggctact	CRISPR spacer
ctaccggagccactggtgctact	Protospacer
*********.****** ******

142. spacer 1.19|52921|23|NC_014025|CRT matches to KJ019106 (Synechococcus phage ACG-2014f isolate Syn7803US50, complete genome) position: , mismatch: 2, identity: 0.913

ctaccggagtcactggggctact	CRISPR spacer
ctaccggagccactggtgctact	Protospacer
*********.****** ******

143. spacer 1.19|52921|23|NC_014025|CRT matches to KJ019107 (Synechococcus phage ACG-2014f isolate Syn7803US52, complete genome) position: , mismatch: 2, identity: 0.913

ctaccggagtcactggggctact	CRISPR spacer
ctaccggagccactggtgctact	Protospacer
*********.****** ******

144. spacer 1.19|52921|23|NC_014025|CRT matches to KJ019143 (Synechococcus phage ACG-2014f isolate Syn7803C12, complete genome) position: , mismatch: 2, identity: 0.913

ctaccggagtcactggggctact	CRISPR spacer
ctaccggagccactggtgctact	Protospacer
*********.****** ******

145. spacer 1.19|52921|23|NC_014025|CRT matches to KJ019103 (Synechococcus phage ACG-2014f isolate Syn7803US44, complete genome) position: , mismatch: 2, identity: 0.913

ctaccggagtcactggggctact	CRISPR spacer
ctaccggagccactggtgctact	Protospacer
*********.****** ******

146. spacer 1.19|52921|23|NC_014025|CRT matches to KJ019102 (Synechococcus phage ACG-2014f isolate Syn7803US43, complete genome) position: , mismatch: 2, identity: 0.913

ctaccggagtcactggggctact	CRISPR spacer
ctaccggagccactggtgctact	Protospacer
*********.****** ******

147. spacer 1.19|52921|23|NC_014025|CRT matches to KJ019066 (Synechococcus phage ACG-2014f isolate Syn7803C9, complete genome) position: , mismatch: 2, identity: 0.913

ctaccggagtcactggggctact	CRISPR spacer
ctaccggagccactggtgctact	Protospacer
*********.****** ******

148. spacer 1.19|52921|23|NC_014025|CRT matches to KJ019149 (Synechococcus phage ACG-2014f isolate Syn7803C21, complete genome) position: , mismatch: 2, identity: 0.913

ctaccggagtcactggggctact	CRISPR spacer
ctaccggagccactggtgctact	Protospacer
*********.****** ******

149. spacer 1.19|52921|23|NC_014025|CRT matches to KJ019105 (Synechococcus phage ACG-2014f isolate Syn7803US4, complete genome) position: , mismatch: 2, identity: 0.913

ctaccggagtcactggggctact	CRISPR spacer
ctaccggagccactggtgctact	Protospacer
*********.****** ******

150. spacer 1.19|52921|23|NC_014025|CRT matches to KJ019098 (Synechococcus phage ACG-2014f isolate Syn7803US39, complete genome) position: , mismatch: 2, identity: 0.913

ctaccggagtcactggggctact	CRISPR spacer
ctaccggagccactggtgctact	Protospacer
*********.****** ******

151. spacer 1.19|52921|23|NC_014025|CRT matches to KJ019159 (Synechococcus phage ACG-2014f isolate Syn7803C34, complete genome) position: , mismatch: 2, identity: 0.913

ctaccggagtcactggggctact	CRISPR spacer
ctaccggagccactggtgctact	Protospacer
*********.****** ******

152. spacer 1.19|52921|23|NC_014025|CRT matches to KJ019111 (Synechococcus phage ACG-2014f isolate Syn7803US57, complete genome) position: , mismatch: 2, identity: 0.913

ctaccggagtcactggggctact	CRISPR spacer
ctaccggagccactggtgctact	Protospacer
*********.****** ******

153. spacer 1.19|52921|23|NC_014025|CRT matches to KJ019148 (Synechococcus phage ACG-2014f isolate Syn7803C19, complete genome) position: , mismatch: 2, identity: 0.913

ctaccggagtcactggggctact	CRISPR spacer
ctaccggagccactggtgctact	Protospacer
*********.****** ******

154. spacer 1.19|52921|23|NC_014025|CRT matches to NC_047712 (Synechococcus phage ACG-2014f isolate Syn7803C7, complete genome) position: , mismatch: 2, identity: 0.913

ctaccggagtcactggggctact	CRISPR spacer
ctaccggagccactggtgctact	Protospacer
*********.****** ******

155. spacer 1.19|52921|23|NC_014025|CRT matches to KJ019090 (Synechococcus phage ACG-2014f isolate Syn7803US24, complete genome) position: , mismatch: 2, identity: 0.913

ctaccggagtcactggggctact	CRISPR spacer
ctaccggagccactggtgctact	Protospacer
*********.****** ******

156. spacer 1.19|52921|23|NC_014025|CRT matches to KJ019146 (Synechococcus phage ACG-2014f isolate Syn7803C16, complete genome) position: , mismatch: 2, identity: 0.913

ctaccggagtcactggggctact	CRISPR spacer
ctaccggagccactggtgctact	Protospacer
*********.****** ******

157. spacer 1.19|52921|23|NC_014025|CRT matches to KJ019152 (Synechococcus phage ACG-2014f isolate Syn7803C25, complete genome) position: , mismatch: 2, identity: 0.913

ctaccggagtcactggggctact	CRISPR spacer
ctaccggagccactggtgctact	Protospacer
*********.****** ******

158. spacer 1.19|52921|23|NC_014025|CRT matches to KJ019151 (Synechococcus phage ACG-2014f isolate Syn7803C24, complete genome) position: , mismatch: 2, identity: 0.913

ctaccggagtcactggggctact	CRISPR spacer
ctaccggagccactggtgctact	Protospacer
*********.****** ******

159. spacer 1.19|52921|23|NC_014025|CRT matches to KJ019150 (Synechococcus phage ACG-2014f isolate Syn7803C22, complete genome) position: , mismatch: 2, identity: 0.913

ctaccggagtcactggggctact	CRISPR spacer
ctaccggagccactggtgctact	Protospacer
*********.****** ******

160. spacer 1.19|52921|23|NC_014025|CRT matches to NC_026927 (Synechococcus phage ACG-2014f isolate Syn7803C90, complete genome) position: , mismatch: 2, identity: 0.913

ctaccggagtcactggggctact	CRISPR spacer
ctaccggagccactggtgctact	Protospacer
*********.****** ******

161. spacer 1.19|52921|23|NC_014025|CRT matches to KJ019097 (Synechococcus phage ACG-2014f isolate Syn7803US37, complete genome) position: , mismatch: 2, identity: 0.913

ctaccggagtcactggggctact	CRISPR spacer
ctaccggagccactggtgctact	Protospacer
*********.****** ******

162. spacer 1.19|52921|23|NC_014025|CRT matches to KJ019045 (Synechococcus phage ACG-2014f isolate Syn7803C6, complete genome) position: , mismatch: 2, identity: 0.913

ctaccggagtcactggggctact	CRISPR spacer
ctaccggagccactggtgctact	Protospacer
*********.****** ******

163. spacer 1.19|52921|23|NC_014025|CRT matches to KJ019037 (Synechococcus phage ACG-2014f isolate Syn7803C58, complete genome) position: , mismatch: 2, identity: 0.913

ctaccggagtcactggggctact	CRISPR spacer
ctaccggagccactggtgctact	Protospacer
*********.****** ******

164. spacer 1.19|52921|23|NC_014025|CRT matches to KJ019099 (Synechococcus phage ACG-2014f isolate Syn7803US3, complete genome) position: , mismatch: 2, identity: 0.913

ctaccggagtcactggggctact	CRISPR spacer
ctaccggagccactggtgctact	Protospacer
*********.****** ******

165. spacer 1.19|52921|23|NC_014025|CRT matches to KJ019155 (Synechococcus phage ACG-2014f isolate Syn7803C29, complete genome) position: , mismatch: 2, identity: 0.913

ctaccggagtcactggggctact	CRISPR spacer
ctaccggagccactggtgctact	Protospacer
*********.****** ******

166. spacer 1.19|52921|23|NC_014025|CRT matches to KJ019053 (Synechococcus phage ACG-2014f isolate Syn7803C80, complete genome) position: , mismatch: 2, identity: 0.913

ctaccggagtcactggggctact	CRISPR spacer
ctaccggagccactggtgctact	Protospacer
*********.****** ******

167. spacer 1.19|52921|23|NC_014025|CRT matches to KJ019101 (Synechococcus phage ACG-2014f isolate Syn7803US42, complete genome) position: , mismatch: 2, identity: 0.913

ctaccggagtcactggggctact	CRISPR spacer
ctaccggagccactggtgctact	Protospacer
*********.****** ******

168. spacer 1.19|52921|23|NC_014025|CRT matches to KJ019085 (Synechococcus phage ACG-2014f isolate Syn7803US13, complete genome) position: , mismatch: 2, identity: 0.913

ctaccggagtcactggggctact	CRISPR spacer
ctaccggagccactggtgctact	Protospacer
*********.****** ******

169. spacer 1.19|52921|23|NC_014025|CRT matches to KJ019096 (Synechococcus phage ACG-2014f isolate Syn7803US36, complete genome) position: , mismatch: 2, identity: 0.913

ctaccggagtcactggggctact	CRISPR spacer
ctaccggagccactggtgctact	Protospacer
*********.****** ******

170. spacer 1.19|52921|23|NC_014025|CRT matches to KJ019091 (Synechococcus phage ACG-2014f isolate Syn7803US26, complete genome) position: , mismatch: 2, identity: 0.913

ctaccggagtcactggggctact	CRISPR spacer
ctaccggagccactggtgctact	Protospacer
*********.****** ******

171. spacer 1.19|52921|23|NC_014025|CRT matches to KJ019144 (Synechococcus phage ACG-2014f isolate Syn7803C14, complete genome) position: , mismatch: 2, identity: 0.913

ctaccggagtcactggggctact	CRISPR spacer
ctaccggagccactggtgctact	Protospacer
*********.****** ******

172. spacer 1.19|52921|23|NC_014025|CRT matches to KJ019145 (Synechococcus phage ACG-2014f isolate Syn7803C15, complete genome) position: , mismatch: 2, identity: 0.913

ctaccggagtcactggggctact	CRISPR spacer
ctaccggagccactggtgctact	Protospacer
*********.****** ******

173. spacer 1.19|52921|23|NC_014025|CRT matches to KJ019092 (Synechococcus phage ACG-2014f isolate Syn7803US2, complete genome) position: , mismatch: 2, identity: 0.913

ctaccggagtcactggggctact	CRISPR spacer
ctaccggagccactggtgctact	Protospacer
*********.****** ******

174. spacer 1.19|52921|23|NC_014025|CRT matches to CP011076 (Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.913

ctaccggagtcactggggctact	CRISPR spacer
ctaccggagacactggcgctact	Protospacer
********* ****** ******

175. spacer 1.19|52921|23|NC_014025|CRT matches to CP011076 (Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.913

ctaccggagtcactggggctact	CRISPR spacer
ctaccggagacactggcgctact	Protospacer
********* ****** ******

176. spacer 1.19|52921|23|NC_014025|CRT matches to CP011076 (Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.913

ctaccggagtcactggggctact	CRISPR spacer
ctaccggagacactggcgctact	Protospacer
********* ****** ******

177. spacer 1.19|52921|23|NC_014025|CRT matches to CP011076 (Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.913

ctaccggagtcactggggctact	CRISPR spacer
ctaccggagacactggcgctact	Protospacer
********* ****** ******

178. spacer 1.19|52921|23|NC_014025|CRT matches to CP011075 (Brevibacillus laterosporus strain B9 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.913

ctaccggagtcactggggctact	CRISPR spacer
ctaccggagacactggtgctact	Protospacer
********* ****** ******

179. spacer 1.19|52921|23|NC_014025|CRT matches to CP011075 (Brevibacillus laterosporus strain B9 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.913

ctaccggagtcactggggctact	CRISPR spacer
ctaccggagacactggcgctact	Protospacer
********* ****** ******

180. spacer 1.20|52966|32|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.938

tgacaggagccactggagctaccggagttact	CRISPR spacer
tgacaggagccactggagctaccggaatcact	Protospacer
**************************.*.***

181. spacer 1.20|52966|32|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.938

tgacaggagccactggagctaccggagttact	CRISPR spacer
tgacaggagccactggagctaccggaatcact	Protospacer
**************************.*.***

182. spacer 1.20|52966|32|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.938

tgacaggagccactggagctaccggagttact	CRISPR spacer
tgacaggagccactggagctactggagtcact	Protospacer
**********************.*****.***

183. spacer 1.20|52966|32|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.938

tgacaggagccactggagctaccggagttact	CRISPR spacer
tgacaggagccactggagctaccggaatcact	Protospacer
**************************.*.***

184. spacer 1.21|53020|41|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.951

tcactggagttactggaattaccggagttactggagtgact	CRISPR spacer
ttaccggagttactggaattaccggagttactggagtgact	Protospacer
*.**.************************************

185. spacer 1.21|53020|41|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.951

tcactggagttactggaattaccggagttactggagtgact	CRISPR spacer
ttaccggagttactggaattaccggagttactggagtgact	Protospacer
*.**.************************************

186. spacer 1.22|53083|32|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.938

tgacaggagccactggagctaccggagttact	CRISPR spacer
tgacaggagccactggagctaccggaatcact	Protospacer
**************************.*.***

187. spacer 1.22|53083|32|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.938

tgacaggagccactggagctaccggagttact	CRISPR spacer
tgacaggagccactggagctaccggaatcact	Protospacer
**************************.*.***

188. spacer 1.22|53083|32|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.938

tgacaggagccactggagctaccggagttact	CRISPR spacer
tgacaggagccactggagctactggagtcact	Protospacer
**********************.*****.***

189. spacer 1.22|53083|32|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.938

tgacaggagccactggagctaccggagttact	CRISPR spacer
tgacaggagccactggagctaccggaatcact	Protospacer
**************************.*.***

190. spacer 1.23|53137|41|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.951

tcactggagttactggaattaccggagttactggagtgact	CRISPR spacer
ttaccggagttactggaattaccggagttactggagtgact	Protospacer
*.**.************************************

191. spacer 1.23|53137|41|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.951

tcactggagttactggaattaccggagttactggagtgact	CRISPR spacer
ttaccggagttactggaattaccggagttactggagtgact	Protospacer
*.**.************************************

192. spacer 1.25|53272|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913

tgactggagctaccggaatcact	CRISPR spacer
ccactggagctaccggaatcact	Protospacer
. *********************

193. spacer 1.25|53272|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913

tgactggagctaccggaatcact	CRISPR spacer
ccactggagctaccggaatcact	Protospacer
. *********************

194. spacer 1.25|53272|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913

tgactggagctaccggaatcact	CRISPR spacer
ctactggagctaccggaatcact	Protospacer
. *********************

195. spacer 1.25|53272|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913

tgactggagctaccggaatcact	CRISPR spacer
ctactggagctaccggaatcact	Protospacer
. *********************

196. spacer 1.25|53272|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913

tgactggagctaccggaatcact	CRISPR spacer
ctactggagctaccggaatcact	Protospacer
. *********************

197. spacer 1.25|53272|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913

tgactggagctaccggaatcact	CRISPR spacer
ccactggagctaccggaatcact	Protospacer
. *********************

198. spacer 1.25|53272|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913

tgactggagctaccggaatcact	CRISPR spacer
ctactggagctaccggaatcact	Protospacer
. *********************

199. spacer 1.25|53272|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913

tgactggagctaccggaatcact	CRISPR spacer
tcacgggagctaccggaatcact	Protospacer
* ** ******************

200. spacer 1.25|53272|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913

tgactggagctaccggaatcact	CRISPR spacer
tcactggagctactggaatcact	Protospacer
* ***********.*********

201. spacer 1.25|53272|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913

tgactggagctaccggaatcact	CRISPR spacer
tcactggagctaccggagtcact	Protospacer
* ***************.*****

202. spacer 1.25|53272|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913

tgactggagctaccggaatcact	CRISPR spacer
tcacgggagctaccggaatcact	Protospacer
* ** ******************

203. spacer 1.25|53272|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913

tgactggagctaccggaatcact	CRISPR spacer
tcactggagctactggaatcact	Protospacer
* ***********.*********

204. spacer 1.25|53272|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913

tgactggagctaccggaatcact	CRISPR spacer
tcactggagctaccgggatcact	Protospacer
* **************.******

205. spacer 1.25|53272|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913

tgactggagctaccggaatcact	CRISPR spacer
tcactggagctaccggagtcact	Protospacer
* ***************.*****

206. spacer 1.25|53272|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913

tgactggagctaccggaatcact	CRISPR spacer
tcactggagctaccgggatcact	Protospacer
* **************.******

207. spacer 1.25|53272|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913

tgactggagctaccggaatcact	CRISPR spacer
tcactggagctaccggagtcact	Protospacer
* ***************.*****

208. spacer 1.25|53272|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913

tgactggagctaccggaatcact	CRISPR spacer
tcacgggagctaccggaatcact	Protospacer
* ** ******************

209. spacer 1.25|53272|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913

tgactggagctaccggaatcact	CRISPR spacer
tcacgggagctaccggaatcact	Protospacer
* ** ******************

210. spacer 1.25|53272|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913

tgactggagctaccggaatcact	CRISPR spacer
tcactggagctaccggagtcact	Protospacer
* ***************.*****

211. spacer 1.13|52597|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 3, identity: 0.87

tcactggagtcactggagctacc	CRISPR spacer
ctactggagtcactggagctact	Protospacer
..********************.

212. spacer 1.13|52597|23|NC_014025|CRT matches to NC_013085 (Synechococcus phage S-RSM4, complete genome) position: , mismatch: 3, identity: 0.87

tcactggagtcactggagctacc	CRISPR spacer
acacaggagtcactggagctact	Protospacer
 *** *****************.

213. spacer 1.13|52597|23|NC_014025|CRT matches to FM207411 (Synechococcus phage S-RSM4 complete genome) position: , mismatch: 3, identity: 0.87

tcactggagtcactggagctacc	CRISPR spacer
acacaggagtcactggagctact	Protospacer
 *** *****************.

214. spacer 1.16|52786|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 3, identity: 0.87

ttactggagctaccggagtcacg	CRISPR spacer
ctactggagctaccggaatcact	Protospacer
.****************.**** 

215. spacer 1.16|52786|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 3, identity: 0.87

ttactggagctaccggagtcacg	CRISPR spacer
ctactggagctaccggaatcact	Protospacer
.****************.**** 

216. spacer 1.16|52786|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 3, identity: 0.87

ttactggagctaccggagtcacg	CRISPR spacer
ctactggagctaccggaatcact	Protospacer
.****************.**** 

217. spacer 1.16|52786|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 3, identity: 0.87

ttactggagctaccggagtcacg	CRISPR spacer
ctactggagctaccggaatcact	Protospacer
.****************.**** 

218. spacer 1.17|52831|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 3, identity: 0.87

ctaccggaatcactggagctact	CRISPR spacer
tcactggaatcactggagctact	Protospacer
..**.******************

219. spacer 1.17|52831|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 3, identity: 0.87

ctaccggaatcactggagctact	CRISPR spacer
tcactggaatcactggagctact	Protospacer
..**.******************

220. spacer 1.18|52876|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 3, identity: 0.87

ttactggagctaccggagtcacg	CRISPR spacer
ctactggagctaccggaatcact	Protospacer
.****************.**** 

221. spacer 1.18|52876|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 3, identity: 0.87

ttactggagctaccggagtcacg	CRISPR spacer
ctactggagctaccggaatcact	Protospacer
.****************.**** 

222. spacer 1.18|52876|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 3, identity: 0.87

ttactggagctaccggagtcacg	CRISPR spacer
ctactggagctaccggaatcact	Protospacer
.****************.**** 

223. spacer 1.18|52876|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 3, identity: 0.87

ttactggagctaccggagtcacg	CRISPR spacer
ctactggagctaccggaatcact	Protospacer
.****************.**** 

224. spacer 1.19|52921|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 3, identity: 0.87

ctaccggagtcactggggctact	CRISPR spacer
tgactggagtcactggggctact	Protospacer
. **.******************

225. spacer 1.20|52966|32|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 3, identity: 0.906

tgacaggagccactggagctaccggagttact	CRISPR spacer
tcactggagtcactggagctaccggagttact	Protospacer
* ** ****.**********************

226. spacer 1.22|53083|32|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 3, identity: 0.906

tgacaggagccactggagctaccggagttact	CRISPR spacer
tcactggagtcactggagctaccggagttact	Protospacer
* ** ****.**********************

227. spacer 1.25|53272|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 3, identity: 0.87

tgactggagctaccggaatcact	CRISPR spacer
ctaccggagctaccggaatcact	Protospacer
. **.******************

228. spacer 1.10|52354|41|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 5, identity: 0.878

tcactggagctaccgggatcactggagctaccggagtcact	CRISPR spacer
tcactggagctaccggaatcactggagctactggagctacc	Protospacer
****************.**************.****..**.

229. spacer 1.15|52723|41|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 5, identity: 0.878

ctactggagttaccggagtcacgggagctaccggagctacc	CRISPR spacer
tcactggagctaccggagtcacgggagctaccggagttact	Protospacer
..*******.**************************.***.

230. spacer 1.20|52966|32|NC_014025|CRT matches to NC_014172 (Bacillus thuringiensis BMB171 plasmid pBMB171, complete sequence) position: , mismatch: 5, identity: 0.844

tgacaggagccactggagctaccggagttact	CRISPR spacer
ctacaggagccactggttctaccggagttaca	Protospacer
. **************  ************* 

231. spacer 1.20|52966|32|NC_014025|CRT matches to NC_011777 (Bacillus cereus AH820 plasmid pAH820_272, complete sequence) position: , mismatch: 5, identity: 0.844

tgacaggagccactggagctaccggagttact	CRISPR spacer
ctacaggagccactggttctaccggagttaca	Protospacer
. **************  ************* 

232. spacer 1.20|52966|32|NC_014025|CRT matches to NC_011777 (Bacillus cereus AH820 plasmid pAH820_272, complete sequence) position: , mismatch: 5, identity: 0.844

tgacaggagccactggagctaccggagttact	CRISPR spacer
ctacaggagccactggttctaccggagttaca	Protospacer
. **************  ************* 

233. spacer 1.22|53083|32|NC_014025|CRT matches to NC_014172 (Bacillus thuringiensis BMB171 plasmid pBMB171, complete sequence) position: , mismatch: 5, identity: 0.844

tgacaggagccactggagctaccggagttact	CRISPR spacer
ctacaggagccactggttctaccggagttaca	Protospacer
. **************  ************* 

234. spacer 1.22|53083|32|NC_014025|CRT matches to NC_011777 (Bacillus cereus AH820 plasmid pAH820_272, complete sequence) position: , mismatch: 5, identity: 0.844

tgacaggagccactggagctaccggagttact	CRISPR spacer
ctacaggagccactggttctaccggagttaca	Protospacer
. **************  ************* 

235. spacer 1.22|53083|32|NC_014025|CRT matches to NC_011777 (Bacillus cereus AH820 plasmid pAH820_272, complete sequence) position: , mismatch: 5, identity: 0.844

tgacaggagccactggagctaccggagttact	CRISPR spacer
ctacaggagccactggttctaccggagttaca	Protospacer
. **************  ************* 

236. spacer 1.10|52354|41|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 6, identity: 0.854

tcactggagctaccgggatcactggagctaccggagtcact	CRISPR spacer
ccactggagctaccggaatcactggagctactggagctacc	Protospacer
.***************.**************.****..**.

237. spacer 1.10|52354|41|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 6, identity: 0.854

tcactggagctaccgggatcactggagctaccggagtcact	CRISPR spacer
ccactggagctaccggaatcactggagctactggagctacc	Protospacer
.***************.**************.****..**.

238. spacer 1.15|52723|41|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 6, identity: 0.854

ctactggagttaccggagtcacgggagctaccggagctacc	CRISPR spacer
tgactggagttaccggagtcacgggagctaccggaatcact	Protospacer
. *********************************...**.

239. spacer 1.15|52723|41|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 6, identity: 0.854

ctactggagttaccggagtcacgggagctaccggagctacc	CRISPR spacer
tgactggagttaccggagtcacgggagctaccggaatcact	Protospacer
. *********************************...**.

240. spacer 1.15|52723|41|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 6, identity: 0.854

ctactggagttaccggagtcacgggagctaccggagctacc	CRISPR spacer
ttactggagctaccggagtcacgggagctaccggaatcact	Protospacer
.********.*************************...**.

241. spacer 1.15|52723|41|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 6, identity: 0.854

ctactggagttaccggagtcacgggagctaccggagctacc	CRISPR spacer
ttactggagctaccggagtcacgggagctaccggaatcact	Protospacer
.********.*************************...**.

242. spacer 1.20|52966|32|NC_014025|CRT matches to NC_014172 (Bacillus thuringiensis BMB171 plasmid pBMB171, complete sequence) position: , mismatch: 6, identity: 0.812

tgacaggagccactggagctaccggagttact	CRISPR spacer
ttacaggacctactggagctaccggaacaact	Protospacer
* ****** *.***************.. ***

243. spacer 1.20|52966|32|NC_014025|CRT matches to NC_011777 (Bacillus cereus AH820 plasmid pAH820_272, complete sequence) position: , mismatch: 6, identity: 0.812

tgacaggagccactggagctaccggagttact	CRISPR spacer
ttacaggacctactggagctaccggaacaact	Protospacer
* ****** *.***************.. ***

244. spacer 1.20|52966|32|NC_014025|CRT matches to NC_011777 (Bacillus cereus AH820 plasmid pAH820_272, complete sequence) position: , mismatch: 6, identity: 0.812

tgacaggagccactggagctaccggagttact	CRISPR spacer
ttacaggacctactggagctaccggaacaact	Protospacer
* ****** *.***************.. ***

245. spacer 1.20|52966|32|NC_014025|CRT matches to NC_011777 (Bacillus cereus AH820 plasmid pAH820_272, complete sequence) position: , mismatch: 6, identity: 0.812

tgacaggagccactggagctaccggagttact	CRISPR spacer
ttacaggacctactggagctaccggaacaact	Protospacer
* ****** *.***************.. ***

246. spacer 1.20|52966|32|NC_014025|CRT matches to NZ_CP016317 (Bacillus cereus strain M3 plasmid pBCM301, complete sequence) position: , mismatch: 6, identity: 0.812

tgacaggagccactggagctaccggagttact	CRISPR spacer
ttacaggacctactggagctaccggaacaact	Protospacer
* ****** *.***************.. ***

247. spacer 1.22|53083|32|NC_014025|CRT matches to NC_014172 (Bacillus thuringiensis BMB171 plasmid pBMB171, complete sequence) position: , mismatch: 6, identity: 0.812

tgacaggagccactggagctaccggagttact	CRISPR spacer
ttacaggacctactggagctaccggaacaact	Protospacer
* ****** *.***************.. ***

248. spacer 1.22|53083|32|NC_014025|CRT matches to NC_011777 (Bacillus cereus AH820 plasmid pAH820_272, complete sequence) position: , mismatch: 6, identity: 0.812

tgacaggagccactggagctaccggagttact	CRISPR spacer
ttacaggacctactggagctaccggaacaact	Protospacer
* ****** *.***************.. ***

249. spacer 1.22|53083|32|NC_014025|CRT matches to NC_011777 (Bacillus cereus AH820 plasmid pAH820_272, complete sequence) position: , mismatch: 6, identity: 0.812

tgacaggagccactggagctaccggagttact	CRISPR spacer
ttacaggacctactggagctaccggaacaact	Protospacer
* ****** *.***************.. ***

250. spacer 1.22|53083|32|NC_014025|CRT matches to NC_011777 (Bacillus cereus AH820 plasmid pAH820_272, complete sequence) position: , mismatch: 6, identity: 0.812

tgacaggagccactggagctaccggagttact	CRISPR spacer
ttacaggacctactggagctaccggaacaact	Protospacer
* ****** *.***************.. ***

251. spacer 1.22|53083|32|NC_014025|CRT matches to NZ_CP016317 (Bacillus cereus strain M3 plasmid pBCM301, complete sequence) position: , mismatch: 6, identity: 0.812

tgacaggagccactggagctaccggagttact	CRISPR spacer
ttacaggacctactggagctaccggaacaact	Protospacer
* ****** *.***************.. ***

252. spacer 1.20|52966|32|NC_014025|CRT matches to MN204498 (Streptomyces phage Saftant, complete genome) position: , mismatch: 7, identity: 0.781

tgacaggagccactggagctaccggagttact	CRISPR spacer
cgacaggagccactggcgctaccggcccggct	Protospacer
.*************** ********  . .**

253. spacer 1.22|53083|32|NC_014025|CRT matches to MN204498 (Streptomyces phage Saftant, complete genome) position: , mismatch: 7, identity: 0.781

tgacaggagccactggagctaccggagttact	CRISPR spacer
cgacaggagccactggcgctaccggcccggct	Protospacer
.*************** ********  . .**

254. spacer 1.9|52264|68|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 8, identity: 0.882

tcactggagtgacaggagccactggagctaccggaatcactggagctactggagctaccg	CRISPR spacer
tcactggagtgacaggagccactggagctaccggaatcactggagctactggagctaccg	Protospacer
************************************************************

255. spacer 1.9|52264|68|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 8, identity: 0.882

tcactggagtgacaggagccactggagctaccggaatcactggagctactggagctaccg	CRISPR spacer
tcactggagtgacaggagccactggagctaccggaatcactggagctactggagctaccg	Protospacer
************************************************************

256. spacer 1.11|52417|68|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 8, identity: 0.882

tcacgggagctaccggagctaccggaatcactggagctaccgggatcactggagctaccg	CRISPR spacer
tcacgggagctaccggagctaccggaatcactggagctaccgggatcactggagctaccg	Protospacer
************************************************************

257. spacer 1.12|52507|68|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 8, identity: 0.882

tcacgggagctaccggagctaccggagttaccggaatcactggagtcactggagtcacgg	CRISPR spacer
tcacgggagctaccggagctaccggagttaccggaatcactggagtcactggagtcacgg	Protospacer
************************************************************

258. spacer 1.20|52966|32|NC_014025|CRT matches to MN224566 (Mycobacterium phage Herbertwm, complete genome) position: , mismatch: 8, identity: 0.75

tgacaggagccactggagctaccggagttact	CRISPR spacer
acactggagccaccggagctaccggagccaag	Protospacer
  ** ********.*************..*  

259. spacer 1.20|52966|32|NC_014025|CRT matches to AP013956 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5F-MedDCM-OCT-S27-C232, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.75

tgacaggagccactggagctaccggagttact	CRISPR spacer
caacaggagacactggagctacaggtgcaacc	Protospacer
..******* ************ ** *. **.

260. spacer 1.20|52966|32|NC_014025|CRT matches to AP013963 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5F-MedDCM-OCT-S38-C146, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.75

tgacaggagccactggagctaccggagttact	CRISPR spacer
caacaggagacactggagctacaggtgcaacc	Protospacer
..******* ************ ** *. **.

261. spacer 1.20|52966|32|NC_014025|CRT matches to AP013959 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5F-MedDCM-OCT-S31-C107, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.75

tgacaggagccactggagctaccggagttact	CRISPR spacer
caacaggagacactggagctacaggtgcaacc	Protospacer
..******* ************ ** *. **.

262. spacer 1.20|52966|32|NC_014025|CRT matches to AP013565 (Uncultured Mediterranean phage uvMED isolate uvMED-CGR-C5F-MedDCM-OCT-S40-C10, *** SEQUENCING IN PROGRESS ***, 2 ordered pieces) position: , mismatch: 8, identity: 0.75

tgacaggagccactggagctaccggagttact	CRISPR spacer
caacaggagacactggagctacaggtgcaacc	Protospacer
..******* ************ ** *. **.

263. spacer 1.20|52966|32|NC_014025|CRT matches to AP013961 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5F-MedDCM-OCT-S34-C156, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.75

tgacaggagccactggagctaccggagttact	CRISPR spacer
caacaggagacactggagctacaggtgcaacc	Protospacer
..******* ************ ** *. **.

264. spacer 1.22|53083|32|NC_014025|CRT matches to MN224566 (Mycobacterium phage Herbertwm, complete genome) position: , mismatch: 8, identity: 0.75

tgacaggagccactggagctaccggagttact	CRISPR spacer
acactggagccaccggagctaccggagccaag	Protospacer
  ** ********.*************..*  

265. spacer 1.22|53083|32|NC_014025|CRT matches to AP013956 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5F-MedDCM-OCT-S27-C232, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.75

tgacaggagccactggagctaccggagttact	CRISPR spacer
caacaggagacactggagctacaggtgcaacc	Protospacer
..******* ************ ** *. **.

266. spacer 1.22|53083|32|NC_014025|CRT matches to AP013963 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5F-MedDCM-OCT-S38-C146, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.75

tgacaggagccactggagctaccggagttact	CRISPR spacer
caacaggagacactggagctacaggtgcaacc	Protospacer
..******* ************ ** *. **.

267. spacer 1.22|53083|32|NC_014025|CRT matches to AP013959 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5F-MedDCM-OCT-S31-C107, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.75

tgacaggagccactggagctaccggagttact	CRISPR spacer
caacaggagacactggagctacaggtgcaacc	Protospacer
..******* ************ ** *. **.

268. spacer 1.22|53083|32|NC_014025|CRT matches to AP013565 (Uncultured Mediterranean phage uvMED isolate uvMED-CGR-C5F-MedDCM-OCT-S40-C10, *** SEQUENCING IN PROGRESS ***, 2 ordered pieces) position: , mismatch: 8, identity: 0.75

tgacaggagccactggagctaccggagttact	CRISPR spacer
caacaggagacactggagctacaggtgcaacc	Protospacer
..******* ************ ** *. **.

269. spacer 1.22|53083|32|NC_014025|CRT matches to AP013961 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5F-MedDCM-OCT-S34-C156, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.75

tgacaggagccactggagctaccggagttact	CRISPR spacer
caacaggagacactggagctacaggtgcaacc	Protospacer
..******* ************ ** *. **.

270. spacer 1.9|52264|68|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 9, identity: 0.868

tcactggagtgacaggagccactggagctaccggaatcactggagctactggagctaccg	CRISPR spacer
tcactggagtgacaggagccactggagctaccggaatcactggagctactggagctactg	Protospacer
**********************************************************.*

271. spacer 1.24|53200|50|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 9, identity: 0.82

tgacaggagccactggagctaccggaatcactggagctactggagctact	CRISPR spacer
ctaccgggatcactggagctaccggagtcactggagctactggagttacc	Protospacer
. ** **...****************.******************.***.

272. spacer 1.3|51706|77|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 17, identity: 0.779

ttaccggagtcacgggagttactggaatcactggagtcactggagtgactggagttaccg	CRISPR spacer
ttaccggagtcacgggagttactggaatcactggagtcactggagtgactggagttaccg	Protospacer
************************************************************

273. spacer 1.4|51805|77|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 17, identity: 0.779

aaactggagttactggagaaacgggagctaccggagtcactggaatcactggagctactg	CRISPR spacer
aaactggagttactggagaaacgggagctaccggagtcactggaatcactggagctactg	Protospacer
************************************************************

274. spacer 1.4|51805|77|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 17, identity: 0.779

aaactggagttactggagaaacgggagctaccggagtcactggaatcactggagctactg	CRISPR spacer
aaactggagttactggagaaacgggagctaccggagtcactggaatcactggagctactg	Protospacer
************************************************************

275. spacer 1.5|51904|77|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 17, identity: 0.779

tcactggagtgactggagttaccggagtcacgggagctaccggaatcactggagttactg	CRISPR spacer
tcactggagtgactggagttaccggagtcacgggagctaccggaatcactggagttactg	Protospacer
************************************************************

276. spacer 1.5|51904|77|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 17, identity: 0.779

tcactggagtgactggagttaccggagtcacgggagctaccggaatcactggagttactg	CRISPR spacer
tcactggagtgactggagttaccggagtcacgggagctaccggaatcactggagttactg	Protospacer
************************************************************

277. spacer 1.7|52084|77|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 17, identity: 0.779

ttactggaattaccggagttactggaattaccggagttactggagtgactggagttaccg	CRISPR spacer
ttactggaattaccggagttactggaattaccggagttactggagtgactggagttaccg	Protospacer
************************************************************

278. spacer 1.7|52084|77|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 19, identity: 0.753

ttactggaattaccggagttactggaattaccggagttactggagtgactggagttaccg	CRISPR spacer
ctaccggaattaccggagttactggaattaccggagttactggagtgactggagttaccg	Protospacer
.***.*******************************************************

279. spacer 1.1|51481|86|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 26, identity: 0.698

tcactggggctactggagcaacgggagctaccggagtcactggagctactggagctactg	CRISPR spacer
tcactggggctactggagcaacgggagctaccggagtcactggagctactggagctactg	Protospacer
************************************************************

280. spacer 1.2|51589|95|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 35, identity: 0.632

tcactggagctactggaattactggaattactggaattaccggagtcactggggctactg	CRISPR spacer
tcactggagctactggaattactggaattactggaattaccggagtcactggggctactg	Protospacer
************************************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_014019
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014019_1 379599-379758 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014019_2 963424-963519 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014019_3 1064822-1064902 Orphan NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014019_4 1554840-1554922 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014019_5 2119143-2119232 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014019_8 2830823-2830907 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014019_7 2830668-2830753 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014019_6 2830451-2830598 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014019_9 3858774-3858868 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 242611 : 250873 8 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_2 2199772 : 2207984 7 Bacillus_virus(66.67%) NA NA
DBSCAN-SWA_3 4204116 : 4213416 8 Bacillus_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NC_014031
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1560 : 65057 53 Catovirus(23.08%) coat,integrase,transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage