1. spacer 1.6|52003|59|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 0, identity: 1.0
tcactggaatcactggagctactggaatcactggagtgacgggaatcactggagctacc CRISPR spacer
tcactggaatcactggagctactggaatcactggagtgacgggaatcactggagctacc Protospacer
***********************************************************
2. spacer 1.6|52003|59|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 0, identity: 1.0
tcactggaatcactggagctactggaatcactggagtgacgggaatcactggagctacc CRISPR spacer
tcactggaatcactggagctactggaatcactggagtgacgggaatcactggagctacc Protospacer
***********************************************************
3. spacer 1.8|52183|59|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 0, identity: 1.0
tcactggagctactggagctaccggaattaccggagttactggaattaccggagttact CRISPR spacer
tcactggagctactggagctaccggaattaccggagttactggaattaccggagttact Protospacer
***********************************************************
4. spacer 1.10|52354|41|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 0, identity: 1.0
tcactggagctaccgggatcactggagctaccggagtcact CRISPR spacer
tcactggagctaccgggatcactggagctaccggagtcact Protospacer
*****************************************
5. spacer 1.10|52354|41|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 0, identity: 1.0
tcactggagctaccgggatcactggagctaccggagtcact CRISPR spacer
tcactggagctaccgggatcactggagctaccggagtcact Protospacer
*****************************************
6. spacer 1.13|52597|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 0, identity: 1.0
tcactggagtcactggagctacc CRISPR spacer
tcactggagtcactggagctacc Protospacer
***********************
7. spacer 1.14|52642|59|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 0, identity: 1.0
ttactggaattaccggagtgactggagttaccggaatcactggagtgacaggagccact CRISPR spacer
ttactggaattaccggagtgactggagttaccggaatcactggagtgacaggagccact Protospacer
***********************************************************
8. spacer 1.15|52723|41|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 0, identity: 1.0
ctactggagttaccggagtcacgggagctaccggagctacc CRISPR spacer
ctactggagttaccggagtcacgggagctaccggagctacc Protospacer
*****************************************
9. spacer 1.15|52723|41|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 0, identity: 1.0
ctactggagttaccggagtcacgggagctaccggagctacc CRISPR spacer
ctactggagttaccggagtcacgggagctaccggagctacc Protospacer
*****************************************
10. spacer 1.16|52786|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 0, identity: 1.0
ttactggagctaccggagtcacg CRISPR spacer
ttactggagctaccggagtcacg Protospacer
***********************
11. spacer 1.16|52786|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 0, identity: 1.0
ttactggagctaccggagtcacg CRISPR spacer
ttactggagctaccggagtcacg Protospacer
***********************
12. spacer 1.17|52831|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 0, identity: 1.0
ctaccggaatcactggagctact CRISPR spacer
ctaccggaatcactggagctact Protospacer
***********************
13. spacer 1.17|52831|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 0, identity: 1.0
ctaccggaatcactggagctact CRISPR spacer
ctaccggaatcactggagctact Protospacer
***********************
14. spacer 1.17|52831|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 0, identity: 1.0
ctaccggaatcactggagctact CRISPR spacer
ctaccggaatcactggagctact Protospacer
***********************
15. spacer 1.17|52831|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 0, identity: 1.0
ctaccggaatcactggagctact CRISPR spacer
ctaccggaatcactggagctact Protospacer
***********************
16. spacer 1.18|52876|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 0, identity: 1.0
ttactggagctaccggagtcacg CRISPR spacer
ttactggagctaccggagtcacg Protospacer
***********************
17. spacer 1.18|52876|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 0, identity: 1.0
ttactggagctaccggagtcacg CRISPR spacer
ttactggagctaccggagtcacg Protospacer
***********************
18. spacer 1.19|52921|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 0, identity: 1.0
ctaccggagtcactggggctact CRISPR spacer
ctaccggagtcactggggctact Protospacer
***********************
19. spacer 1.20|52966|32|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 0, identity: 1.0
tgacaggagccactggagctaccggagttact CRISPR spacer
tgacaggagccactggagctaccggagttact Protospacer
********************************
20. spacer 1.20|52966|32|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 0, identity: 1.0
tgacaggagccactggagctaccggagttact CRISPR spacer
tgacaggagccactggagctaccggagttact Protospacer
********************************
21. spacer 1.21|53020|41|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 0, identity: 1.0
tcactggagttactggaattaccggagttactggagtgact CRISPR spacer
tcactggagttactggaattaccggagttactggagtgact Protospacer
*****************************************
22. spacer 1.21|53020|41|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 0, identity: 1.0
tcactggagttactggaattaccggagttactggagtgact CRISPR spacer
tcactggagttactggaattaccggagttactggagtgact Protospacer
*****************************************
23. spacer 1.22|53083|32|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 0, identity: 1.0
tgacaggagccactggagctaccggagttact CRISPR spacer
tgacaggagccactggagctaccggagttact Protospacer
********************************
24. spacer 1.22|53083|32|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 0, identity: 1.0
tgacaggagccactggagctaccggagttact CRISPR spacer
tgacaggagccactggagctaccggagttact Protospacer
********************************
25. spacer 1.23|53137|41|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 0, identity: 1.0
tcactggagttactggaattaccggagttactggagtgact CRISPR spacer
tcactggagttactggaattaccggagttactggagtgact Protospacer
*****************************************
26. spacer 1.23|53137|41|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 0, identity: 1.0
tcactggagttactggaattaccggagttactggagtgact CRISPR spacer
tcactggagttactggaattaccggagttactggagtgact Protospacer
*****************************************
27. spacer 1.24|53200|50|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 0, identity: 1.0
tgacaggagccactggagctaccggaatcactggagctactggagctact CRISPR spacer
tgacaggagccactggagctaccggaatcactggagctactggagctact Protospacer
**************************************************
28. spacer 1.25|53272|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 0, identity: 1.0
tgactggagctaccggaatcact CRISPR spacer
tgactggagctaccggaatcact Protospacer
***********************
29. spacer 1.13|52597|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 1, identity: 0.957
tcactggagtcactggagctacc CRISPR spacer
tcactggagttactggagctacc Protospacer
**********.************
30. spacer 1.13|52597|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 1, identity: 0.957
tcactggagtcactggagctacc CRISPR spacer
tcactggagtcacgggagctacc Protospacer
************* *********
31. spacer 1.13|52597|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 1, identity: 0.957
tcactggagtcactggagctacc CRISPR spacer
tcactggagttactggagctacc Protospacer
**********.************
32. spacer 1.13|52597|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 1, identity: 0.957
tcactggagtcactggagctacc CRISPR spacer
tcactggagttactggagctacc Protospacer
**********.************
33. spacer 1.13|52597|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 1, identity: 0.957
tcactggagtcactggagctacc CRISPR spacer
tcactggagtgactggagctacc Protospacer
********** ************
34. spacer 1.15|52723|41|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 1, identity: 0.976
ctactggagttaccggagtcacgggagctaccggagctacc CRISPR spacer
ttactggagttaccggagtcacgggagctaccggagctacc Protospacer
.****************************************
35. spacer 1.16|52786|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 1, identity: 0.957
ttactggagctaccggagtcacg CRISPR spacer
tcactggagctaccggagtcacg Protospacer
*.*********************
36. spacer 1.16|52786|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 1, identity: 0.957
ttactggagctaccggagtcacg CRISPR spacer
tcactggagctaccggagtcacg Protospacer
*.*********************
37. spacer 1.16|52786|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 1, identity: 0.957
ttactggagctaccggagtcacg CRISPR spacer
ttactggagttaccggagtcacg Protospacer
*********.*************
38. spacer 1.17|52831|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 1, identity: 0.957
ctaccggaatcactggagctact CRISPR spacer
ctaccggaatcactggagctacc Protospacer
**********************.
39. spacer 1.17|52831|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 1, identity: 0.957
ctaccggaatcactggagctact CRISPR spacer
ctaccggaatcactggagctacc Protospacer
**********************.
40. spacer 1.17|52831|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 1, identity: 0.957
ctaccggaatcactggagctact CRISPR spacer
ctaccggaatcactggagctacc Protospacer
**********************.
41. spacer 1.17|52831|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 1, identity: 0.957
ctaccggaatcactggagctact CRISPR spacer
ctaccggaatcactggagctacc Protospacer
**********************.
42. spacer 1.17|52831|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 1, identity: 0.957
ctaccggaatcactggagctact CRISPR spacer
ctaccggagtcactggagctact Protospacer
********.**************
43. spacer 1.17|52831|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 1, identity: 0.957
ctaccggaatcactggagctact CRISPR spacer
ctaccggaatcactggagttact Protospacer
******************.****
44. spacer 1.17|52831|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 1, identity: 0.957
ctaccggaatcactggagctact CRISPR spacer
ctaccggaatcactggagttact Protospacer
******************.****
45. spacer 1.17|52831|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 1, identity: 0.957
ctaccggaatcactggagctact CRISPR spacer
ctaccggaatcactggagttact Protospacer
******************.****
46. spacer 1.17|52831|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 1, identity: 0.957
ctaccggaatcactggagctact CRISPR spacer
ctaccggagtcactggagctact Protospacer
********.**************
47. spacer 1.17|52831|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 1, identity: 0.957
ctaccggaatcactggagctact CRISPR spacer
ctaccggaatcactggagttact Protospacer
******************.****
48. spacer 1.18|52876|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 1, identity: 0.957
ttactggagctaccggagtcacg CRISPR spacer
tcactggagctaccggagtcacg Protospacer
*.*********************
49. spacer 1.18|52876|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 1, identity: 0.957
ttactggagctaccggagtcacg CRISPR spacer
tcactggagctaccggagtcacg Protospacer
*.*********************
50. spacer 1.18|52876|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 1, identity: 0.957
ttactggagctaccggagtcacg CRISPR spacer
ttactggagttaccggagtcacg Protospacer
*********.*************
51. spacer 1.19|52921|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 1, identity: 0.957
ctaccggagtcactggggctact CRISPR spacer
ttaccggagtcactggggctact Protospacer
.**********************
52. spacer 1.19|52921|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 1, identity: 0.957
ctaccggagtcactggggctact CRISPR spacer
ttaccggagtcactggggctact Protospacer
.**********************
53. spacer 1.19|52921|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 1, identity: 0.957
ctaccggagtcactggggctact CRISPR spacer
ctaccggagtcactggagctact Protospacer
****************.******
54. spacer 1.19|52921|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 1, identity: 0.957
ctaccggagtcactggggctact CRISPR spacer
ctaccggagtcactggagctact Protospacer
****************.******
55. spacer 1.24|53200|50|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 1, identity: 0.98
tgacaggagccactggagctaccggaatcactggagctactggagctact CRISPR spacer
tgacaggagccactggagctaccggaatcactggagctactggagctacc Protospacer
*************************************************.
56. spacer 1.24|53200|50|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 1, identity: 0.98
tgacaggagccactggagctaccggaatcactggagctactggagctact CRISPR spacer
tgacaggagccactggagctaccggaatcactggagctactggagctacc Protospacer
*************************************************.
57. spacer 1.25|53272|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 1, identity: 0.957
tgactggagctaccggaatcact CRISPR spacer
tgactggagttaccggaatcact Protospacer
*********.*************
58. spacer 1.25|53272|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 1, identity: 0.957
tgactggagctaccggaatcact CRISPR spacer
tgactggagttaccggaatcact Protospacer
*********.*************
59. spacer 1.25|53272|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 1, identity: 0.957
tgactggagctaccggaatcact CRISPR spacer
ttactggagctaccggaatcact Protospacer
* *********************
60. spacer 1.25|53272|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 1, identity: 0.957
tgactggagctaccggaatcact CRISPR spacer
tgactggagttaccggaatcact Protospacer
*********.*************
61. spacer 1.25|53272|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 1, identity: 0.957
tgactggagctaccggaatcact CRISPR spacer
tcactggagctaccggaatcact Protospacer
* *********************
62. spacer 1.25|53272|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 1, identity: 0.957
tgactggagctaccggaatcact CRISPR spacer
tgactggagttaccggaatcact Protospacer
*********.*************
63. spacer 1.25|53272|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 1, identity: 0.957
tgactggagctaccggaatcact CRISPR spacer
tgactggagttaccggaatcact Protospacer
*********.*************
64. spacer 1.10|52354|41|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.951
tcactggagctaccgggatcactggagctaccggagtcact CRISPR spacer
tcacgggagctaccggaatcactggagctaccggagtcact Protospacer
**** ***********.************************
65. spacer 1.13|52597|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913
tcactggagtcactggagctacc CRISPR spacer
ccactggaatcactggagctacc Protospacer
.*******.**************
66. spacer 1.13|52597|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913
tcactggagtcactggagctacc CRISPR spacer
ccactggaatcactggagctacc Protospacer
.*******.**************
67. spacer 1.13|52597|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913
tcactggagtcactggagctacc CRISPR spacer
tcactggaatcactggagctact Protospacer
********.*************.
68. spacer 1.13|52597|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913
tcactggagtcactggagctacc CRISPR spacer
tcactggaatcactggagctact Protospacer
********.*************.
69. spacer 1.13|52597|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913
tcactggagtcactggagctacc CRISPR spacer
tcactggagtcactggagttact Protospacer
******************.***.
70. spacer 1.13|52597|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913
tcactggagtcactggagctacc CRISPR spacer
tcactggagtcactggagttact Protospacer
******************.***.
71. spacer 1.13|52597|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913
tcactggagtcactggagctacc CRISPR spacer
tcactggagtgactggagttacc Protospacer
********** *******.****
72. spacer 1.13|52597|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913
tcactggagtcactggagctacc CRISPR spacer
tcactggagtgactggagttacc Protospacer
********** *******.****
73. spacer 1.13|52597|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913
tcactggagtcactggagctacc CRISPR spacer
tcactggagctactggagctacc Protospacer
*********..************
74. spacer 1.13|52597|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913
tcactggagtcactggagctacc CRISPR spacer
tcactggagctactggagctacc Protospacer
*********..************
75. spacer 1.13|52597|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913
tcactggagtcactggagctacc CRISPR spacer
tcactggagttactggagttacc Protospacer
**********.*******.****
76. spacer 1.13|52597|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913
tcactggagtcactggagctacc CRISPR spacer
tcactggagctactggagctacc Protospacer
*********..************
77. spacer 1.16|52786|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913
ttactggagctaccggagtcacg CRISPR spacer
tcactggagctaccggagtcact Protospacer
*.********************
78. spacer 1.16|52786|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913
ttactggagctaccggagtcacg CRISPR spacer
ttactggagctaccggaatcact Protospacer
*****************.****
79. spacer 1.16|52786|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913
ttactggagctaccggagtcacg CRISPR spacer
tcactggagctaccggagtcact Protospacer
*.********************
80. spacer 1.16|52786|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913
ttactggagctaccggagtcacg CRISPR spacer
tcactggagctaccggagtcact Protospacer
*.********************
81. spacer 1.16|52786|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913
ttactggagctaccggagtcacg CRISPR spacer
ctactggagttaccggagtcacg Protospacer
.********.*************
82. spacer 1.16|52786|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913
ttactggagctaccggagtcacg CRISPR spacer
ctactggagttaccggagtcacg Protospacer
.********.*************
83. spacer 1.16|52786|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913
ttactggagctaccggagtcacg CRISPR spacer
tcactggagctaccggagtcact Protospacer
*.********************
84. spacer 1.16|52786|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913
ttactggagctaccggagtcacg CRISPR spacer
tgactggagttaccggagtcacg Protospacer
* *******.*************
85. spacer 1.16|52786|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913
ttactggagctaccggagtcacg CRISPR spacer
tgactggagttaccggagtcacg Protospacer
* *******.*************
86. spacer 1.16|52786|23|NC_014025|CRT matches to EU744250 (Mycobacterium virus Pukovnik, complete genome) position: , mismatch: 2, identity: 0.913
ttactggagctaccggagtcacg CRISPR spacer
ttaccggagctaccggaggcacg Protospacer
****.************* ****
87. spacer 1.17|52831|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913
ctaccggaatcactggagctact CRISPR spacer
ttaccggagtcactggagctact Protospacer
.*******.**************
88. spacer 1.17|52831|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913
ctaccggaatcactggagctact CRISPR spacer
ctaccgggatcactggagctacc Protospacer
*******.**************.
89. spacer 1.17|52831|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913
ctaccggaatcactggagctact CRISPR spacer
ctaccgggatcactggagctacc Protospacer
*******.**************.
90. spacer 1.17|52831|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913
ctaccggaatcactggagctact CRISPR spacer
ttaccggaatcactggagttact Protospacer
.*****************.****
91. spacer 1.17|52831|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913
ctaccggaatcactggagctact CRISPR spacer
ctaccggagtcacgggagctact Protospacer
********.**** *********
92. spacer 1.17|52831|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913
ctaccggaatcactggagctact CRISPR spacer
ctaccggagtcactggagccact Protospacer
********.**********.***
93. spacer 1.17|52831|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913
ctaccggaatcactggagctact CRISPR spacer
ctaccggagtcactggagttact Protospacer
********.*********.****
94. spacer 1.17|52831|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913
ctaccggaatcactggagctact CRISPR spacer
ctactggagtcactggagctact Protospacer
****.***.**************
95. spacer 1.17|52831|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913
ctaccggaatcactggagctact CRISPR spacer
ctaccggagtcactggggctact Protospacer
********.*******.******
96. spacer 1.17|52831|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913
ctaccggaatcactggagctact CRISPR spacer
ctaccggaatcactggagtgact Protospacer
******************. ***
97. spacer 1.17|52831|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913
ctaccggaatcactggagctact CRISPR spacer
ctaccggaatcactggagtgact Protospacer
******************. ***
98. spacer 1.17|52831|23|NC_014025|CRT matches to NZ_CP009691 (Bacillus mycoides strain ATCC 6462 plasmid pBMX_1, complete sequence) position: , mismatch: 2, identity: 0.913
ctaccggaatcactggagctact CRISPR spacer
ctactggaataactggagctact Protospacer
****.***** ************
99. spacer 1.17|52831|23|NC_014025|CRT matches to MT586120 (Synechococcus phage S-CAM7 isolate 0809CC03, complete genome) position: , mismatch: 2, identity: 0.913
ctaccggaatcactggagctact CRISPR spacer
ctactggactcactggagctact Protospacer
****.*** **************
100. spacer 1.17|52831|23|NC_014025|CRT matches to MT586120 (Synechococcus phage S-CAM7 isolate 0809CC03, complete genome) position: , mismatch: 2, identity: 0.913
ctaccggaatcactggagctact CRISPR spacer
ctactggactcactggagctact Protospacer
****.*** **************
101. spacer 1.17|52831|23|NC_014025|CRT matches to MT586120 (Synechococcus phage S-CAM7 isolate 0809CC03, complete genome) position: , mismatch: 2, identity: 0.913
ctaccggaatcactggagctact CRISPR spacer
ctactggactcactggagctact Protospacer
****.*** **************
102. spacer 1.17|52831|23|NC_014025|CRT matches to MT586120 (Synechococcus phage S-CAM7 isolate 0809CC03, complete genome) position: , mismatch: 2, identity: 0.913
ctaccggaatcactggagctact CRISPR spacer
ctactggactcactggagctact Protospacer
****.*** **************
103. spacer 1.17|52831|23|NC_014025|CRT matches to MT586120 (Synechococcus phage S-CAM7 isolate 0809CC03, complete genome) position: , mismatch: 2, identity: 0.913
ctaccggaatcactggagctact CRISPR spacer
ctactggactcactggagctact Protospacer
****.*** **************
104. spacer 1.17|52831|23|NC_014025|CRT matches to NC_031927 (Synechococcus phage S-CAM7 isolate 0910CC49, complete genome) position: , mismatch: 2, identity: 0.913
ctaccggaatcactggagctact CRISPR spacer
ctactggactcactggagctact Protospacer
****.*** **************
105. spacer 1.17|52831|23|NC_014025|CRT matches to NC_031927 (Synechococcus phage S-CAM7 isolate 0910CC49, complete genome) position: , mismatch: 2, identity: 0.913
ctaccggaatcactggagctact CRISPR spacer
ctactggactcactggagctact Protospacer
****.*** **************
106. spacer 1.17|52831|23|NC_014025|CRT matches to NC_031927 (Synechococcus phage S-CAM7 isolate 0910CC49, complete genome) position: , mismatch: 2, identity: 0.913
ctaccggaatcactggagctact CRISPR spacer
ctactggactcactggagctact Protospacer
****.*** **************
107. spacer 1.17|52831|23|NC_014025|CRT matches to NC_031927 (Synechococcus phage S-CAM7 isolate 0910CC49, complete genome) position: , mismatch: 2, identity: 0.913
ctaccggaatcactggagctact CRISPR spacer
ctactggactcactggagctact Protospacer
****.*** **************
108. spacer 1.17|52831|23|NC_014025|CRT matches to NC_031927 (Synechococcus phage S-CAM7 isolate 0910CC49, complete genome) position: , mismatch: 2, identity: 0.913
ctaccggaatcactggagctact CRISPR spacer
ctactggactcactggagctact Protospacer
****.*** **************
109. spacer 1.17|52831|23|NC_014025|CRT matches to KU686213 (Synechococcus phage S-CAM7 isolate 0910SB42, complete genome) position: , mismatch: 2, identity: 0.913
ctaccggaatcactggagctact CRISPR spacer
ctactggactcactggagctact Protospacer
****.*** **************
110. spacer 1.17|52831|23|NC_014025|CRT matches to KU686213 (Synechococcus phage S-CAM7 isolate 0910SB42, complete genome) position: , mismatch: 2, identity: 0.913
ctaccggaatcactggagctact CRISPR spacer
ctactggactcactggagctact Protospacer
****.*** **************
111. spacer 1.17|52831|23|NC_014025|CRT matches to KU686213 (Synechococcus phage S-CAM7 isolate 0910SB42, complete genome) position: , mismatch: 2, identity: 0.913
ctaccggaatcactggagctact CRISPR spacer
ctactggactcactggagctact Protospacer
****.*** **************
112. spacer 1.17|52831|23|NC_014025|CRT matches to KU686213 (Synechococcus phage S-CAM7 isolate 0910SB42, complete genome) position: , mismatch: 2, identity: 0.913
ctaccggaatcactggagctact CRISPR spacer
ctactggactcactggagctact Protospacer
****.*** **************
113. spacer 1.17|52831|23|NC_014025|CRT matches to KU686213 (Synechococcus phage S-CAM7 isolate 0910SB42, complete genome) position: , mismatch: 2, identity: 0.913
ctaccggaatcactggagctact CRISPR spacer
ctactggactcactggagctact Protospacer
****.*** **************
114. spacer 1.17|52831|23|NC_014025|CRT matches to CP013001 (Bacillus thuringiensis strain XL6 plasmid, complete sequence) position: , mismatch: 2, identity: 0.913
ctaccggaatcactggagctact CRISPR spacer
ctaccggaaacactggacctact Protospacer
********* ******* *****
115. spacer 1.17|52831|23|NC_014025|CRT matches to LC554890 (Ralstonia phage RP13 DNA, nearly complete genome) position: , mismatch: 2, identity: 0.913
ctaccggaatcactggagctact CRISPR spacer
ctgctggaatcactggagctact Protospacer
**.*.******************
116. spacer 1.18|52876|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913
ttactggagctaccggagtcacg CRISPR spacer
tcactggagctaccggagtcact Protospacer
*.********************
117. spacer 1.18|52876|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913
ttactggagctaccggagtcacg CRISPR spacer
ttactggagctaccggaatcact Protospacer
*****************.****
118. spacer 1.18|52876|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913
ttactggagctaccggagtcacg CRISPR spacer
tcactggagctaccggagtcact Protospacer
*.********************
119. spacer 1.18|52876|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913
ttactggagctaccggagtcacg CRISPR spacer
tcactggagctaccggagtcact Protospacer
*.********************
120. spacer 1.18|52876|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913
ttactggagctaccggagtcacg CRISPR spacer
ctactggagttaccggagtcacg Protospacer
.********.*************
121. spacer 1.18|52876|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913
ttactggagctaccggagtcacg CRISPR spacer
ctactggagttaccggagtcacg Protospacer
.********.*************
122. spacer 1.18|52876|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913
ttactggagctaccggagtcacg CRISPR spacer
tcactggagctaccggagtcact Protospacer
*.********************
123. spacer 1.18|52876|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913
ttactggagctaccggagtcacg CRISPR spacer
tgactggagttaccggagtcacg Protospacer
* *******.*************
124. spacer 1.18|52876|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913
ttactggagctaccggagtcacg CRISPR spacer
tgactggagttaccggagtcacg Protospacer
* *******.*************
125. spacer 1.18|52876|23|NC_014025|CRT matches to EU744250 (Mycobacterium virus Pukovnik, complete genome) position: , mismatch: 2, identity: 0.913
ttactggagctaccggagtcacg CRISPR spacer
ttaccggagctaccggaggcacg Protospacer
****.************* ****
126. spacer 1.19|52921|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913
ctaccggagtcactggggctact CRISPR spacer
ttaccggagtcactggagctact Protospacer
.***************.******
127. spacer 1.19|52921|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913
ctaccggagtcactggggctact CRISPR spacer
ctaccggagtcacgggagctact Protospacer
************* **.******
128. spacer 1.19|52921|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913
ctaccggagtcactggggctact CRISPR spacer
ctaccggagtcactggagccact Protospacer
****************.**.***
129. spacer 1.19|52921|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913
ctaccggagtcactggggctact CRISPR spacer
ctaccggaatcactggagctact Protospacer
********.*******.******
130. spacer 1.19|52921|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913
ctaccggagtcactggggctact CRISPR spacer
ctaccggaatcactggagctact Protospacer
********.*******.******
131. spacer 1.19|52921|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913
ctaccggagtcactggggctact CRISPR spacer
ctaccggagtcactggagttact Protospacer
****************.*.****
132. spacer 1.19|52921|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913
ctaccggagtcactggggctact CRISPR spacer
ctactggagtcactggagctact Protospacer
****.***********.******
133. spacer 1.19|52921|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913
ctaccggagtcactggggctact CRISPR spacer
ctaccggaatcactggagctact Protospacer
********.*******.******
134. spacer 1.19|52921|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913
ctaccggagtcactggggctact CRISPR spacer
ctaccggaatcactggagctact Protospacer
********.*******.******
135. spacer 1.19|52921|23|NC_014025|CRT matches to NZ_CP015352 (Bacillus thuringiensis strain MYBT18246 plasmid p142098, complete sequence) position: , mismatch: 2, identity: 0.913
ctaccggagtcactggggctact CRISPR spacer
ctaccggagttactggggctacc Protospacer
**********.***********.
136. spacer 1.19|52921|23|NC_014025|CRT matches to NZ_CP015352 (Bacillus thuringiensis strain MYBT18246 plasmid p142098, complete sequence) position: , mismatch: 2, identity: 0.913
ctaccggagtcactggggctact CRISPR spacer
ctaccggagttactggggctacc Protospacer
**********.***********.
137. spacer 1.19|52921|23|NC_014025|CRT matches to NZ_CP015352 (Bacillus thuringiensis strain MYBT18246 plasmid p142098, complete sequence) position: , mismatch: 2, identity: 0.913
ctaccggagtcactggggctact CRISPR spacer
ctaccggagttactggggctacc Protospacer
**********.***********.
138. spacer 1.19|52921|23|NC_014025|CRT matches to NZ_CP015352 (Bacillus thuringiensis strain MYBT18246 plasmid p142098, complete sequence) position: , mismatch: 2, identity: 0.913
ctaccggagtcactggggctact CRISPR spacer
ctaccggagttactggggctacc Protospacer
**********.***********.
139. spacer 1.19|52921|23|NC_014025|CRT matches to NZ_CP015352 (Bacillus thuringiensis strain MYBT18246 plasmid p142098, complete sequence) position: , mismatch: 2, identity: 0.913
ctaccggagtcactggggctact CRISPR spacer
ctaccggagttactggggctacc Protospacer
**********.***********.
140. spacer 1.19|52921|23|NC_014025|CRT matches to KJ019095 (Synechococcus phage ACG-2014f isolate Syn7803US34, complete genome) position: , mismatch: 2, identity: 0.913
ctaccggagtcactggggctact CRISPR spacer
ctaccggagccactggtgctact Protospacer
*********.****** ******
141. spacer 1.19|52921|23|NC_014025|CRT matches to KJ019086 (Synechococcus phage ACG-2014f isolate Syn7803US17, complete genome) position: , mismatch: 2, identity: 0.913
ctaccggagtcactggggctact CRISPR spacer
ctaccggagccactggtgctact Protospacer
*********.****** ******
142. spacer 1.19|52921|23|NC_014025|CRT matches to KJ019106 (Synechococcus phage ACG-2014f isolate Syn7803US50, complete genome) position: , mismatch: 2, identity: 0.913
ctaccggagtcactggggctact CRISPR spacer
ctaccggagccactggtgctact Protospacer
*********.****** ******
143. spacer 1.19|52921|23|NC_014025|CRT matches to KJ019107 (Synechococcus phage ACG-2014f isolate Syn7803US52, complete genome) position: , mismatch: 2, identity: 0.913
ctaccggagtcactggggctact CRISPR spacer
ctaccggagccactggtgctact Protospacer
*********.****** ******
144. spacer 1.19|52921|23|NC_014025|CRT matches to KJ019143 (Synechococcus phage ACG-2014f isolate Syn7803C12, complete genome) position: , mismatch: 2, identity: 0.913
ctaccggagtcactggggctact CRISPR spacer
ctaccggagccactggtgctact Protospacer
*********.****** ******
145. spacer 1.19|52921|23|NC_014025|CRT matches to KJ019103 (Synechococcus phage ACG-2014f isolate Syn7803US44, complete genome) position: , mismatch: 2, identity: 0.913
ctaccggagtcactggggctact CRISPR spacer
ctaccggagccactggtgctact Protospacer
*********.****** ******
146. spacer 1.19|52921|23|NC_014025|CRT matches to KJ019102 (Synechococcus phage ACG-2014f isolate Syn7803US43, complete genome) position: , mismatch: 2, identity: 0.913
ctaccggagtcactggggctact CRISPR spacer
ctaccggagccactggtgctact Protospacer
*********.****** ******
147. spacer 1.19|52921|23|NC_014025|CRT matches to KJ019066 (Synechococcus phage ACG-2014f isolate Syn7803C9, complete genome) position: , mismatch: 2, identity: 0.913
ctaccggagtcactggggctact CRISPR spacer
ctaccggagccactggtgctact Protospacer
*********.****** ******
148. spacer 1.19|52921|23|NC_014025|CRT matches to KJ019149 (Synechococcus phage ACG-2014f isolate Syn7803C21, complete genome) position: , mismatch: 2, identity: 0.913
ctaccggagtcactggggctact CRISPR spacer
ctaccggagccactggtgctact Protospacer
*********.****** ******
149. spacer 1.19|52921|23|NC_014025|CRT matches to KJ019105 (Synechococcus phage ACG-2014f isolate Syn7803US4, complete genome) position: , mismatch: 2, identity: 0.913
ctaccggagtcactggggctact CRISPR spacer
ctaccggagccactggtgctact Protospacer
*********.****** ******
150. spacer 1.19|52921|23|NC_014025|CRT matches to KJ019098 (Synechococcus phage ACG-2014f isolate Syn7803US39, complete genome) position: , mismatch: 2, identity: 0.913
ctaccggagtcactggggctact CRISPR spacer
ctaccggagccactggtgctact Protospacer
*********.****** ******
151. spacer 1.19|52921|23|NC_014025|CRT matches to KJ019159 (Synechococcus phage ACG-2014f isolate Syn7803C34, complete genome) position: , mismatch: 2, identity: 0.913
ctaccggagtcactggggctact CRISPR spacer
ctaccggagccactggtgctact Protospacer
*********.****** ******
152. spacer 1.19|52921|23|NC_014025|CRT matches to KJ019111 (Synechococcus phage ACG-2014f isolate Syn7803US57, complete genome) position: , mismatch: 2, identity: 0.913
ctaccggagtcactggggctact CRISPR spacer
ctaccggagccactggtgctact Protospacer
*********.****** ******
153. spacer 1.19|52921|23|NC_014025|CRT matches to KJ019148 (Synechococcus phage ACG-2014f isolate Syn7803C19, complete genome) position: , mismatch: 2, identity: 0.913
ctaccggagtcactggggctact CRISPR spacer
ctaccggagccactggtgctact Protospacer
*********.****** ******
154. spacer 1.19|52921|23|NC_014025|CRT matches to NC_047712 (Synechococcus phage ACG-2014f isolate Syn7803C7, complete genome) position: , mismatch: 2, identity: 0.913
ctaccggagtcactggggctact CRISPR spacer
ctaccggagccactggtgctact Protospacer
*********.****** ******
155. spacer 1.19|52921|23|NC_014025|CRT matches to KJ019090 (Synechococcus phage ACG-2014f isolate Syn7803US24, complete genome) position: , mismatch: 2, identity: 0.913
ctaccggagtcactggggctact CRISPR spacer
ctaccggagccactggtgctact Protospacer
*********.****** ******
156. spacer 1.19|52921|23|NC_014025|CRT matches to KJ019146 (Synechococcus phage ACG-2014f isolate Syn7803C16, complete genome) position: , mismatch: 2, identity: 0.913
ctaccggagtcactggggctact CRISPR spacer
ctaccggagccactggtgctact Protospacer
*********.****** ******
157. spacer 1.19|52921|23|NC_014025|CRT matches to KJ019152 (Synechococcus phage ACG-2014f isolate Syn7803C25, complete genome) position: , mismatch: 2, identity: 0.913
ctaccggagtcactggggctact CRISPR spacer
ctaccggagccactggtgctact Protospacer
*********.****** ******
158. spacer 1.19|52921|23|NC_014025|CRT matches to KJ019151 (Synechococcus phage ACG-2014f isolate Syn7803C24, complete genome) position: , mismatch: 2, identity: 0.913
ctaccggagtcactggggctact CRISPR spacer
ctaccggagccactggtgctact Protospacer
*********.****** ******
159. spacer 1.19|52921|23|NC_014025|CRT matches to KJ019150 (Synechococcus phage ACG-2014f isolate Syn7803C22, complete genome) position: , mismatch: 2, identity: 0.913
ctaccggagtcactggggctact CRISPR spacer
ctaccggagccactggtgctact Protospacer
*********.****** ******
160. spacer 1.19|52921|23|NC_014025|CRT matches to NC_026927 (Synechococcus phage ACG-2014f isolate Syn7803C90, complete genome) position: , mismatch: 2, identity: 0.913
ctaccggagtcactggggctact CRISPR spacer
ctaccggagccactggtgctact Protospacer
*********.****** ******
161. spacer 1.19|52921|23|NC_014025|CRT matches to KJ019097 (Synechococcus phage ACG-2014f isolate Syn7803US37, complete genome) position: , mismatch: 2, identity: 0.913
ctaccggagtcactggggctact CRISPR spacer
ctaccggagccactggtgctact Protospacer
*********.****** ******
162. spacer 1.19|52921|23|NC_014025|CRT matches to KJ019045 (Synechococcus phage ACG-2014f isolate Syn7803C6, complete genome) position: , mismatch: 2, identity: 0.913
ctaccggagtcactggggctact CRISPR spacer
ctaccggagccactggtgctact Protospacer
*********.****** ******
163. spacer 1.19|52921|23|NC_014025|CRT matches to KJ019037 (Synechococcus phage ACG-2014f isolate Syn7803C58, complete genome) position: , mismatch: 2, identity: 0.913
ctaccggagtcactggggctact CRISPR spacer
ctaccggagccactggtgctact Protospacer
*********.****** ******
164. spacer 1.19|52921|23|NC_014025|CRT matches to KJ019099 (Synechococcus phage ACG-2014f isolate Syn7803US3, complete genome) position: , mismatch: 2, identity: 0.913
ctaccggagtcactggggctact CRISPR spacer
ctaccggagccactggtgctact Protospacer
*********.****** ******
165. spacer 1.19|52921|23|NC_014025|CRT matches to KJ019155 (Synechococcus phage ACG-2014f isolate Syn7803C29, complete genome) position: , mismatch: 2, identity: 0.913
ctaccggagtcactggggctact CRISPR spacer
ctaccggagccactggtgctact Protospacer
*********.****** ******
166. spacer 1.19|52921|23|NC_014025|CRT matches to KJ019053 (Synechococcus phage ACG-2014f isolate Syn7803C80, complete genome) position: , mismatch: 2, identity: 0.913
ctaccggagtcactggggctact CRISPR spacer
ctaccggagccactggtgctact Protospacer
*********.****** ******
167. spacer 1.19|52921|23|NC_014025|CRT matches to KJ019101 (Synechococcus phage ACG-2014f isolate Syn7803US42, complete genome) position: , mismatch: 2, identity: 0.913
ctaccggagtcactggggctact CRISPR spacer
ctaccggagccactggtgctact Protospacer
*********.****** ******
168. spacer 1.19|52921|23|NC_014025|CRT matches to KJ019085 (Synechococcus phage ACG-2014f isolate Syn7803US13, complete genome) position: , mismatch: 2, identity: 0.913
ctaccggagtcactggggctact CRISPR spacer
ctaccggagccactggtgctact Protospacer
*********.****** ******
169. spacer 1.19|52921|23|NC_014025|CRT matches to KJ019096 (Synechococcus phage ACG-2014f isolate Syn7803US36, complete genome) position: , mismatch: 2, identity: 0.913
ctaccggagtcactggggctact CRISPR spacer
ctaccggagccactggtgctact Protospacer
*********.****** ******
170. spacer 1.19|52921|23|NC_014025|CRT matches to KJ019091 (Synechococcus phage ACG-2014f isolate Syn7803US26, complete genome) position: , mismatch: 2, identity: 0.913
ctaccggagtcactggggctact CRISPR spacer
ctaccggagccactggtgctact Protospacer
*********.****** ******
171. spacer 1.19|52921|23|NC_014025|CRT matches to KJ019144 (Synechococcus phage ACG-2014f isolate Syn7803C14, complete genome) position: , mismatch: 2, identity: 0.913
ctaccggagtcactggggctact CRISPR spacer
ctaccggagccactggtgctact Protospacer
*********.****** ******
172. spacer 1.19|52921|23|NC_014025|CRT matches to KJ019145 (Synechococcus phage ACG-2014f isolate Syn7803C15, complete genome) position: , mismatch: 2, identity: 0.913
ctaccggagtcactggggctact CRISPR spacer
ctaccggagccactggtgctact Protospacer
*********.****** ******
173. spacer 1.19|52921|23|NC_014025|CRT matches to KJ019092 (Synechococcus phage ACG-2014f isolate Syn7803US2, complete genome) position: , mismatch: 2, identity: 0.913
ctaccggagtcactggggctact CRISPR spacer
ctaccggagccactggtgctact Protospacer
*********.****** ******
174. spacer 1.19|52921|23|NC_014025|CRT matches to CP011076 (Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.913
ctaccggagtcactggggctact CRISPR spacer
ctaccggagacactggcgctact Protospacer
********* ****** ******
175. spacer 1.19|52921|23|NC_014025|CRT matches to CP011076 (Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.913
ctaccggagtcactggggctact CRISPR spacer
ctaccggagacactggcgctact Protospacer
********* ****** ******
176. spacer 1.19|52921|23|NC_014025|CRT matches to CP011076 (Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.913
ctaccggagtcactggggctact CRISPR spacer
ctaccggagacactggcgctact Protospacer
********* ****** ******
177. spacer 1.19|52921|23|NC_014025|CRT matches to CP011076 (Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.913
ctaccggagtcactggggctact CRISPR spacer
ctaccggagacactggcgctact Protospacer
********* ****** ******
178. spacer 1.19|52921|23|NC_014025|CRT matches to CP011075 (Brevibacillus laterosporus strain B9 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.913
ctaccggagtcactggggctact CRISPR spacer
ctaccggagacactggtgctact Protospacer
********* ****** ******
179. spacer 1.19|52921|23|NC_014025|CRT matches to CP011075 (Brevibacillus laterosporus strain B9 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.913
ctaccggagtcactggggctact CRISPR spacer
ctaccggagacactggcgctact Protospacer
********* ****** ******
180. spacer 1.20|52966|32|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.938
tgacaggagccactggagctaccggagttact CRISPR spacer
tgacaggagccactggagctaccggaatcact Protospacer
**************************.*.***
181. spacer 1.20|52966|32|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.938
tgacaggagccactggagctaccggagttact CRISPR spacer
tgacaggagccactggagctaccggaatcact Protospacer
**************************.*.***
182. spacer 1.20|52966|32|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.938
tgacaggagccactggagctaccggagttact CRISPR spacer
tgacaggagccactggagctactggagtcact Protospacer
**********************.*****.***
183. spacer 1.20|52966|32|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.938
tgacaggagccactggagctaccggagttact CRISPR spacer
tgacaggagccactggagctaccggaatcact Protospacer
**************************.*.***
184. spacer 1.21|53020|41|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.951
tcactggagttactggaattaccggagttactggagtgact CRISPR spacer
ttaccggagttactggaattaccggagttactggagtgact Protospacer
*.**.************************************
185. spacer 1.21|53020|41|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.951
tcactggagttactggaattaccggagttactggagtgact CRISPR spacer
ttaccggagttactggaattaccggagttactggagtgact Protospacer
*.**.************************************
186. spacer 1.22|53083|32|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.938
tgacaggagccactggagctaccggagttact CRISPR spacer
tgacaggagccactggagctaccggaatcact Protospacer
**************************.*.***
187. spacer 1.22|53083|32|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.938
tgacaggagccactggagctaccggagttact CRISPR spacer
tgacaggagccactggagctaccggaatcact Protospacer
**************************.*.***
188. spacer 1.22|53083|32|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.938
tgacaggagccactggagctaccggagttact CRISPR spacer
tgacaggagccactggagctactggagtcact Protospacer
**********************.*****.***
189. spacer 1.22|53083|32|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.938
tgacaggagccactggagctaccggagttact CRISPR spacer
tgacaggagccactggagctaccggaatcact Protospacer
**************************.*.***
190. spacer 1.23|53137|41|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.951
tcactggagttactggaattaccggagttactggagtgact CRISPR spacer
ttaccggagttactggaattaccggagttactggagtgact Protospacer
*.**.************************************
191. spacer 1.23|53137|41|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.951
tcactggagttactggaattaccggagttactggagtgact CRISPR spacer
ttaccggagttactggaattaccggagttactggagtgact Protospacer
*.**.************************************
192. spacer 1.25|53272|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913
tgactggagctaccggaatcact CRISPR spacer
ccactggagctaccggaatcact Protospacer
. *********************
193. spacer 1.25|53272|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913
tgactggagctaccggaatcact CRISPR spacer
ccactggagctaccggaatcact Protospacer
. *********************
194. spacer 1.25|53272|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913
tgactggagctaccggaatcact CRISPR spacer
ctactggagctaccggaatcact Protospacer
. *********************
195. spacer 1.25|53272|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913
tgactggagctaccggaatcact CRISPR spacer
ctactggagctaccggaatcact Protospacer
. *********************
196. spacer 1.25|53272|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913
tgactggagctaccggaatcact CRISPR spacer
ctactggagctaccggaatcact Protospacer
. *********************
197. spacer 1.25|53272|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913
tgactggagctaccggaatcact CRISPR spacer
ccactggagctaccggaatcact Protospacer
. *********************
198. spacer 1.25|53272|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913
tgactggagctaccggaatcact CRISPR spacer
ctactggagctaccggaatcact Protospacer
. *********************
199. spacer 1.25|53272|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913
tgactggagctaccggaatcact CRISPR spacer
tcacgggagctaccggaatcact Protospacer
* ** ******************
200. spacer 1.25|53272|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913
tgactggagctaccggaatcact CRISPR spacer
tcactggagctactggaatcact Protospacer
* ***********.*********
201. spacer 1.25|53272|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913
tgactggagctaccggaatcact CRISPR spacer
tcactggagctaccggagtcact Protospacer
* ***************.*****
202. spacer 1.25|53272|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913
tgactggagctaccggaatcact CRISPR spacer
tcacgggagctaccggaatcact Protospacer
* ** ******************
203. spacer 1.25|53272|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913
tgactggagctaccggaatcact CRISPR spacer
tcactggagctactggaatcact Protospacer
* ***********.*********
204. spacer 1.25|53272|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913
tgactggagctaccggaatcact CRISPR spacer
tcactggagctaccgggatcact Protospacer
* **************.******
205. spacer 1.25|53272|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913
tgactggagctaccggaatcact CRISPR spacer
tcactggagctaccggagtcact Protospacer
* ***************.*****
206. spacer 1.25|53272|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913
tgactggagctaccggaatcact CRISPR spacer
tcactggagctaccgggatcact Protospacer
* **************.******
207. spacer 1.25|53272|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913
tgactggagctaccggaatcact CRISPR spacer
tcactggagctaccggagtcact Protospacer
* ***************.*****
208. spacer 1.25|53272|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913
tgactggagctaccggaatcact CRISPR spacer
tcacgggagctaccggaatcact Protospacer
* ** ******************
209. spacer 1.25|53272|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913
tgactggagctaccggaatcact CRISPR spacer
tcacgggagctaccggaatcact Protospacer
* ** ******************
210. spacer 1.25|53272|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 2, identity: 0.913
tgactggagctaccggaatcact CRISPR spacer
tcactggagctaccggagtcact Protospacer
* ***************.*****
211. spacer 1.13|52597|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 3, identity: 0.87
tcactggagtcactggagctacc CRISPR spacer
ctactggagtcactggagctact Protospacer
..********************.
212. spacer 1.13|52597|23|NC_014025|CRT matches to NC_013085 (Synechococcus phage S-RSM4, complete genome) position: , mismatch: 3, identity: 0.87
tcactggagtcactggagctacc CRISPR spacer
acacaggagtcactggagctact Protospacer
*** *****************.
213. spacer 1.13|52597|23|NC_014025|CRT matches to FM207411 (Synechococcus phage S-RSM4 complete genome) position: , mismatch: 3, identity: 0.87
tcactggagtcactggagctacc CRISPR spacer
acacaggagtcactggagctact Protospacer
*** *****************.
214. spacer 1.16|52786|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 3, identity: 0.87
ttactggagctaccggagtcacg CRISPR spacer
ctactggagctaccggaatcact Protospacer
.****************.****
215. spacer 1.16|52786|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 3, identity: 0.87
ttactggagctaccggagtcacg CRISPR spacer
ctactggagctaccggaatcact Protospacer
.****************.****
216. spacer 1.16|52786|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 3, identity: 0.87
ttactggagctaccggagtcacg CRISPR spacer
ctactggagctaccggaatcact Protospacer
.****************.****
217. spacer 1.16|52786|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 3, identity: 0.87
ttactggagctaccggagtcacg CRISPR spacer
ctactggagctaccggaatcact Protospacer
.****************.****
218. spacer 1.17|52831|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 3, identity: 0.87
ctaccggaatcactggagctact CRISPR spacer
tcactggaatcactggagctact Protospacer
..**.******************
219. spacer 1.17|52831|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 3, identity: 0.87
ctaccggaatcactggagctact CRISPR spacer
tcactggaatcactggagctact Protospacer
..**.******************
220. spacer 1.18|52876|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 3, identity: 0.87
ttactggagctaccggagtcacg CRISPR spacer
ctactggagctaccggaatcact Protospacer
.****************.****
221. spacer 1.18|52876|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 3, identity: 0.87
ttactggagctaccggagtcacg CRISPR spacer
ctactggagctaccggaatcact Protospacer
.****************.****
222. spacer 1.18|52876|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 3, identity: 0.87
ttactggagctaccggagtcacg CRISPR spacer
ctactggagctaccggaatcact Protospacer
.****************.****
223. spacer 1.18|52876|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 3, identity: 0.87
ttactggagctaccggagtcacg CRISPR spacer
ctactggagctaccggaatcact Protospacer
.****************.****
224. spacer 1.19|52921|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 3, identity: 0.87
ctaccggagtcactggggctact CRISPR spacer
tgactggagtcactggggctact Protospacer
. **.******************
225. spacer 1.20|52966|32|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 3, identity: 0.906
tgacaggagccactggagctaccggagttact CRISPR spacer
tcactggagtcactggagctaccggagttact Protospacer
* ** ****.**********************
226. spacer 1.22|53083|32|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 3, identity: 0.906
tgacaggagccactggagctaccggagttact CRISPR spacer
tcactggagtcactggagctaccggagttact Protospacer
* ** ****.**********************
227. spacer 1.25|53272|23|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 3, identity: 0.87
tgactggagctaccggaatcact CRISPR spacer
ctaccggagctaccggaatcact Protospacer
. **.******************
228. spacer 1.10|52354|41|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 5, identity: 0.878
tcactggagctaccgggatcactggagctaccggagtcact CRISPR spacer
tcactggagctaccggaatcactggagctactggagctacc Protospacer
****************.**************.****..**.
229. spacer 1.15|52723|41|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 5, identity: 0.878
ctactggagttaccggagtcacgggagctaccggagctacc CRISPR spacer
tcactggagctaccggagtcacgggagctaccggagttact Protospacer
..*******.**************************.***.
230. spacer 1.20|52966|32|NC_014025|CRT matches to NC_014172 (Bacillus thuringiensis BMB171 plasmid pBMB171, complete sequence) position: , mismatch: 5, identity: 0.844
tgacaggagccactggagctaccggagttact CRISPR spacer
ctacaggagccactggttctaccggagttaca Protospacer
. ************** *************
231. spacer 1.20|52966|32|NC_014025|CRT matches to NC_011777 (Bacillus cereus AH820 plasmid pAH820_272, complete sequence) position: , mismatch: 5, identity: 0.844
tgacaggagccactggagctaccggagttact CRISPR spacer
ctacaggagccactggttctaccggagttaca Protospacer
. ************** *************
232. spacer 1.20|52966|32|NC_014025|CRT matches to NC_011777 (Bacillus cereus AH820 plasmid pAH820_272, complete sequence) position: , mismatch: 5, identity: 0.844
tgacaggagccactggagctaccggagttact CRISPR spacer
ctacaggagccactggttctaccggagttaca Protospacer
. ************** *************
233. spacer 1.22|53083|32|NC_014025|CRT matches to NC_014172 (Bacillus thuringiensis BMB171 plasmid pBMB171, complete sequence) position: , mismatch: 5, identity: 0.844
tgacaggagccactggagctaccggagttact CRISPR spacer
ctacaggagccactggttctaccggagttaca Protospacer
. ************** *************
234. spacer 1.22|53083|32|NC_014025|CRT matches to NC_011777 (Bacillus cereus AH820 plasmid pAH820_272, complete sequence) position: , mismatch: 5, identity: 0.844
tgacaggagccactggagctaccggagttact CRISPR spacer
ctacaggagccactggttctaccggagttaca Protospacer
. ************** *************
235. spacer 1.22|53083|32|NC_014025|CRT matches to NC_011777 (Bacillus cereus AH820 plasmid pAH820_272, complete sequence) position: , mismatch: 5, identity: 0.844
tgacaggagccactggagctaccggagttact CRISPR spacer
ctacaggagccactggttctaccggagttaca Protospacer
. ************** *************
236. spacer 1.10|52354|41|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 6, identity: 0.854
tcactggagctaccgggatcactggagctaccggagtcact CRISPR spacer
ccactggagctaccggaatcactggagctactggagctacc Protospacer
.***************.**************.****..**.
237. spacer 1.10|52354|41|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 6, identity: 0.854
tcactggagctaccgggatcactggagctaccggagtcact CRISPR spacer
ccactggagctaccggaatcactggagctactggagctacc Protospacer
.***************.**************.****..**.
238. spacer 1.15|52723|41|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 6, identity: 0.854
ctactggagttaccggagtcacgggagctaccggagctacc CRISPR spacer
tgactggagttaccggagtcacgggagctaccggaatcact Protospacer
. *********************************...**.
239. spacer 1.15|52723|41|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 6, identity: 0.854
ctactggagttaccggagtcacgggagctaccggagctacc CRISPR spacer
tgactggagttaccggagtcacgggagctaccggaatcact Protospacer
. *********************************...**.
240. spacer 1.15|52723|41|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 6, identity: 0.854
ctactggagttaccggagtcacgggagctaccggagctacc CRISPR spacer
ttactggagctaccggagtcacgggagctaccggaatcact Protospacer
.********.*************************...**.
241. spacer 1.15|52723|41|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 6, identity: 0.854
ctactggagttaccggagtcacgggagctaccggagctacc CRISPR spacer
ttactggagctaccggagtcacgggagctaccggaatcact Protospacer
.********.*************************...**.
242. spacer 1.20|52966|32|NC_014025|CRT matches to NC_014172 (Bacillus thuringiensis BMB171 plasmid pBMB171, complete sequence) position: , mismatch: 6, identity: 0.812
tgacaggagccactggagctaccggagttact CRISPR spacer
ttacaggacctactggagctaccggaacaact Protospacer
* ****** *.***************.. ***
243. spacer 1.20|52966|32|NC_014025|CRT matches to NC_011777 (Bacillus cereus AH820 plasmid pAH820_272, complete sequence) position: , mismatch: 6, identity: 0.812
tgacaggagccactggagctaccggagttact CRISPR spacer
ttacaggacctactggagctaccggaacaact Protospacer
* ****** *.***************.. ***
244. spacer 1.20|52966|32|NC_014025|CRT matches to NC_011777 (Bacillus cereus AH820 plasmid pAH820_272, complete sequence) position: , mismatch: 6, identity: 0.812
tgacaggagccactggagctaccggagttact CRISPR spacer
ttacaggacctactggagctaccggaacaact Protospacer
* ****** *.***************.. ***
245. spacer 1.20|52966|32|NC_014025|CRT matches to NC_011777 (Bacillus cereus AH820 plasmid pAH820_272, complete sequence) position: , mismatch: 6, identity: 0.812
tgacaggagccactggagctaccggagttact CRISPR spacer
ttacaggacctactggagctaccggaacaact Protospacer
* ****** *.***************.. ***
246. spacer 1.20|52966|32|NC_014025|CRT matches to NZ_CP016317 (Bacillus cereus strain M3 plasmid pBCM301, complete sequence) position: , mismatch: 6, identity: 0.812
tgacaggagccactggagctaccggagttact CRISPR spacer
ttacaggacctactggagctaccggaacaact Protospacer
* ****** *.***************.. ***
247. spacer 1.22|53083|32|NC_014025|CRT matches to NC_014172 (Bacillus thuringiensis BMB171 plasmid pBMB171, complete sequence) position: , mismatch: 6, identity: 0.812
tgacaggagccactggagctaccggagttact CRISPR spacer
ttacaggacctactggagctaccggaacaact Protospacer
* ****** *.***************.. ***
248. spacer 1.22|53083|32|NC_014025|CRT matches to NC_011777 (Bacillus cereus AH820 plasmid pAH820_272, complete sequence) position: , mismatch: 6, identity: 0.812
tgacaggagccactggagctaccggagttact CRISPR spacer
ttacaggacctactggagctaccggaacaact Protospacer
* ****** *.***************.. ***
249. spacer 1.22|53083|32|NC_014025|CRT matches to NC_011777 (Bacillus cereus AH820 plasmid pAH820_272, complete sequence) position: , mismatch: 6, identity: 0.812
tgacaggagccactggagctaccggagttact CRISPR spacer
ttacaggacctactggagctaccggaacaact Protospacer
* ****** *.***************.. ***
250. spacer 1.22|53083|32|NC_014025|CRT matches to NC_011777 (Bacillus cereus AH820 plasmid pAH820_272, complete sequence) position: , mismatch: 6, identity: 0.812
tgacaggagccactggagctaccggagttact CRISPR spacer
ttacaggacctactggagctaccggaacaact Protospacer
* ****** *.***************.. ***
251. spacer 1.22|53083|32|NC_014025|CRT matches to NZ_CP016317 (Bacillus cereus strain M3 plasmid pBCM301, complete sequence) position: , mismatch: 6, identity: 0.812
tgacaggagccactggagctaccggagttact CRISPR spacer
ttacaggacctactggagctaccggaacaact Protospacer
* ****** *.***************.. ***
252. spacer 1.20|52966|32|NC_014025|CRT matches to MN204498 (Streptomyces phage Saftant, complete genome) position: , mismatch: 7, identity: 0.781
tgacaggagccactggagctaccggagttact CRISPR spacer
cgacaggagccactggcgctaccggcccggct Protospacer
.*************** ******** . .**
253. spacer 1.22|53083|32|NC_014025|CRT matches to MN204498 (Streptomyces phage Saftant, complete genome) position: , mismatch: 7, identity: 0.781
tgacaggagccactggagctaccggagttact CRISPR spacer
cgacaggagccactggcgctaccggcccggct Protospacer
.*************** ******** . .**
254. spacer 1.9|52264|68|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 8, identity: 0.882
tcactggagtgacaggagccactggagctaccggaatcactggagctactggagctaccg CRISPR spacer
tcactggagtgacaggagccactggagctaccggaatcactggagctactggagctaccg Protospacer
************************************************************
255. spacer 1.9|52264|68|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 8, identity: 0.882
tcactggagtgacaggagccactggagctaccggaatcactggagctactggagctaccg CRISPR spacer
tcactggagtgacaggagccactggagctaccggaatcactggagctactggagctaccg Protospacer
************************************************************
256. spacer 1.11|52417|68|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 8, identity: 0.882
tcacgggagctaccggagctaccggaatcactggagctaccgggatcactggagctaccg CRISPR spacer
tcacgggagctaccggagctaccggaatcactggagctaccgggatcactggagctaccg Protospacer
************************************************************
257. spacer 1.12|52507|68|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 8, identity: 0.882
tcacgggagctaccggagctaccggagttaccggaatcactggagtcactggagtcacgg CRISPR spacer
tcacgggagctaccggagctaccggagttaccggaatcactggagtcactggagtcacgg Protospacer
************************************************************
258. spacer 1.20|52966|32|NC_014025|CRT matches to MN224566 (Mycobacterium phage Herbertwm, complete genome) position: , mismatch: 8, identity: 0.75
tgacaggagccactggagctaccggagttact CRISPR spacer
acactggagccaccggagctaccggagccaag Protospacer
** ********.*************..*
259. spacer 1.20|52966|32|NC_014025|CRT matches to AP013956 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5F-MedDCM-OCT-S27-C232, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.75
tgacaggagccactggagctaccggagttact CRISPR spacer
caacaggagacactggagctacaggtgcaacc Protospacer
..******* ************ ** *. **.
260. spacer 1.20|52966|32|NC_014025|CRT matches to AP013963 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5F-MedDCM-OCT-S38-C146, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.75
tgacaggagccactggagctaccggagttact CRISPR spacer
caacaggagacactggagctacaggtgcaacc Protospacer
..******* ************ ** *. **.
261. spacer 1.20|52966|32|NC_014025|CRT matches to AP013959 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5F-MedDCM-OCT-S31-C107, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.75
tgacaggagccactggagctaccggagttact CRISPR spacer
caacaggagacactggagctacaggtgcaacc Protospacer
..******* ************ ** *. **.
262. spacer 1.20|52966|32|NC_014025|CRT matches to AP013565 (Uncultured Mediterranean phage uvMED isolate uvMED-CGR-C5F-MedDCM-OCT-S40-C10, *** SEQUENCING IN PROGRESS ***, 2 ordered pieces) position: , mismatch: 8, identity: 0.75
tgacaggagccactggagctaccggagttact CRISPR spacer
caacaggagacactggagctacaggtgcaacc Protospacer
..******* ************ ** *. **.
263. spacer 1.20|52966|32|NC_014025|CRT matches to AP013961 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5F-MedDCM-OCT-S34-C156, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.75
tgacaggagccactggagctaccggagttact CRISPR spacer
caacaggagacactggagctacaggtgcaacc Protospacer
..******* ************ ** *. **.
264. spacer 1.22|53083|32|NC_014025|CRT matches to MN224566 (Mycobacterium phage Herbertwm, complete genome) position: , mismatch: 8, identity: 0.75
tgacaggagccactggagctaccggagttact CRISPR spacer
acactggagccaccggagctaccggagccaag Protospacer
** ********.*************..*
265. spacer 1.22|53083|32|NC_014025|CRT matches to AP013956 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5F-MedDCM-OCT-S27-C232, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.75
tgacaggagccactggagctaccggagttact CRISPR spacer
caacaggagacactggagctacaggtgcaacc Protospacer
..******* ************ ** *. **.
266. spacer 1.22|53083|32|NC_014025|CRT matches to AP013963 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5F-MedDCM-OCT-S38-C146, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.75
tgacaggagccactggagctaccggagttact CRISPR spacer
caacaggagacactggagctacaggtgcaacc Protospacer
..******* ************ ** *. **.
267. spacer 1.22|53083|32|NC_014025|CRT matches to AP013959 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5F-MedDCM-OCT-S31-C107, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.75
tgacaggagccactggagctaccggagttact CRISPR spacer
caacaggagacactggagctacaggtgcaacc Protospacer
..******* ************ ** *. **.
268. spacer 1.22|53083|32|NC_014025|CRT matches to AP013565 (Uncultured Mediterranean phage uvMED isolate uvMED-CGR-C5F-MedDCM-OCT-S40-C10, *** SEQUENCING IN PROGRESS ***, 2 ordered pieces) position: , mismatch: 8, identity: 0.75
tgacaggagccactggagctaccggagttact CRISPR spacer
caacaggagacactggagctacaggtgcaacc Protospacer
..******* ************ ** *. **.
269. spacer 1.22|53083|32|NC_014025|CRT matches to AP013961 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5F-MedDCM-OCT-S34-C156, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.75
tgacaggagccactggagctaccggagttact CRISPR spacer
caacaggagacactggagctacaggtgcaacc Protospacer
..******* ************ ** *. **.
270. spacer 1.9|52264|68|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 9, identity: 0.868
tcactggagtgacaggagccactggagctaccggaatcactggagctactggagctaccg CRISPR spacer
tcactggagtgacaggagccactggagctaccggaatcactggagctactggagctactg Protospacer
**********************************************************.*
271. spacer 1.24|53200|50|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 9, identity: 0.82
tgacaggagccactggagctaccggaatcactggagctactggagctact CRISPR spacer
ctaccgggatcactggagctaccggagtcactggagctactggagttacc Protospacer
. ** **...****************.******************.***.
272. spacer 1.3|51706|77|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 17, identity: 0.779
ttaccggagtcacgggagttactggaatcactggagtcactggagtgactggagttaccg CRISPR spacer
ttaccggagtcacgggagttactggaatcactggagtcactggagtgactggagttaccg Protospacer
************************************************************
273. spacer 1.4|51805|77|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 17, identity: 0.779
aaactggagttactggagaaacgggagctaccggagtcactggaatcactggagctactg CRISPR spacer
aaactggagttactggagaaacgggagctaccggagtcactggaatcactggagctactg Protospacer
************************************************************
274. spacer 1.4|51805|77|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 17, identity: 0.779
aaactggagttactggagaaacgggagctaccggagtcactggaatcactggagctactg CRISPR spacer
aaactggagttactggagaaacgggagctaccggagtcactggaatcactggagctactg Protospacer
************************************************************
275. spacer 1.5|51904|77|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 17, identity: 0.779
tcactggagtgactggagttaccggagtcacgggagctaccggaatcactggagttactg CRISPR spacer
tcactggagtgactggagttaccggagtcacgggagctaccggaatcactggagttactg Protospacer
************************************************************
276. spacer 1.5|51904|77|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 17, identity: 0.779
tcactggagtgactggagttaccggagtcacgggagctaccggaatcactggagttactg CRISPR spacer
tcactggagtgactggagttaccggagtcacgggagctaccggaatcactggagttactg Protospacer
************************************************************
277. spacer 1.7|52084|77|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 17, identity: 0.779
ttactggaattaccggagttactggaattaccggagttactggagtgactggagttaccg CRISPR spacer
ttactggaattaccggagttactggaattaccggagttactggagtgactggagttaccg Protospacer
************************************************************
278. spacer 1.7|52084|77|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 19, identity: 0.753
ttactggaattaccggagttactggaattaccggagttactggagtgactggagttaccg CRISPR spacer
ctaccggaattaccggagttactggaattaccggagttactggagtgactggagttaccg Protospacer
.***.*******************************************************
279. spacer 1.1|51481|86|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 26, identity: 0.698
tcactggggctactggagcaacgggagctaccggagtcactggagctactggagctactg CRISPR spacer
tcactggggctactggagcaacgggagctaccggagtcactggagctactggagctactg Protospacer
************************************************************
280. spacer 1.2|51589|95|NC_014025|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 35, identity: 0.632
tcactggagctactggaattactggaattactggaattaccggagtcactggggctactg CRISPR spacer
tcactggagctactggaattactggaattactggaattaccggagtcactggggctactg Protospacer
************************************************************