Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_014011 Aminobacterium colombiense DSM 12261, complete sequence 2 crisprs cas2,cas1,cas5,cas7,cas8b3,cas3,cas6,DinG,WYL,DEDDh 0 3 3 0

Results visualization

1. NC_014011
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014011_1 112500-114959 Unclear I-A,I-B,II-B
34 spacers
cas2,cas1,cas5,cas7,cas8b3,cas3,cas6

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014011_2 1231516-1231627 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_014011_1 1.9|113103|34|NC_014011|CRISPRCasFinder,CRT,PILER-CR 113103-113136 34 MG945220 UNVERIFIED: Microviridae sp. isolate 1190-1602, partial genome 3506-3539 5 0.853
NC_014011_1 1.9|113103|34|NC_014011|CRISPRCasFinder,CRT,PILER-CR 113103-113136 34 MH992213 Apis mellifera associated microvirus 15 isolate INH_SP_268, complete genome 3002-3035 8 0.765
NC_014011_1 1.18|113745|35|NC_014011|CRISPRCasFinder,CRT,PILER-CR 113745-113779 35 AP013580 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C16-MedDCM-OCT-S43-C44, *** SEQUENCING IN PROGRESS *** 21319-21353 8 0.771
NC_014011_1 1.11|113244|34|NC_014011|CRISPRCasFinder,CRT,PILER-CR 113244-113277 34 NC_019740 Microcoleus sp. PCC 7113 plasmid pMIC7113.03, complete sequence 18029-18062 9 0.735

1. spacer 1.9|113103|34|NC_014011|CRISPRCasFinder,CRT,PILER-CR matches to MG945220 (UNVERIFIED: Microviridae sp. isolate 1190-1602, partial genome) position: , mismatch: 5, identity: 0.853

atactctc-cttgccgctcttaaggctgctggact	CRISPR spacer
-tgttctcacttgccgctcttgaggctgctggaat	Protospacer
 *..**** ************.*********** *

2. spacer 1.9|113103|34|NC_014011|CRISPRCasFinder,CRT,PILER-CR matches to MH992213 (Apis mellifera associated microvirus 15 isolate INH_SP_268, complete genome) position: , mismatch: 8, identity: 0.765

atactctccttgccgctcttaaggctgctggact	CRISPR spacer
aacgtcgtgttgccgatcttaaggctgctggtct	Protospacer
*   ** . ****** *************** **

3. spacer 1.18|113745|35|NC_014011|CRISPRCasFinder,CRT,PILER-CR matches to AP013580 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C16-MedDCM-OCT-S43-C44, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.771

-gtaattaacatctacgtcttttacttttccacctg	CRISPR spacer
tgcga-aaacatcttcgtcttttactgttccatcag	Protospacer
 *..*  ******* *********** *****.* *

4. spacer 1.11|113244|34|NC_014011|CRISPRCasFinder,CRT,PILER-CR matches to NC_019740 (Microcoleus sp. PCC 7113 plasmid pMIC7113.03, complete sequence) position: , mismatch: 9, identity: 0.735

ctgttagtgattccaaccaattcccccaccactg	CRISPR spacer
gcggtaaatgttccaaccaatgccccaaccactg	Protospacer
 .* **.  .*********** **** *******

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1033694 : 1041469 7 Staphylococcus_phage(50.0%) tRNA NA
DBSCAN-SWA_2 1111367 : 1190872 92 Vibrio_phage(28.21%) integrase,protease,terminase,head,tail,tRNA,plate,portal attL 1131055:1131077|attR 1170131:1170153
DBSCAN-SWA_3 1828396 : 1836521 9 Planktothrix_phage(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage