Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_014008 Coraliomargarita akajimensis DSM 45221, complete sequence 9 crisprs DEDDh,DinG,csa3,Cas9_archaeal,cas3 2 0 1 0

Results visualization

1. NC_014008
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014008_1 339795-339934 Orphan NA
1 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014008_2 389686-389799 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014008_3 423675-423765 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014008_4 900463-900586 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014008_5 1695901-1695995 Orphan NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014008_6 1890287-1890408 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014008_7 3328028-3328174 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014008_8 3613321-3613476 Unclear NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014008_9 3719513-3719648 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_014008_5 5.1|1695924|49|NC_014008|CRISPRCasFinder 1695924-1695972 49 NC_014008.1 3053168-3053216 1 0.98
NC_014008_7 7.1|3328079|45|NC_014008|CRISPRCasFinder 3328079-3328123 45 NC_014008.1 3321814-3321858 2 0.956
NC_014008_7 7.1|3328079|45|NC_014008|CRISPRCasFinder 3328079-3328123 45 NC_014008.1 3326885-3326929 2 0.956
NC_014008_7 7.1|3328079|45|NC_014008|CRISPRCasFinder 3328079-3328123 45 NC_014008.1 3336543-3336587 2 0.956

1. spacer 5.1|1695924|49|NC_014008|CRISPRCasFinder matches to position: 3053168-3053216, mismatch: 1, identity: 0.98

tttaactttcacttgatccggttcgcttcgcgcccggtcatgtcgtcgc	CRISPR spacer
tttcactttcacttgatccggttcgcttcgcgcccggtcatgtcgtcgc	Protospacer
*** *********************************************

2. spacer 7.1|3328079|45|NC_014008|CRISPRCasFinder matches to position: 3321814-3321858, mismatch: 2, identity: 0.956

aagcgtaggatgagtgagcgggtgccctctgagcagcaaacgaac	CRISPR spacer
aagcgtagggtgagtgagcgggtgccctctgggcagcaaacgaac	Protospacer
*********.*********************.*************

3. spacer 7.1|3328079|45|NC_014008|CRISPRCasFinder matches to position: 3326885-3326929, mismatch: 2, identity: 0.956

aagcgtaggatgagtgagcgggtgccctctgagcagcaaacgaac	CRISPR spacer
aagcgtagggtgagtgagcgggtgccctctgggcagcaaacgaac	Protospacer
*********.*********************.*************

4. spacer 7.1|3328079|45|NC_014008|CRISPRCasFinder matches to position: 3336543-3336587, mismatch: 2, identity: 0.956

aagcgtaggatgagtgagcgggtgccctctgagcagcaaacgaac	CRISPR spacer
aagcgtagggtgagtgagcgggtgccctctgggcagcaaacgaac	Protospacer
*********.*********************.*************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1508870 : 1517630 9 uncultured_Caudovirales_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage