Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_008014 Lawsonia intracellularis PHE/MN1-00 plasmid 3, complete sequence 0 crisprs NA 0 0 1 0
NC_008012 Lawsonia intracellularis PHE/MN1-00 plasmid 1, complete sequence 0 crisprs NA 0 0 0 0
NC_008011 Lawsonia intracellularis PHE/MN1-00, complete genome 2 crisprs NA 0 0 3 0
NC_008013 Lawsonia intracellularis PHE/MN1-00 plasmid 2, complete sequence 1 crisprs NA 0 2 0 0

Results visualization

1. NC_008011
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_008011_1 93380-93478 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_008011_2 698545-698685 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 185905 : 201646 15 Staphylococcus_phage(36.36%) tRNA NA
DBSCAN-SWA_2 707510 : 714246 7 Erysipelothrix_phage(16.67%) NA NA
DBSCAN-SWA_3 1029762 : 1037198 8 Mycoplasma_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_008014
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 121982 : 144823 25 uncultured_Caudovirales_phage(25.0%) protease,head,plate,tail NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NC_008013
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_008013_1 6721-6896 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_008013_1 1.1|6747|52|NC_008013|CRISPRCasFinder 6747-6798 52 NC_008013 Lawsonia intracellularis PHE/MN1-00 plasmid 2, complete sequence 6747-6798 0 1.0
NC_008013_1 1.1|6747|52|NC_008013|CRISPRCasFinder 6747-6798 52 NC_020129 Lawsonia intracellularis N343 plasmid 2, complete sequence 6787-6838 0 1.0
NC_008013_1 1.2|6825|46|NC_008013|CRISPRCasFinder 6825-6870 46 NC_008013 Lawsonia intracellularis PHE/MN1-00 plasmid 2, complete sequence 6825-6870 0 1.0
NC_008013_1 1.2|6825|46|NC_008013|CRISPRCasFinder 6825-6870 46 NC_020129 Lawsonia intracellularis N343 plasmid 2, complete sequence 6865-6910 0 1.0

1. spacer 1.1|6747|52|NC_008013|CRISPRCasFinder matches to NC_008013 (Lawsonia intracellularis PHE/MN1-00 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

gccactattaatgattacagaggcattctcagttactccaagtccattgaag	CRISPR spacer
gccactattaatgattacagaggcattctcagttactccaagtccattgaag	Protospacer
****************************************************

2. spacer 1.1|6747|52|NC_008013|CRISPRCasFinder matches to NC_020129 (Lawsonia intracellularis N343 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

gccactattaatgattacagaggcattctcagttactccaagtccattgaag	CRISPR spacer
gccactattaatgattacagaggcattctcagttactccaagtccattgaag	Protospacer
****************************************************

3. spacer 1.2|6825|46|NC_008013|CRISPRCasFinder matches to NC_008013 (Lawsonia intracellularis PHE/MN1-00 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

actatcagtaacagttgctgtagttgatattgtatgaccttcgaca	CRISPR spacer
actatcagtaacagttgctgtagttgatattgtatgaccttcgaca	Protospacer
**********************************************

4. spacer 1.2|6825|46|NC_008013|CRISPRCasFinder matches to NC_020129 (Lawsonia intracellularis N343 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

actatcagtaacagttgctgtagttgatattgtatgaccttcgaca	CRISPR spacer
actatcagtaacagttgctgtagttgatattgtatgaccttcgaca	Protospacer
**********************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage