Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_010399 Clavibacter michiganensis subsp. sepedonicus plasmid pCS1, complete sequence 0 crisprs NA 0 0 0 0
NC_010407 Clavibacter michiganensis subsp. sepedonicus, complete genome 2 crisprs WYL,csa3,DEDDh,cas3,PD-DExK 2 9 8 1
NC_010408 Clavibacter michiganensis subsp. sepedonicus plasmid pCSL1, complete sequence 1 crisprs NA 0 1 0 0

Results visualization

1. NC_010407
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_010407_1 1303030-1303412 Orphan NA
6 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_010407_2 2327869-2328020 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NC_010407.1 2357656-2357677 2 0.909
NC_010407_2 2.3|2327979|19|NC_010407|CRISPRCasFinder 2327979-2327997 19 NC_010407.1 1267143-1267161 2 0.895
NC_010407_2 2.3|2327979|19|NC_010407|CRISPRCasFinder 2327979-2327997 19 NC_010407.1 1355407-1355425 2 0.895
NC_010407_2 2.3|2327979|19|NC_010407|CRISPRCasFinder 2327979-2327997 19 NC_010407.1 1838345-1838363 6 0.684
NC_010407_2 2.3|2327979|19|NC_010407|CRISPRCasFinder 2327979-2327997 19 NC_010407.1 1860644-1860662 2 0.895
NC_010407_2 2.3|2327979|19|NC_010407|CRISPRCasFinder 2327979-2327997 19 NC_010407.1 2142850-2142868 2 0.895
NC_010407_2 2.3|2327979|19|NC_010407|CRISPRCasFinder 2327979-2327997 19 NC_010407.1 2158090-2158108 2 0.895
NC_010407_2 2.3|2327979|19|NC_010407|CRISPRCasFinder 2327979-2327997 19 NC_010407.1 2277400-2277418 2 0.895
NC_010407_2 2.3|2327979|19|NC_010407|CRISPRCasFinder 2327979-2327997 19 NC_010407.1 2325679-2325697 2 0.895
NC_010407_2 2.3|2327979|19|NC_010407|CRISPRCasFinder 2327979-2327997 19 NC_010407.1 2640214-2640232 2 0.895
NC_010407_2 2.3|2327979|19|NC_010407|CRISPRCasFinder 2327979-2327997 19 NC_010407.1 3025984-3026002 2 0.895
NC_010407_2 2.3|2327979|19|NC_010407|CRISPRCasFinder 2327979-2327997 19 NC_010407.1 154606-154624 2 0.895
NC_010407_2 2.3|2327979|19|NC_010407|CRISPRCasFinder 2327979-2327997 19 NC_010407.1 1775188-1775206 7 0.632
NC_010407_2 2.3|2327979|19|NC_010407|CRISPRCasFinder 2327979-2327997 19 NC_010407.1 1915637-1915655 2 0.895
NC_010407_2 2.3|2327979|19|NC_010407|CRISPRCasFinder 2327979-2327997 19 NC_010407.1 2164143-2164161 2 0.895
NC_010407_2 2.3|2327979|19|NC_010407|CRISPRCasFinder 2327979-2327997 19 NC_010407.1 2200993-2201011 2 0.895
NC_010407_2 2.3|2327979|19|NC_010407|CRISPRCasFinder 2327979-2327997 19 NC_010407.1 2812807-2812825 2 0.895
NC_010407_2 2.3|2327979|19|NC_010407|CRISPRCasFinder 2327979-2327997 19 NC_010408.1 389-407 7 0.632
NC_010407_2 2.3|2327979|19|NC_010407|CRISPRCasFinder 2327979-2327997 19 NC_010408.1 1866-1884 2 0.895
NC_010407_2 2.3|2327979|19|NC_010407|CRISPRCasFinder 2327979-2327997 19 NC_010408.1 92908-92926 6 0.684
NC_010407_2 2.3|2327979|19|NC_010407|CRISPRCasFinder 2327979-2327997 19 NC_010408.1 94385-94403 7 0.632

1. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to position: 2357656-2357677, mismatch: 2, identity: 0.909

cagcaccggcagcagcggcagc	CRISPR spacer
cagccccggcagcagcgccagc	Protospacer
**** ************ ****

2. spacer 2.3|2327979|19|NC_010407|CRISPRCasFinder matches to position: 1267143-1267161, mismatch: 2, identity: 0.895

gcgcgacggcgcgcgcgac	CRISPR spacer
gcgcgccggcgtgcgcgac	Protospacer
***** *****.*******

3. spacer 2.3|2327979|19|NC_010407|CRISPRCasFinder matches to position: 1355407-1355425, mismatch: 2, identity: 0.895

gcgcgacggcgcgcgcgac	CRISPR spacer
gcgcgacgccgcgcgggac	Protospacer
******** ****** ***

4. spacer 2.3|2327979|19|NC_010407|CRISPRCasFinder matches to position: 1838345-1838363, mismatch: 6, identity: 0.684

-----gcgcgacggcgcgcgcgac	CRISPR spacer
gtcgggcgcgacgtcgcgc-----	Protospacer
     ******** *****     

5. spacer 2.3|2327979|19|NC_010407|CRISPRCasFinder matches to position: 1860644-1860662, mismatch: 2, identity: 0.895

gcgcgacggcgcgcgcgac	CRISPR spacer
gcgcgaccgcgagcgcgac	Protospacer
******* *** *******

6. spacer 2.3|2327979|19|NC_010407|CRISPRCasFinder matches to position: 2142850-2142868, mismatch: 2, identity: 0.895

gcgcgacggcgcgcgcgac	CRISPR spacer
gcgcgtcggcgcgcgtgac	Protospacer
***** *********.***

7. spacer 2.3|2327979|19|NC_010407|CRISPRCasFinder matches to position: 2158090-2158108, mismatch: 2, identity: 0.895

gcgcgacggcgcgcgcgac	CRISPR spacer
gcccgatggcgcgcgcgac	Protospacer
** ***.************

8. spacer 2.3|2327979|19|NC_010407|CRISPRCasFinder matches to position: 2277400-2277418, mismatch: 2, identity: 0.895

gcgcgacggcgcgcgcgac	CRISPR spacer
gcgcgacgacgagcgcgac	Protospacer
********.** *******

9. spacer 2.3|2327979|19|NC_010407|CRISPRCasFinder matches to position: 2325679-2325697, mismatch: 2, identity: 0.895

gcgcgacggcgcgcgcgac	CRISPR spacer
gcgcgacggcgagcacgac	Protospacer
*********** **.****

10. spacer 2.3|2327979|19|NC_010407|CRISPRCasFinder matches to position: 2640214-2640232, mismatch: 2, identity: 0.895

gcgcgacggcgcgcgcgac	CRISPR spacer
gcgcggcggcgagcgcgac	Protospacer
*****.***** *******

11. spacer 2.3|2327979|19|NC_010407|CRISPRCasFinder matches to position: 3025984-3026002, mismatch: 2, identity: 0.895

gcgcgacggcgcgcgcgac	CRISPR spacer
gcgcgaggtcgcgcgcgac	Protospacer
****** * **********

12. spacer 2.3|2327979|19|NC_010407|CRISPRCasFinder matches to position: 154606-154624, mismatch: 2, identity: 0.895

gcgcgacggcgcgcgcgac	CRISPR spacer
gctcgacggcgcgggcgac	Protospacer
** ********** *****

13. spacer 2.3|2327979|19|NC_010407|CRISPRCasFinder matches to position: 1775188-1775206, mismatch: 7, identity: 0.632

-----gcgcgacggcgcgcgcgac	CRISPR spacer
gtcgcgcgcaccggcgcgc-----	Protospacer
     ****. ********     

14. spacer 2.3|2327979|19|NC_010407|CRISPRCasFinder matches to position: 1915637-1915655, mismatch: 2, identity: 0.895

gcgcgacggcgcgcgcgac	CRISPR spacer
gcgcgacgccgcgctcgac	Protospacer
******** ***** ****

15. spacer 2.3|2327979|19|NC_010407|CRISPRCasFinder matches to position: 2164143-2164161, mismatch: 2, identity: 0.895

gcgcgacggcgcgcgcgac	CRISPR spacer
gcgacacggcgcgcgcgac	Protospacer
***  **************

16. spacer 2.3|2327979|19|NC_010407|CRISPRCasFinder matches to position: 2200993-2201011, mismatch: 2, identity: 0.895

gcgcgacggcgcgcgcgac	CRISPR spacer
gcgcgacgacgcgggcgac	Protospacer
********.**** *****

17. spacer 2.3|2327979|19|NC_010407|CRISPRCasFinder matches to position: 2812807-2812825, mismatch: 2, identity: 0.895

gcgcgacggcgcgcgcgac	CRISPR spacer
gcgcgaacgcgcgcgcgac	Protospacer
******  ***********

18. spacer 2.3|2327979|19|NC_010407|CRISPRCasFinder matches to position: 389-407, mismatch: 7, identity: 0.632

-----gcgcgacggcgcgcgcgac	CRISPR spacer
gtcgcgcgcgacgtcgtgc-----	Protospacer
     ******** **.**     

19. spacer 2.3|2327979|19|NC_010407|CRISPRCasFinder matches to position: 1866-1884, mismatch: 2, identity: 0.895

gcgcgacggcgcgcgcgac	CRISPR spacer
gcgcgacgtcgcgcacgac	Protospacer
******** *****.****

20. spacer 2.3|2327979|19|NC_010407|CRISPRCasFinder matches to position: 92908-92926, mismatch: 6, identity: 0.684

-----gcgcgacggcgcgcgcgac	CRISPR spacer
gtcgtgcgcgacgtcgcgc-----	Protospacer
     ******** *****     

21. spacer 2.3|2327979|19|NC_010407|CRISPRCasFinder matches to position: 94385-94403, mismatch: 7, identity: 0.632

-----gcgcgacggcgcgcgcgac	CRISPR spacer
gtcgcgcgcgacgtcgtgc-----	Protospacer
     ******** **.**     

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_010407_2 2.2|2327937|19|NC_010407|CRISPRCasFinder 2327937-2327955 19 NC_009806 Kineococcus radiotolerans SRS30216 = ATCC BAA-149 plasmid pKRAD01, complete sequence 17998-18016 0 1.0
NC_010407_2 2.3|2327979|19|NC_010407|CRISPRCasFinder 2327979-2327997 19 NZ_CP043499 Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence 1206788-1206806 0 1.0
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 1837940-1837961 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 1223119-1223140 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 1225284-1225305 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 1819809-1819830 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NC_010625 Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence 1505154-1505175 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 275518-275539 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 1181281-1181302 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP054621 Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence 571412-571433 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 1157421-1157442 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 1270441-1270462 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 923521-923542 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 1184227-1184248 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 1184227-1184248 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 MH230177 Aeromonas phage SD04, complete genome 34974-34995 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 MH248138 Erwinia phage vB_EamM_Alexandra, complete genome 140866-140887 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 MT675126 Providencia phage vB_PreS-PatoteraRojo, complete genome 16215-16236 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 756113-756134 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 754050-754071 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 1172828-1172849 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 851045-851066 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 804722-804743 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 900929-900950 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 651295-651316 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP024248 Escherichia coli O27:H7 strain B4103-1 plasmid unnamed3, complete sequence 108716-108737 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 1448738-1448759 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 718992-719013 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_LN832562 Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence 442250-442271 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 876153-876174 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 1466375-1466396 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 895036-895057 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 1172957-1172978 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 900922-900943 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1070941-1070962 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 631991-632012 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 669166-669187 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 900936-900957 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 1223899-1223920 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 792983-793004 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 880499-880520 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 726534-726555 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 1203752-1203773 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 1263569-1263590 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP011665 Streptomyces sp. Mg1 plasmid pSMg1-1, complete sequence 343048-343069 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 42203-42224 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 808216-808237 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 650410-650431 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 806817-806838 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 993915-993936 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 1172552-1172573 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 651283-651304 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 651301-651322 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 651280-651301 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 804021-804042 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 880488-880509 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 993882-993903 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 870003-870024 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 914729-914750 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 993883-993904 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 1172497-1172518 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 774621-774642 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 870003-870024 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 914729-914750 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 661130-661151 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 993896-993917 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 870003-870024 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 756177-756198 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 774644-774665 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 870007-870028 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 914729-914750 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 914729-914750 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 914729-914750 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 993896-993917 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 993885-993906 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 774644-774665 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 809362-809383 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 756177-756198 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 790055-790076 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 844289-844310 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 881171-881192 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 993885-993906 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 774644-774665 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 870003-870024 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1047359-1047380 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 993881-993902 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 774644-774665 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 774644-774665 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 993896-993917 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 914731-914752 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 993907-993928 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 993885-993906 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 756163-756184 1 0.955
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP011665 Streptomyces sp. Mg1 plasmid pSMg1-1, complete sequence 136889-136910 2 0.909
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP018096 Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence 158815-158836 2 0.909
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_LN831789 Streptomyces leeuwenhoekii strain type strain (C34 = DSM 42122 = NRRL B-24963) plasmid pSLE2 57586-57607 2 0.909
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 KM659097 Paracoccus yeei plasmid pLM20P5, complete sequence 18893-18914 2 0.909
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP044425 Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence 460755-460776 2 0.909
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP049909 Hymenobacter sp. HDW8 plasmid p_unnamed2, complete sequence 54462-54483 2 0.909
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_LR134446 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 4, complete sequence 3172-3193 2 0.909
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NC_012520 Rhodococcus opacus B4 plasmid pROB01, complete sequence 280793-280814 2 0.909
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 1198104-1198125 2 0.909
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NC_016623 Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence 614262-614283 2 0.909
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 MH572501 Microviridae sp. isolate SD_HF_34, complete genome 2090-2111 2 0.909
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 MH910042 Mycobacterium phage Scarlett, complete genome 59696-59717 2 0.909
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 MH910038 Mycobacterium phage LeMond, complete genome 59905-59926 2 0.909
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 MH910039 Mycobacterium phage Oscar, complete genome 59827-59848 2 0.909
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NC_047951 Yersinia phage phiR8-01 complete genome 40073-40094 2 0.909
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 MK376955 Mycobacterium phage KiSi, complete genome 59948-59969 2 0.909
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP020568 Kitasatospora aureofaciens strain DM-1 plasmid unnamed1, complete sequence 228533-228554 3 0.864
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NZ_CP029358 Azospirillum sp. CFH 70021 plasmid unnamed3 210412-210433 3 0.864
NC_010407_2 2.1|2327892|22|NC_010407|CRISPRCasFinder 2327892-2327913 22 NC_016585 Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence 736577-736598 3 0.864
NC_010407_1 1.3|1303176|31|NC_010407|CRT 1303176-1303206 31 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 300974-301004 4 0.871
NC_010407_1 1.5|1303293|31|NC_010407|CRT 1303293-1303323 31 NZ_CP054841 Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence 82609-82639 4 0.871
NC_010407_1 1.3|1303176|31|NC_010407|CRT 1303176-1303206 31 NZ_CP012182 Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence 470347-470377 5 0.839
NC_010407_1 1.3|1303176|31|NC_010407|CRT 1303176-1303206 31 NZ_CP012185 Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence 578188-578218 5 0.839
NC_010407_1 1.1|1303059|31|NC_010407|CRT 1303059-1303089 31 NZ_CP045548 Streptomyces sp. SYP-A7193 plasmid unnamed1, complete sequence 165394-165424 6 0.806
NC_010407_1 1.1|1303059|31|NC_010407|CRT 1303059-1303089 31 NC_013858 Azospirillum sp. B510 plasmid pAB510d, complete sequence 190119-190149 6 0.806
NC_010407_1 1.1|1303059|31|NC_010407|CRT 1303059-1303089 31 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 300974-301004 6 0.806
NC_010407_1 1.1|1303059|31|NC_010407|CRT 1303059-1303089 31 NC_048733 Microbacterium phage Burro, complete genome 4398-4428 6 0.806
NC_010407_1 1.2|1303119|28|NC_010407|CRT 1303119-1303146 28 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 220319-220346 6 0.786
NC_010407_1 1.2|1303119|28|NC_010407|CRT 1303119-1303146 28 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 1782054-1782081 6 0.786
NC_010407_1 1.3|1303176|31|NC_010407|CRT 1303176-1303206 31 NC_048733 Microbacterium phage Burro, complete genome 4398-4428 6 0.806
NC_010407_1 1.5|1303293|31|NC_010407|CRT 1303293-1303323 31 NZ_CP035092 Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence 161057-161087 6 0.806
NC_010407_1 1.5|1303293|31|NC_010407|CRT 1303293-1303323 31 NZ_LR134467 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 25, complete sequence 33923-33953 6 0.806
NC_010407_1 1.5|1303293|31|NC_010407|CRT 1303293-1303323 31 NC_008688 Paracoccus denitrificans PD1222 plasmid 1, complete sequence 408404-408434 6 0.806
NC_010407_1 1.5|1303293|31|NC_010407|CRT 1303293-1303323 31 NZ_CP015737 Shinella sp. HZN7 plasmid pShin-01, complete sequence 503230-503260 6 0.806
NC_010407_1 1.5|1303293|31|NC_010407|CRT 1303293-1303323 31 NC_014957 Isosphaera pallida ATCC 43644 plasmid pISOP01, complete sequence 31017-31047 6 0.806
NC_010407_1 1.5|1303293|31|NC_010407|CRT 1303293-1303323 31 NZ_CP030074 Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence 205671-205701 6 0.806
NC_010407_1 1.6|1303353|31|NC_010407|CRT 1303353-1303383 31 NZ_CP022366 Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence 26082-26112 6 0.806
NC_010407_1 1.6|1303353|31|NC_010407|CRT 1303353-1303383 31 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 2671523-2671553 6 0.806
NC_010407_1 1.6|1303353|31|NC_010407|CRT 1303353-1303383 31 KT287080 Enterobacter phage phiEap-2, complete genome 10889-10919 6 0.806
NC_010407_1 1.1|1303059|31|NC_010407|CRT 1303059-1303089 31 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 605757-605787 7 0.774
NC_010407_1 1.1|1303059|31|NC_010407|CRT 1303059-1303089 31 NZ_CP013739 Streptomyces globisporus C-1027 plasmid SGLP1, complete sequence 7176-7206 7 0.774
NC_010407_1 1.1|1303059|31|NC_010407|CRT 1303059-1303089 31 MK801721 Gordonia phage William, complete genome 22539-22569 7 0.774
NC_010407_1 1.1|1303059|31|NC_010407|CRT 1303059-1303089 31 NZ_CP015867 Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence 177827-177857 7 0.774
NC_010407_1 1.1|1303059|31|NC_010407|CRT 1303059-1303089 31 NZ_CP051544 Paracoccus sanguinis strain OM2164 plasmid pPspOM44, complete sequence 8652-8682 7 0.774
NC_010407_1 1.1|1303059|31|NC_010407|CRT 1303059-1303089 31 NZ_CP025549 Mycobacterium paragordonae strain 49061 plasmid unnamed3, complete sequence 12065-12095 7 0.774
NC_010407_1 1.1|1303059|31|NC_010407|CRT 1303059-1303089 31 NC_016586 Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence 562750-562780 7 0.774
NC_010407_1 1.1|1303059|31|NC_010407|CRT 1303059-1303089 31 AF068845 Mycobacteriophage TM4, complete genome 21501-21531 7 0.774
NC_010407_1 1.1|1303059|31|NC_010407|CRT 1303059-1303089 31 NC_003387 Mycobacterium phage TM4, complete genome 21501-21531 7 0.774
NC_010407_1 1.1|1303059|31|NC_010407|CRT 1303059-1303089 31 NZ_CP015419 Rhodovulum sulfidophilum DSM 1374 plasmid unnamed1, complete sequence 15929-15959 7 0.774
NC_010407_1 1.1|1303059|31|NC_010407|CRT 1303059-1303089 31 NZ_CP015422 Rhodovulum sulfidophilum strain SNK001 plasmid, complete sequence 15829-15859 7 0.774
NC_010407_1 1.1|1303059|31|NC_010407|CRT 1303059-1303089 31 KC787101 Mycobacterium phage 33D, partial genome 26898-26928 7 0.774
NC_010407_1 1.3|1303176|31|NC_010407|CRT 1303176-1303206 31 KY555145 Caulobacter phage Ccr29, complete genome 66344-66374 7 0.774
NC_010407_1 1.3|1303176|31|NC_010407|CRT 1303176-1303206 31 KY555143 Caulobacter phage Ccr2, complete genome 61811-61841 7 0.774
NC_010407_1 1.3|1303176|31|NC_010407|CRT 1303176-1303206 31 NC_019407 Caulobacter phage CcrMagneto, complete genome 60679-60709 7 0.774
NC_010407_1 1.3|1303176|31|NC_010407|CRT 1303176-1303206 31 KY555144 Caulobacter phage Ccr5, complete genome 61263-61293 7 0.774
NC_010407_1 1.3|1303176|31|NC_010407|CRT 1303176-1303206 31 KY555142 Caulobacter phage Ccr10, complete genome 61336-61366 7 0.774
NC_010407_1 1.3|1303176|31|NC_010407|CRT 1303176-1303206 31 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 1451403-1451433 7 0.774
NC_010407_1 1.3|1303176|31|NC_010407|CRT 1303176-1303206 31 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 361665-361695 7 0.774
NC_010407_1 1.3|1303176|31|NC_010407|CRT 1303176-1303206 31 NZ_KR152226 Micrococcus sp. MG-2010-D12 plasmid pJD12, complete sequence 71176-71206 7 0.774
NC_010407_1 1.4|1303236|28|NC_010407|CRT 1303236-1303263 28 NC_024971 Streptomyces rochei plasmid pSLA2-S DNA, complete sequence, strain: 7434AN4 9902-9929 7 0.75
NC_010407_1 1.5|1303293|31|NC_010407|CRT 1303293-1303323 31 NZ_CP013415 Burkholderia ubonensis strain MSMB2035 plasmid pMSMB2035, complete sequence 130654-130684 7 0.774
NC_010407_1 1.5|1303293|31|NC_010407|CRT 1303293-1303323 31 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 1412114-1412144 7 0.774
NC_010407_1 1.5|1303293|31|NC_010407|CRT 1303293-1303323 31 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 401144-401174 7 0.774
NC_010407_1 1.5|1303293|31|NC_010407|CRT 1303293-1303323 31 NC_013856 Azospirillum sp. B510 plasmid pAB510b, complete sequence 313226-313256 7 0.774
NC_010407_1 1.5|1303293|31|NC_010407|CRT 1303293-1303323 31 NZ_CP020701 Streptomyces tsukubensis strain NRRL 18488 plasmid pSTS1, complete sequence 6148-6178 7 0.774
NC_010407_1 1.5|1303293|31|NC_010407|CRT 1303293-1303323 31 NZ_CP006369 Aureimonas sp. AU20 plasmid pAU20b, complete sequence 320146-320176 7 0.774
NC_010407_1 1.1|1303059|31|NC_010407|CRT 1303059-1303089 31 KY555145 Caulobacter phage Ccr29, complete genome 66344-66374 8 0.742
NC_010407_1 1.1|1303059|31|NC_010407|CRT 1303059-1303089 31 KY555143 Caulobacter phage Ccr2, complete genome 61811-61841 8 0.742
NC_010407_1 1.1|1303059|31|NC_010407|CRT 1303059-1303089 31 NC_019407 Caulobacter phage CcrMagneto, complete genome 60679-60709 8 0.742
NC_010407_1 1.1|1303059|31|NC_010407|CRT 1303059-1303089 31 KY555144 Caulobacter phage Ccr5, complete genome 61263-61293 8 0.742
NC_010407_1 1.1|1303059|31|NC_010407|CRT 1303059-1303089 31 KY555142 Caulobacter phage Ccr10, complete genome 61336-61366 8 0.742
NC_010407_1 1.1|1303059|31|NC_010407|CRT 1303059-1303089 31 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 836227-836257 8 0.742
NC_010407_1 1.1|1303059|31|NC_010407|CRT 1303059-1303089 31 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 1619957-1619987 8 0.742
NC_010407_1 1.1|1303059|31|NC_010407|CRT 1303059-1303089 31 NZ_CP030864 Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence 86021-86051 8 0.742
NC_010407_1 1.1|1303059|31|NC_010407|CRT 1303059-1303089 31 NZ_CP030864 Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence 53877-53907 8 0.742
NC_010407_1 1.1|1303059|31|NC_010407|CRT 1303059-1303089 31 NZ_CP020385 Rhodovulum sp. MB263 plasmid pRSMBA, complete sequence 200051-200081 8 0.742
NC_010407_1 1.1|1303059|31|NC_010407|CRT 1303059-1303089 31 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 193305-193335 8 0.742
NC_010407_1 1.1|1303059|31|NC_010407|CRT 1303059-1303089 31 NZ_AP014802 Rhodovulum sulfidophilum plasmid Plasmid2 DNA, complete genome, strain: DSM 2351 88951-88981 8 0.742
NC_010407_1 1.1|1303059|31|NC_010407|CRT 1303059-1303089 31 KY092482 Streptomyces phage Mojorita, complete genome 27812-27842 8 0.742
NC_010407_1 1.1|1303059|31|NC_010407|CRT 1303059-1303089 31 KY092480 Streptomyces phage Picard, complete genome 28010-28040 8 0.742
NC_010407_1 1.3|1303176|31|NC_010407|CRT 1303176-1303206 31 NZ_CP045548 Streptomyces sp. SYP-A7193 plasmid unnamed1, complete sequence 165394-165424 8 0.742
NC_010407_1 1.3|1303176|31|NC_010407|CRT 1303176-1303206 31 KY555147 Caulobacter phage Ccr34, complete genome 62425-62455 8 0.742
NC_010407_1 1.3|1303176|31|NC_010407|CRT 1303176-1303206 31 KY555146 Caulobacter phage Ccr32, complete genome 61984-62014 8 0.742
NC_010407_1 1.3|1303176|31|NC_010407|CRT 1303176-1303206 31 JX163858 Caulobacter phage phiCbK, complete genome 145843-145873 8 0.742
NC_010407_1 1.3|1303176|31|NC_010407|CRT 1303176-1303206 31 NZ_CP025549 Mycobacterium paragordonae strain 49061 plasmid unnamed3, complete sequence 12065-12095 8 0.742
NC_010407_1 1.3|1303176|31|NC_010407|CRT 1303176-1303206 31 NZ_LR134467 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 25, complete sequence 33923-33953 8 0.742
NC_010407_1 1.3|1303176|31|NC_010407|CRT 1303176-1303206 31 NZ_CP010865 Marinovum algicola DG 898 plasmid pMaD10, complete sequence 27848-27878 8 0.742
NC_010407_1 1.3|1303176|31|NC_010407|CRT 1303176-1303206 31 MK814757 Gordonia phage Fairfaxidum, complete genome 22796-22826 8 0.742
NC_010407_1 1.3|1303176|31|NC_010407|CRT 1303176-1303206 31 MN234161 Gordonia phage Toast, complete genome 22713-22743 8 0.742
NC_010407_1 1.5|1303293|31|NC_010407|CRT 1303293-1303323 31 NC_012811 Methylorubrum extorquens AM1 megaplasmid, complete sequence 963302-963332 8 0.742
NC_010407_1 1.5|1303293|31|NC_010407|CRT 1303293-1303323 31 NZ_LR594668 Variovorax sp. SRS16 plasmid 3 378411-378441 8 0.742
NC_010407_1 1.5|1303293|31|NC_010407|CRT 1303293-1303323 31 NZ_CP024587 Roseomonas sp. FDAARGOS_362 plasmid unnamed3, complete sequence 107259-107289 8 0.742
NC_010407_1 1.5|1303293|31|NC_010407|CRT 1303293-1303323 31 NZ_CP016078 Actinoalloteichus sp. GBA129-24 plasmid pGBA129-24a, complete sequence 55270-55300 8 0.742
NC_010407_1 1.6|1303353|31|NC_010407|CRT 1303353-1303383 31 NZ_CP024986 Streptomyces lavendulae subsp. lavendulae strain CCM 3239 plasmid pSA3239, complete sequence 152312-152342 8 0.742
NC_010407_1 1.6|1303353|31|NC_010407|CRT 1303353-1303383 31 NC_024970 Streptomyces aureofaciens strain CCM3239 plasmid pSA3239, complete sequence 88735-88765 8 0.742
NC_010407_1 1.6|1303353|31|NC_010407|CRT 1303353-1303383 31 NZ_KJ396772 Streptomyces lavendulae subsp. lavendulae strain CCM3239 plasmid pSA3239, complete sequence 88735-88765 8 0.742
NC_010407_1 1.6|1303353|31|NC_010407|CRT 1303353-1303383 31 NZ_CP030074 Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence 841381-841411 8 0.742
NC_010407_1 1.1|1303059|31|NC_010407|CRT 1303059-1303089 31 KY555147 Caulobacter phage Ccr34, complete genome 62425-62455 9 0.71
NC_010407_1 1.1|1303059|31|NC_010407|CRT 1303059-1303089 31 KY555146 Caulobacter phage Ccr32, complete genome 61984-62014 9 0.71
NC_010407_1 1.1|1303059|31|NC_010407|CRT 1303059-1303089 31 JX163858 Caulobacter phage phiCbK, complete genome 145843-145873 9 0.71
NC_010407_1 1.1|1303059|31|NC_010407|CRT 1303059-1303089 31 NZ_CP030074 Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence 322922-322952 9 0.71
NC_010407_1 1.1|1303059|31|NC_010407|CRT 1303059-1303089 31 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 1023852-1023882 9 0.71
NC_010407_1 1.3|1303176|31|NC_010407|CRT 1303176-1303206 31 NZ_CP031079 Paracoccus yeei strain CCUG 32053 plasmid pYEE1, complete sequence 343833-343863 9 0.71
NC_010407_1 1.3|1303176|31|NC_010407|CRT 1303176-1303206 31 NC_016586 Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence 562750-562780 9 0.71
NC_010407_1 1.3|1303176|31|NC_010407|CRT 1303176-1303206 31 NZ_CP024426 Paracoccus yeei strain TT13 plasmid pTT13-4, complete sequence 123881-123911 9 0.71
NC_010407_1 1.3|1303176|31|NC_010407|CRT 1303176-1303206 31 NZ_CP020445 Paracoccus yeei strain FDAARGOS_252 plasmid unnamed5, complete sequence 63666-63696 9 0.71
NC_010407_1 1.3|1303176|31|NC_010407|CRT 1303176-1303206 31 NZ_CP051544 Paracoccus sanguinis strain OM2164 plasmid pPspOM44, complete sequence 8652-8682 9 0.71
NC_010407_1 1.3|1303176|31|NC_010407|CRT 1303176-1303206 31 NZ_CP044079 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed2, complete sequence 77516-77546 9 0.71
NC_010407_1 1.3|1303176|31|NC_010407|CRT 1303176-1303206 31 AF068845 Mycobacteriophage TM4, complete genome 21501-21531 9 0.71
NC_010407_1 1.3|1303176|31|NC_010407|CRT 1303176-1303206 31 NC_003387 Mycobacterium phage TM4, complete genome 21501-21531 9 0.71
NC_010407_1 1.3|1303176|31|NC_010407|CRT 1303176-1303206 31 CP054922 Streptomyces sp. NA03103 plasmid unnamed2, complete sequence 22275-22305 9 0.71
NC_010407_1 1.3|1303176|31|NC_010407|CRT 1303176-1303206 31 NC_012520 Rhodococcus opacus B4 plasmid pROB01, complete sequence 287200-287230 9 0.71
NC_010407_1 1.3|1303176|31|NC_010407|CRT 1303176-1303206 31 MK801721 Gordonia phage William, complete genome 22539-22569 9 0.71
NC_010407_1 1.3|1303176|31|NC_010407|CRT 1303176-1303206 31 KC787101 Mycobacterium phage 33D, partial genome 26898-26928 9 0.71
NC_010407_1 1.5|1303293|31|NC_010407|CRT 1303293-1303323 31 NC_010311 Streptomyces sp. HK1 plasmid pSHK1, complete sequence 103174-103204 9 0.71
NC_010407_1 1.5|1303293|31|NC_010407|CRT 1303293-1303323 31 NZ_CP046917 Paraburkholderia sp. DHF22 plasmid p1, complete sequence 33494-33524 9 0.71
NC_010407_1 1.6|1303353|31|NC_010407|CRT 1303353-1303383 31 NC_004954 Micrococcus sp. 28 plasmid pSD10, complete sequence 47480-47510 9 0.71
NC_010407_1 1.1|1303059|31|NC_010407|CRT 1303059-1303089 31 NZ_CP010865 Marinovum algicola DG 898 plasmid pMaD10, complete sequence 27848-27878 10 0.677
NC_010407_1 1.5|1303293|31|NC_010407|CRT 1303293-1303323 31 NZ_CP016287 Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence 613718-613748 10 0.677
NC_010407_1 1.5|1303293|31|NC_010407|CRT 1303293-1303323 31 NZ_CP054621 Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence 405565-405595 10 0.677
NC_010407_1 1.6|1303353|31|NC_010407|CRT 1303353-1303383 31 NZ_CP032919 Agrobacterium tumefaciens strain 15955 plasmid pAt15955, complete sequence 268261-268291 10 0.677
NC_010407_1 1.6|1303353|31|NC_010407|CRT 1303353-1303383 31 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 268345-268375 10 0.677
NC_010407_1 1.1|1303059|31|NC_010407|CRT 1303059-1303089 31 NZ_CP022999 Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence 34120-34150 12 0.613

1. spacer 2.2|2327937|19|NC_010407|CRISPRCasFinder matches to NC_009806 (Kineococcus radiotolerans SRS30216 = ATCC BAA-149 plasmid pKRAD01, complete sequence) position: , mismatch: 0, identity: 1.0

cagcaccggcgacggcagg	CRISPR spacer
cagcaccggcgacggcagg	Protospacer
*******************

2. spacer 2.3|2327979|19|NC_010407|CRISPRCasFinder matches to NZ_CP043499 (Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gcgcgacggcgcgcgcgac	CRISPR spacer
gcgcgacggcgcgcgcgac	Protospacer
*******************

3. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

4. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

5. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

6. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

7. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NC_010625 (Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcagcggcagcagcggcagc	Protospacer
***** ****************

8. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

9. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

10. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcagcggcagcagcggcagc	Protospacer
***** ****************

11. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

12. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

13. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

14. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

15. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

16. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to MH230177 (Aeromonas phage SD04, complete genome) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcagcggcagcagcggcagc	Protospacer
***** ****************

17. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to MH248138 (Erwinia phage vB_EamM_Alexandra, complete genome) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
catcaccggcagcagcggcagc	Protospacer
** *******************

18. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to MT675126 (Providencia phage vB_PreS-PatoteraRojo, complete genome) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

19. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

20. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

21. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

22. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

23. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

24. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

25. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

26. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP024248 (Escherichia coli O27:H7 strain B4103-1 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcaccggcagc	Protospacer
************** *******

27. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

28. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

29. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_LN832562 (Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcagcagc	Protospacer
****************.*****

30. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

31. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

32. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

33. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

34. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

35. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

36. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

37. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

38. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

39. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

40. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

41. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

42. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

43. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

44. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcagcggcagcagcggcagc	Protospacer
***** ****************

45. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP011665 (Streptomyces sp. Mg1 plasmid pSMg1-1, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

46. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcagcggcagcagcggcagc	Protospacer
***** ****************

47. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

48. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

49. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

50. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

51. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

52. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

53. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

54. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

55. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

56. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

57. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

58. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

59. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

60. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

61. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

62. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

63. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

64. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

65. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

66. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

67. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

68. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

69. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

70. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

71. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

72. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

73. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

74. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

75. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

76. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

77. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

78. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

79. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

80. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

81. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

82. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

83. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

84. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

85. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcagcggcagcagcggcagc	Protospacer
***** ****************

86. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

87. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

88. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

89. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

90. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

91. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

92. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

93. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgccagc	Protospacer
***************** ****

94. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP011665 (Streptomyces sp. Mg1 plasmid pSMg1-1, complete sequence) position: , mismatch: 2, identity: 0.909

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcaccggcagt	Protospacer
************** ******.

95. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP018096 (Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence) position: , mismatch: 2, identity: 0.909

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcggcagcggcagg	Protospacer
**********.********** 

96. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_LN831789 (Streptomyces leeuwenhoekii strain type strain (C34 = DSM 42122 = NRRL B-24963) plasmid pSLE2) position: , mismatch: 2, identity: 0.909

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccgccagcagcggcagg	Protospacer
******** ************ 

97. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to KM659097 (Paracoccus yeei plasmid pLM20P5, complete sequence) position: , mismatch: 2, identity: 0.909

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcgtcagg	Protospacer
***************** *** 

98. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP044425 (Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence) position: , mismatch: 2, identity: 0.909

cagcaccggcagcagcggcagc	CRISPR spacer
cgccaccggcagcagcggcagc	Protospacer
*. *******************

99. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP049909 (Hymenobacter sp. HDW8 plasmid p_unnamed2, complete sequence) position: , mismatch: 2, identity: 0.909

cagcaccggcagcagcggcagc	CRISPR spacer
gagcagcggcagcagcggcagc	Protospacer
 **** ****************

100. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_LR134446 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 4, complete sequence) position: , mismatch: 2, identity: 0.909

cagcaccggcagcagcggcagc	CRISPR spacer
gagcaccggcagcggcggcagc	Protospacer
 ************.********

101. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NC_012520 (Rhodococcus opacus B4 plasmid pROB01, complete sequence) position: , mismatch: 2, identity: 0.909

cagcaccggcagcagcggcagc	CRISPR spacer
gagcgccggcagcagcggcagc	Protospacer
 ***.*****************

102. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 2, identity: 0.909

cagcaccggcagcagcggcagc	CRISPR spacer
gagcaccggcagcagcgccagc	Protospacer
 **************** ****

103. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 2, identity: 0.909

cagcaccggcagcagcggcagc	CRISPR spacer
ctacaccggcagcagcggcagc	Protospacer
* .*******************

104. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to MH572501 (Microviridae sp. isolate SD_HF_34, complete genome) position: , mismatch: 2, identity: 0.909

cagcaccggcagcagcggcagc	CRISPR spacer
gagcaccggcaccagcggcagc	Protospacer
 ********** **********

105. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to MH910042 (Mycobacterium phage Scarlett, complete genome) position: , mismatch: 2, identity: 0.909

cagcaccggcagcagcggcagc	CRISPR spacer
cagcacctgcagcagcggcagg	Protospacer
******* ************* 

106. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to MH910038 (Mycobacterium phage LeMond, complete genome) position: , mismatch: 2, identity: 0.909

cagcaccggcagcagcggcagc	CRISPR spacer
cagcacctgcagcagcggcagg	Protospacer
******* ************* 

107. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to MH910039 (Mycobacterium phage Oscar, complete genome) position: , mismatch: 2, identity: 0.909

cagcaccggcagcagcggcagc	CRISPR spacer
cagcacctgcagcagcggcagg	Protospacer
******* ************* 

108. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NC_047951 (Yersinia phage phiR8-01 complete genome) position: , mismatch: 2, identity: 0.909

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccagcagcagcggcaga	Protospacer
*******.************* 

109. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to MK376955 (Mycobacterium phage KiSi, complete genome) position: , mismatch: 2, identity: 0.909

cagcaccggcagcagcggcagc	CRISPR spacer
cagcacctgcagcagcggcagg	Protospacer
******* ************* 

110. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP020568 (Kitasatospora aureofaciens strain DM-1 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.864

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcggccag	Protospacer
******************* . 

111. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NZ_CP029358 (Azospirillum sp. CFH 70021 plasmid unnamed3) position: , mismatch: 3, identity: 0.864

cagcaccggcagcagcggcagc	CRISPR spacer
cagcaccggcagcagcggcgcg	Protospacer
*******************.  

112. spacer 2.1|2327892|22|NC_010407|CRISPRCasFinder matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 3, identity: 0.864

cagcaccggcagcagcggcagc	CRISPR spacer
atgcaccggcagcagcggcagg	Protospacer
  ******************* 

113. spacer 1.3|1303176|31|NC_010407|CRT matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 4, identity: 0.871

tggtggtg-ccggcccggcccgtccggcgcgg	CRISPR spacer
-ggtgatgcccggcccgacccgtccggtgcgg	Protospacer
 ****.** ********.*********.****

114. spacer 1.5|1303293|31|NC_010407|CRT matches to NZ_CP054841 (Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.871

tggcgga--gccgggtcggcccggcccgcgcgc	CRISPR spacer
--gcggatcgccgggtcggccaggccggcgcgc	Protospacer
  *****  ************ **** ******

115. spacer 1.3|1303176|31|NC_010407|CRT matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 5, identity: 0.839

tggtggtgccggcccggcccgtccggcgcgg	CRISPR spacer
tgtgggtgccggtccggccggtccggcgcag	Protospacer
**  ********.****** *********.*

116. spacer 1.3|1303176|31|NC_010407|CRT matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 5, identity: 0.839

tggtggtgccggcccggcccgtccggcgcgg	CRISPR spacer
tgtgggtgccggtccggccggtccggcgcag	Protospacer
**  ********.****** *********.*

117. spacer 1.1|1303059|31|NC_010407|CRT matches to NZ_CP045548 (Streptomyces sp. SYP-A7193 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.806

tggcggggccggcccggcccgtccggcgcgg	CRISPR spacer
gacctggaccggcccggcccgtccgtcgcgg	Protospacer
 . * **.***************** *****

118. spacer 1.1|1303059|31|NC_010407|CRT matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 6, identity: 0.806

tggcggggccggcccggcccgtccggcgcgg	CRISPR spacer
ttgcagggccggcccggcctgtccggcgaaa	Protospacer
* **.**************.******** ..

119. spacer 1.1|1303059|31|NC_010407|CRT matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 6, identity: 0.806

tggcgg-ggccggcccggcccgtccggcgcgg	CRISPR spacer
-ggtgatgcccggcccgacccgtccggtgcgg	Protospacer
 **.*. * ********.*********.****

120. spacer 1.1|1303059|31|NC_010407|CRT matches to NC_048733 (Microbacterium phage Burro, complete genome) position: , mismatch: 6, identity: 0.806

tggcggggccggcccggcccgtccggcgcgg	CRISPR spacer
tcgaggcaccggcccggcccgtgcggcgcgt	Protospacer
* * ** .************** ******* 

121. spacer 1.2|1303119|28|NC_010407|CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 6, identity: 0.786

cgggggcggtgcttcccggccgcagcgt	CRISPR spacer
gtgtcgcggtggttcccggccgcaacgt	Protospacer
  *  ****** ************.***

122. spacer 1.2|1303119|28|NC_010407|CRT matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 6, identity: 0.786

cgggggcggtgcttcccggccgcagcgt	CRISPR spacer
gcgttgcggtggttcccggccgcaacgt	Protospacer
  *  ****** ************.***

123. spacer 1.3|1303176|31|NC_010407|CRT matches to NC_048733 (Microbacterium phage Burro, complete genome) position: , mismatch: 6, identity: 0.806

tggtggtgccggcccggcccgtccggcgcgg	CRISPR spacer
tcgaggcaccggcccggcccgtgcggcgcgt	Protospacer
* * **..************** ******* 

124. spacer 1.5|1303293|31|NC_010407|CRT matches to NZ_CP035092 (Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.806

tggcggagccgggtcggcccggcccgcgcgc	CRISPR spacer
gggcttggccggctcggccaggcccgcgcgc	Protospacer
 ***  .***** ****** ***********

125. spacer 1.5|1303293|31|NC_010407|CRT matches to NZ_LR134467 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 25, complete sequence) position: , mismatch: 6, identity: 0.806

tggcggagccgggtcggcccggcccgcgcgc	CRISPR spacer
gggcacggccggcccggcccggcccgcgcgc	Protospacer
 ***. .***** .*****************

126. spacer 1.5|1303293|31|NC_010407|CRT matches to NC_008688 (Paracoccus denitrificans PD1222 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.806

tggcggagccgggtcggcccggcccgcgcgc	CRISPR spacer
gggcttggccggctcggccaggcccgcgcgc	Protospacer
 ***  .***** ****** ***********

127. spacer 1.5|1303293|31|NC_010407|CRT matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 6, identity: 0.806

tggcggagccgggtcggcccggcccgcgcgc	CRISPR spacer
cggccgagccgggtcggcgcggcccagtcgc	Protospacer
.*** ************* ******.  ***

128. spacer 1.5|1303293|31|NC_010407|CRT matches to NC_014957 (Isosphaera pallida ATCC 43644 plasmid pISOP01, complete sequence) position: , mismatch: 6, identity: 0.806

tggcggagccgggtcggcccggcccgcgcgc	CRISPR spacer
tggcggagccgggtcggccgggtcgcaccgc	Protospacer
******************* **.*    ***

129. spacer 1.5|1303293|31|NC_010407|CRT matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.806

--tggcggagccgggtcggcccggcccgcgcgc	CRISPR spacer
gtcgtcg--gccgggtccgcccggcccgcgagc	Protospacer
  .* **  ******** ************ **

130. spacer 1.6|1303353|31|NC_010407|CRT matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 6, identity: 0.806

cggcggggccggagtggcgctgcctgcgcgt	CRISPR spacer
caacccggccggaggggcgcggcctgcgcgt	Protospacer
*..*  ******** ***** **********

131. spacer 1.6|1303353|31|NC_010407|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.806

cggcggggccggagtggcgctgcctgcgcgt-	CRISPR spacer
cggcgcggccggtgtggcgctg-ctgctggca	Protospacer
***** ****** ********* ****  *. 

132. spacer 1.6|1303353|31|NC_010407|CRT matches to KT287080 (Enterobacter phage phiEap-2, complete genome) position: , mismatch: 6, identity: 0.806

cggcggggccggagtggcgctgcctgcgcgt	CRISPR spacer
cgatgcggccgaagcggcgctgcctgcgcct	Protospacer
**..* *****.**.************** *

133. spacer 1.1|1303059|31|NC_010407|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.774

tggcggggccggcccggcccgtccggcgcgg	CRISPR spacer
tggcgggtccggcccggcccgtcgaccggtc	Protospacer
******* *************** . **   

134. spacer 1.1|1303059|31|NC_010407|CRT matches to NZ_CP013739 (Streptomyces globisporus C-1027 plasmid SGLP1, complete sequence) position: , mismatch: 7, identity: 0.774

tggcggggccggcccggcccgtccggcgcgg	CRISPR spacer
gtgcggggccggccgggcccgtcccgcttga	Protospacer
  ************ ********* ** .*.

135. spacer 1.1|1303059|31|NC_010407|CRT matches to MK801721 (Gordonia phage William, complete genome) position: , mismatch: 7, identity: 0.774

tggcggggccggcccggcccgtccggcgcgg	CRISPR spacer
gatccgggcccgcccggcccgcccggcgcga	Protospacer
 . * ***** **********.********.

136. spacer 1.1|1303059|31|NC_010407|CRT matches to NZ_CP015867 (Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence) position: , mismatch: 7, identity: 0.774

tggcggggccggcccggcccgtccggcgcgg--	CRISPR spacer
gggcggggcgggcccggcccgtc--accaggtc	Protospacer
 ******** *************  .*  **  

137. spacer 1.1|1303059|31|NC_010407|CRT matches to NZ_CP051544 (Paracoccus sanguinis strain OM2164 plasmid pPspOM44, complete sequence) position: , mismatch: 7, identity: 0.774

tggcggggccggcccggcccgtccggcgcgg	CRISPR spacer
ctgcccggcccgcccggcctgtccggcgcga	Protospacer
. **  **** ********.**********.

138. spacer 1.1|1303059|31|NC_010407|CRT matches to NZ_CP025549 (Mycobacterium paragordonae strain 49061 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.774

tggcggggccggcccggcccgtccggcgcgg	CRISPR spacer
aggattggccggcctggcccgtccggcacgc	Protospacer
 **   ********.************.** 

139. spacer 1.1|1303059|31|NC_010407|CRT matches to NC_016586 (Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence) position: , mismatch: 7, identity: 0.774

tggcggg--gccggcccggcccgtccggcgcgg	CRISPR spacer
--gccaaccgccagcccggcccggccggcgcgg	Protospacer
  ** ..  ***.********** *********

140. spacer 1.1|1303059|31|NC_010407|CRT matches to AF068845 (Mycobacteriophage TM4, complete genome) position: , mismatch: 7, identity: 0.774

tggcg-gggccggcccggcccgtccggcgcgg	CRISPR spacer
-gacacgaaccagcccggcccgaccggcgcgg	Protospacer
 *.*. *..**.********** *********

141. spacer 1.1|1303059|31|NC_010407|CRT matches to NC_003387 (Mycobacterium phage TM4, complete genome) position: , mismatch: 7, identity: 0.774

tggcg-gggccggcccggcccgtccggcgcgg	CRISPR spacer
-gacacgaaccagcccggcccgaccggcgcgg	Protospacer
 *.*. *..**.********** *********

142. spacer 1.1|1303059|31|NC_010407|CRT matches to NZ_CP015419 (Rhodovulum sulfidophilum DSM 1374 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774

tggcggggccggcccggcccgtccggcgcgg----	CRISPR spacer
tggcgcggcccgcccggcccgt----cgcgaaaac	Protospacer
***** **** ***********    ****.    

143. spacer 1.1|1303059|31|NC_010407|CRT matches to NZ_CP015422 (Rhodovulum sulfidophilum strain SNK001 plasmid, complete sequence) position: , mismatch: 7, identity: 0.774

tggcggggccggcccggcccgtccggcgcgg----	CRISPR spacer
tggcgcggcccgcccggcccgt----cgcgaaaac	Protospacer
***** **** ***********    ****.    

144. spacer 1.1|1303059|31|NC_010407|CRT matches to KC787101 (Mycobacterium phage 33D, partial genome) position: , mismatch: 7, identity: 0.774

tggcg-gggccggcccggcccgtccggcgcgg	CRISPR spacer
-gacacgaaccagcccggcccgaccggcgcgg	Protospacer
 *.*. *..**.********** *********

145. spacer 1.3|1303176|31|NC_010407|CRT matches to KY555145 (Caulobacter phage Ccr29, complete genome) position: , mismatch: 7, identity: 0.774

tggtggtgccggcccggcccgtccggcgcgg	CRISPR spacer
ccatgccgccggcccggcccgtcgggcgcgc	Protospacer
. .** .**************** ****** 

146. spacer 1.3|1303176|31|NC_010407|CRT matches to KY555143 (Caulobacter phage Ccr2, complete genome) position: , mismatch: 7, identity: 0.774

tggtggtgccggcccggcccgtccggcgcgg	CRISPR spacer
ccatgccgccggcccggcccgtcgggcgcgc	Protospacer
. .** .**************** ****** 

147. spacer 1.3|1303176|31|NC_010407|CRT matches to NC_019407 (Caulobacter phage CcrMagneto, complete genome) position: , mismatch: 7, identity: 0.774

tggtggtgccggcccggcccgtccggcgcgg	CRISPR spacer
ccatgccgccggcccggcccgtcgggcgcgc	Protospacer
. .** .**************** ****** 

148. spacer 1.3|1303176|31|NC_010407|CRT matches to KY555144 (Caulobacter phage Ccr5, complete genome) position: , mismatch: 7, identity: 0.774

tggtggtgccggcccggcccgtccggcgcgg	CRISPR spacer
ccatgccgccggcccggcccgtcgggcgcgc	Protospacer
. .** .**************** ****** 

149. spacer 1.3|1303176|31|NC_010407|CRT matches to KY555142 (Caulobacter phage Ccr10, complete genome) position: , mismatch: 7, identity: 0.774

tggtggtgccggcccggcccgtccggcgcgg	CRISPR spacer
ccatgccgccggcccggcccgtcgggcgcgc	Protospacer
. .** .**************** ****** 

150. spacer 1.3|1303176|31|NC_010407|CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 7, identity: 0.774

tggtggtgccggcccggcccgtccggcgcgg	CRISPR spacer
ctggcgtgccagcctggcccgtccggcgccg	Protospacer
. *  *****.***.************** *

151. spacer 1.3|1303176|31|NC_010407|CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 7, identity: 0.774

tggtggtgccggcccggcccgtccggcgcgg	CRISPR spacer
ctggcgtgccagcctggcccgtccggcgccg	Protospacer
. *  *****.***.************** *

152. spacer 1.3|1303176|31|NC_010407|CRT matches to NZ_KR152226 (Micrococcus sp. MG-2010-D12 plasmid pJD12, complete sequence) position: , mismatch: 7, identity: 0.774

tggtggtgccggcccggcccgtccggcgcgg	CRISPR spacer
cggcccggccggcccggcccggccggcccgg	Protospacer
.**.   ************** ***** ***

153. spacer 1.4|1303236|28|NC_010407|CRT matches to NC_024971 (Streptomyces rochei plasmid pSLA2-S DNA, complete sequence, strain: 7434AN4) position: , mismatch: 7, identity: 0.75

cgggggcggtgcctcgcggccgcagcgt	CRISPR spacer
cggcggcggtgcctcgcgggcgcgaaac	Protospacer
*** *************** ***.. ..

154. spacer 1.5|1303293|31|NC_010407|CRT matches to NZ_CP013415 (Burkholderia ubonensis strain MSMB2035 plasmid pMSMB2035, complete sequence) position: , mismatch: 7, identity: 0.774

tggcggagccgggtcggcccggcccgcgcgc	CRISPR spacer
acctcgcgccgggtcagcccggcccgcgcgc	Protospacer
   . * ********.***************

155. spacer 1.5|1303293|31|NC_010407|CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 7, identity: 0.774

tggcggagccgggtcggcccggcccgcgcgc	CRISPR spacer
gtgcacggccaggtcggcccggcccgcgagc	Protospacer
  **. .***.***************** **

156. spacer 1.5|1303293|31|NC_010407|CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 7, identity: 0.774

tggcggagccgggtcggcccggcccgcgcgc	CRISPR spacer
gtgcacggccaggtcggcccggcccgcgagc	Protospacer
  **. .***.***************** **

157. spacer 1.5|1303293|31|NC_010407|CRT matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 7, identity: 0.774

--tggcggagccgggtcggcccggcccgcgcgc	CRISPR spacer
atcggc--agccgggtcggcccggaccgcgatg	Protospacer
  .***  **************** *****   

158. spacer 1.5|1303293|31|NC_010407|CRT matches to NZ_CP020701 (Streptomyces tsukubensis strain NRRL 18488 plasmid pSTS1, complete sequence) position: , mismatch: 7, identity: 0.774

tggcggagccgggtcggcccggcccgcgcgc	CRISPR spacer
cggcggcgccgggtccgcccggcccagacgg	Protospacer
.***** ******** *********. .** 

159. spacer 1.5|1303293|31|NC_010407|CRT matches to NZ_CP006369 (Aureimonas sp. AU20 plasmid pAU20b, complete sequence) position: , mismatch: 7, identity: 0.774

tggcggagccgggtcggcccggcccgcgcgc-	CRISPR spacer
aggcgcagccaggtcggcccggccta-gcgtc	Protospacer
 **** ****.*************.. ***. 

160. spacer 1.1|1303059|31|NC_010407|CRT matches to KY555145 (Caulobacter phage Ccr29, complete genome) position: , mismatch: 8, identity: 0.742

tggcggggccggcccggcccgtccggcgcgg	CRISPR spacer
ccatgccgccggcccggcccgtcgggcgcgc	Protospacer
. ..*  **************** ****** 

161. spacer 1.1|1303059|31|NC_010407|CRT matches to KY555143 (Caulobacter phage Ccr2, complete genome) position: , mismatch: 8, identity: 0.742

tggcggggccggcccggcccgtccggcgcgg	CRISPR spacer
ccatgccgccggcccggcccgtcgggcgcgc	Protospacer
. ..*  **************** ****** 

162. spacer 1.1|1303059|31|NC_010407|CRT matches to NC_019407 (Caulobacter phage CcrMagneto, complete genome) position: , mismatch: 8, identity: 0.742

tggcggggccggcccggcccgtccggcgcgg	CRISPR spacer
ccatgccgccggcccggcccgtcgggcgcgc	Protospacer
. ..*  **************** ****** 

163. spacer 1.1|1303059|31|NC_010407|CRT matches to KY555144 (Caulobacter phage Ccr5, complete genome) position: , mismatch: 8, identity: 0.742

tggcggggccggcccggcccgtccggcgcgg	CRISPR spacer
ccatgccgccggcccggcccgtcgggcgcgc	Protospacer
. ..*  **************** ****** 

164. spacer 1.1|1303059|31|NC_010407|CRT matches to KY555142 (Caulobacter phage Ccr10, complete genome) position: , mismatch: 8, identity: 0.742

tggcggggccggcccggcccgtccggcgcgg	CRISPR spacer
ccatgccgccggcccggcccgtcgggcgcgc	Protospacer
. ..*  **************** ****** 

165. spacer 1.1|1303059|31|NC_010407|CRT matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.742

tggcggggccggcccggcccgtccggcgcgg	CRISPR spacer
cggcggggcccgcgcggcccgtccccccgga	Protospacer
.********* ** **********  *  *.

166. spacer 1.1|1303059|31|NC_010407|CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 8, identity: 0.742

tggcggggccggcccggcccgtccggcgcgg	CRISPR spacer
ggaacgggccggccctgcgcgtccggcggcg	Protospacer
 *.  ********** ** *********  *

167. spacer 1.1|1303059|31|NC_010407|CRT matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.742

tggcggggccggcccggcccgtccggcgcgg	CRISPR spacer
gggcggggccggcccggaccgccccggacac	Protospacer
 **************** ***.** * .*. 

168. spacer 1.1|1303059|31|NC_010407|CRT matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.742

tggcggggccggcccggcccgtccggcgcgg	CRISPR spacer
ggatcgtcccggcccggcacgtcctgcgcgg	Protospacer
 *.. *  ********** ***** ******

169. spacer 1.1|1303059|31|NC_010407|CRT matches to NZ_CP020385 (Rhodovulum sp. MB263 plasmid pRSMBA, complete sequence) position: , mismatch: 8, identity: 0.742

tggcggggccggcccggcccgtccggcgcgg	CRISPR spacer
tggcgcggcccgcccggcccgtcgcgaaagc	Protospacer
***** **** ************  * . * 

170. spacer 1.1|1303059|31|NC_010407|CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 8, identity: 0.742

tggcggggccggcccggcccgtccggcgcgg	CRISPR spacer
ggaacgggccggccctgcgcgtccggcggcg	Protospacer
 *.  ********** ** *********  *

171. spacer 1.1|1303059|31|NC_010407|CRT matches to NZ_AP014802 (Rhodovulum sulfidophilum plasmid Plasmid2 DNA, complete genome, strain: DSM 2351) position: , mismatch: 8, identity: 0.742

tggcggggccggcccggcccgtccggcgcgg	CRISPR spacer
tggcgcggcccgcccggcccgtcgcgaaagc	Protospacer
***** **** ************  * . * 

172. spacer 1.1|1303059|31|NC_010407|CRT matches to KY092482 (Streptomyces phage Mojorita, complete genome) position: , mismatch: 8, identity: 0.742

tggcggggccggcccggcccgtccggcgcgg	CRISPR spacer
gtgcggcgcccgcccggcccgtccgtacccg	Protospacer
  **** *** **************   * *

173. spacer 1.1|1303059|31|NC_010407|CRT matches to KY092480 (Streptomyces phage Picard, complete genome) position: , mismatch: 8, identity: 0.742

tggcggggccggcccggcccgtccggcgcgg	CRISPR spacer
gtgcggcgcccgcccggcccgtccgtacccg	Protospacer
  **** *** **************   * *

174. spacer 1.3|1303176|31|NC_010407|CRT matches to NZ_CP045548 (Streptomyces sp. SYP-A7193 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

tggtggtgccggcccggcccgtccggcgcgg	CRISPR spacer
gacctggaccggcccggcccgtccgtcgcgg	Protospacer
 . . * .***************** *****

175. spacer 1.3|1303176|31|NC_010407|CRT matches to KY555147 (Caulobacter phage Ccr34, complete genome) position: , mismatch: 8, identity: 0.742

tggtggtgccggcccggcccgtccggcgcgg	CRISPR spacer
ccatgcctccggcccggcccgtcgggcgcgc	Protospacer
. .** . *************** ****** 

176. spacer 1.3|1303176|31|NC_010407|CRT matches to KY555146 (Caulobacter phage Ccr32, complete genome) position: , mismatch: 8, identity: 0.742

tggtggtgccggcccggcccgtccggcgcgg	CRISPR spacer
ccatgcctccggcccggcccgtcgggcgcgc	Protospacer
. .** . *************** ****** 

177. spacer 1.3|1303176|31|NC_010407|CRT matches to JX163858 (Caulobacter phage phiCbK, complete genome) position: , mismatch: 8, identity: 0.742

tggtggtgccggcccggcccgtccggcgcgg	CRISPR spacer
ccatgcctccggcccggcccgtcgggcgcgc	Protospacer
. .** . *************** ****** 

178. spacer 1.3|1303176|31|NC_010407|CRT matches to NZ_CP025549 (Mycobacterium paragordonae strain 49061 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.742

tggtggtgccggcccggcccgtccggcgcgg	CRISPR spacer
aggattggccggcctggcccgtccggcacgc	Protospacer
 **    *******.************.** 

179. spacer 1.3|1303176|31|NC_010407|CRT matches to NZ_LR134467 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 25, complete sequence) position: , mismatch: 8, identity: 0.742

tggtggtgccggcccggcccgtccggcgcgg	CRISPR spacer
gggcacggccggcccggcccggcccgcgcgc	Protospacer
 **..  ************** ** ***** 

180. spacer 1.3|1303176|31|NC_010407|CRT matches to NZ_CP010865 (Marinovum algicola DG 898 plasmid pMaD10, complete sequence) position: , mismatch: 8, identity: 0.742

tggtggtgccggcccggcccgtccggcgcgg	CRISPR spacer
gatttttcccgccccggcctgtccggcgcgg	Protospacer
 . *  * *** *******.***********

181. spacer 1.3|1303176|31|NC_010407|CRT matches to MK814757 (Gordonia phage Fairfaxidum, complete genome) position: , mismatch: 8, identity: 0.742

tggtggtgccggcccggcccgtccggcgcgg	CRISPR spacer
gagccgggcccgcccggcccgcccggcgcga	Protospacer
 .*. * *** **********.********.

182. spacer 1.3|1303176|31|NC_010407|CRT matches to MN234161 (Gordonia phage Toast, complete genome) position: , mismatch: 8, identity: 0.742

tggtggtgccggcccggcccgtccggcgcgg	CRISPR spacer
gagccgggcccgcccggcccgcccggcgcga	Protospacer
 .*. * *** **********.********.

183. spacer 1.5|1303293|31|NC_010407|CRT matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.742

tggcggagccgggtcggcccggcccgcgcgc	CRISPR spacer
gtgaagagccgggtcagccgggcccgcgcct	Protospacer
  * .**********.*** ********* .

184. spacer 1.5|1303293|31|NC_010407|CRT matches to NZ_LR594668 (Variovorax sp. SRS16 plasmid 3) position: , mismatch: 8, identity: 0.742

tggcggagccgggtcggcccggcccgcgcgc	CRISPR spacer
gagatcagctgggtcggcccggcacgcgcga	Protospacer
 .*   ***.************* ****** 

185. spacer 1.5|1303293|31|NC_010407|CRT matches to NZ_CP024587 (Roseomonas sp. FDAARGOS_362 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.742

tggcggagccgggtcggcccggcccgcgcgc	CRISPR spacer
aagccgagccgggtcagcccggcccagacgg	Protospacer
 .** **********.*********. .** 

186. spacer 1.5|1303293|31|NC_010407|CRT matches to NZ_CP016078 (Actinoalloteichus sp. GBA129-24 plasmid pGBA129-24a, complete sequence) position: , mismatch: 8, identity: 0.742

tggcggagccgggtcggcccggcccgcgcgc	CRISPR spacer
gaccggagccggggcggcccgccccggtctc	Protospacer
 . ********** ******* ****  * *

187. spacer 1.6|1303353|31|NC_010407|CRT matches to NZ_CP024986 (Streptomyces lavendulae subsp. lavendulae strain CCM 3239 plasmid pSA3239, complete sequence) position: , mismatch: 8, identity: 0.742

cggcggggccggagtggcgctgcctgcgcgt	CRISPR spacer
cggcgcggccggcgtggcgctgctcgtcctc	Protospacer
***** ****** **********..*. * .

188. spacer 1.6|1303353|31|NC_010407|CRT matches to NC_024970 (Streptomyces aureofaciens strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 8, identity: 0.742

cggcggggccggagtggcgctgcctgcgcgt	CRISPR spacer
cggcgcggccggcgtggcgctgctcgtcctc	Protospacer
***** ****** **********..*. * .

189. spacer 1.6|1303353|31|NC_010407|CRT matches to NZ_KJ396772 (Streptomyces lavendulae subsp. lavendulae strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 8, identity: 0.742

cggcggggccggagtggcgctgcctgcgcgt	CRISPR spacer
cggcgcggccggcgtggcgctgctcgtcctc	Protospacer
***** ****** **********..*. * .

190. spacer 1.6|1303353|31|NC_010407|CRT matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

cggcggggccggagtggcgctgcctgcgcgt	CRISPR spacer
cggcttggccggagtggcgctgctggtcggc	Protospacer
****  *****************. *.  *.

191. spacer 1.1|1303059|31|NC_010407|CRT matches to KY555147 (Caulobacter phage Ccr34, complete genome) position: , mismatch: 9, identity: 0.71

tggcggggccggcccggcccgtccggcgcgg	CRISPR spacer
ccatgcctccggcccggcccgtcgggcgcgc	Protospacer
. ..*   *************** ****** 

192. spacer 1.1|1303059|31|NC_010407|CRT matches to KY555146 (Caulobacter phage Ccr32, complete genome) position: , mismatch: 9, identity: 0.71

tggcggggccggcccggcccgtccggcgcgg	CRISPR spacer
ccatgcctccggcccggcccgtcgggcgcgc	Protospacer
. ..*   *************** ****** 

193. spacer 1.1|1303059|31|NC_010407|CRT matches to JX163858 (Caulobacter phage phiCbK, complete genome) position: , mismatch: 9, identity: 0.71

tggcggggccggcccggcccgtccggcgcgg	CRISPR spacer
ccatgcctccggcccggcccgtcgggcgcgc	Protospacer
. ..*   *************** ****** 

194. spacer 1.1|1303059|31|NC_010407|CRT matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.71

tggcggggccggcccggcccgtccggcgcgg	CRISPR spacer
cggcgggggcggcccagcccgtccaggaacc	Protospacer
.******* ******.********.* .   

195. spacer 1.1|1303059|31|NC_010407|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71

tggcggggccggcccggcccgtccggcgcgg	CRISPR spacer
gacgggggccggaccggcgcgtccggcctga	Protospacer
 .  ******** ***** ******** .*.

196. spacer 1.3|1303176|31|NC_010407|CRT matches to NZ_CP031079 (Paracoccus yeei strain CCUG 32053 plasmid pYEE1, complete sequence) position: , mismatch: 9, identity: 0.71

tggtggtgccggcccggcccgtccggcgcgg	CRISPR spacer
ggcaggtgccggaccggcccttccggctgca	Protospacer
 *  ******** ******* ******   .

197. spacer 1.3|1303176|31|NC_010407|CRT matches to NC_016586 (Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence) position: , mismatch: 9, identity: 0.71

tggtggtgccggcccggcccgtccggcgcgg	CRISPR spacer
gccaaccgccagcccggcccggccggcgcgg	Protospacer
    . .***.********** *********

198. spacer 1.3|1303176|31|NC_010407|CRT matches to NZ_CP024426 (Paracoccus yeei strain TT13 plasmid pTT13-4, complete sequence) position: , mismatch: 9, identity: 0.71

tggtggtgccggcccggcccgtccggcgcgg	CRISPR spacer
ggcaggtgccggaccggcccttccggctgca	Protospacer
 *  ******** ******* ******   .

199. spacer 1.3|1303176|31|NC_010407|CRT matches to NZ_CP020445 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.71

tggtggtgccggcccggcccgtccggcgcgg	CRISPR spacer
ggcaggtgccggaccggcccttccggctgca	Protospacer
 *  ******** ******* ******   .

200. spacer 1.3|1303176|31|NC_010407|CRT matches to NZ_CP051544 (Paracoccus sanguinis strain OM2164 plasmid pPspOM44, complete sequence) position: , mismatch: 9, identity: 0.71

tggtggtgccggcccggcccgtccggcgcgg	CRISPR spacer
ctgcccggcccgcccggcctgtccggcgcga	Protospacer
. *.   *** ********.**********.

201. spacer 1.3|1303176|31|NC_010407|CRT matches to NZ_CP044079 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.71

tggtggtgccggcccggcccgtccggcgcgg	CRISPR spacer
ggcaggtgccggaccggcccttccggctgca	Protospacer
 *  ******** ******* ******   .

202. spacer 1.3|1303176|31|NC_010407|CRT matches to AF068845 (Mycobacteriophage TM4, complete genome) position: , mismatch: 9, identity: 0.71

tggtggtgccggcccggcccgtccggcgcgg	CRISPR spacer
gacacgaaccagcccggcccgaccggcgcgg	Protospacer
 .   * .**.********** *********

203. spacer 1.3|1303176|31|NC_010407|CRT matches to NC_003387 (Mycobacterium phage TM4, complete genome) position: , mismatch: 9, identity: 0.71

tggtggtgccggcccggcccgtccggcgcgg	CRISPR spacer
gacacgaaccagcccggcccgaccggcgcgg	Protospacer
 .   * .**.********** *********

204. spacer 1.3|1303176|31|NC_010407|CRT matches to CP054922 (Streptomyces sp. NA03103 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.71

tggtggtgccggcccggcccgtccggcgcgg	CRISPR spacer
agcaggtgccgggccggccggtccggccgcc	Protospacer
 *  ******** ****** *******    

205. spacer 1.3|1303176|31|NC_010407|CRT matches to NC_012520 (Rhodococcus opacus B4 plasmid pROB01, complete sequence) position: , mismatch: 9, identity: 0.71

tggtggtgccggcccggcccgtccggcgcgg	CRISPR spacer
ggtccgtgccggccaggcccgtgcggcggcc	Protospacer
 * . ********* ******* *****   

206. spacer 1.3|1303176|31|NC_010407|CRT matches to MK801721 (Gordonia phage William, complete genome) position: , mismatch: 9, identity: 0.71

tggtggtgccggcccggcccgtccggcgcgg	CRISPR spacer
gatccgggcccgcccggcccgcccggcgcga	Protospacer
 . . * *** **********.********.

207. spacer 1.3|1303176|31|NC_010407|CRT matches to KC787101 (Mycobacterium phage 33D, partial genome) position: , mismatch: 9, identity: 0.71

tggtggtgccggcccggcccgtccggcgcgg	CRISPR spacer
gacacgaaccagcccggcccgaccggcgcgg	Protospacer
 .   * .**.********** *********

208. spacer 1.5|1303293|31|NC_010407|CRT matches to NC_010311 (Streptomyces sp. HK1 plasmid pSHK1, complete sequence) position: , mismatch: 9, identity: 0.71

tggcggagccgggtcggcccggcccgcgcgc	CRISPR spacer
ccactcggccgggtcggccccgcacgcgcgg	Protospacer
. .*  .************* ** ****** 

209. spacer 1.5|1303293|31|NC_010407|CRT matches to NZ_CP046917 (Paraburkholderia sp. DHF22 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.71

tggcggagccgggtcggcccggcccgcgcgc	CRISPR spacer
tccgttccccggatcggcccgggccgcgcgc	Protospacer
*       ****.********* ********

210. spacer 1.6|1303353|31|NC_010407|CRT matches to NC_004954 (Micrococcus sp. 28 plasmid pSD10, complete sequence) position: , mismatch: 9, identity: 0.71

cggcggggccggagtggcgctgcctgcgcgt	CRISPR spacer
ttttcagcccggagtcgcgctgccagcgcgt	Protospacer
.  . .* ******* ******** ******

211. spacer 1.1|1303059|31|NC_010407|CRT matches to NZ_CP010865 (Marinovum algicola DG 898 plasmid pMaD10, complete sequence) position: , mismatch: 10, identity: 0.677

tggcggggccggcccggcccgtccggcgcgg	CRISPR spacer
gatttttcccgccccggcctgtccggcgcgg	Protospacer
 . .    *** *******.***********

212. spacer 1.5|1303293|31|NC_010407|CRT matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.677

tggcggagccgggtcggcccggcccgcgcgc	CRISPR spacer
gcatccagccggatcgtcccggcccgcgcat	Protospacer
  ..  ******.*** ************..

213. spacer 1.5|1303293|31|NC_010407|CRT matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 10, identity: 0.677

tggcggagccgggtcggcccggcccgcgcgc	CRISPR spacer
ctagttcgccgggtcggcacggaccgcgcgg	Protospacer
. .    *********** *** ******* 

214. spacer 1.6|1303353|31|NC_010407|CRT matches to NZ_CP032919 (Agrobacterium tumefaciens strain 15955 plasmid pAt15955, complete sequence) position: , mismatch: 10, identity: 0.677

cggcggggccggagtggcgctgcctgcgcgt	CRISPR spacer
tatttcagccgcagtggcgctgcctgcacga	Protospacer
.. .  .**** ***************.** 

215. spacer 1.6|1303353|31|NC_010407|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 10, identity: 0.677

cggcggggccggagtggcgctgcctgcgcgt	CRISPR spacer
tatttcagccgcagtggcgctgcctgcacga	Protospacer
.. .  .**** ***************.** 

216. spacer 1.1|1303059|31|NC_010407|CRT matches to NZ_CP022999 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence) position: , mismatch: 12, identity: 0.613

tggcggggccggcccggcccgtccggcgcgg---	CRISPR spacer
---cgagcgcggacaggccggcccggccccgcga	Protospacer
   **.*  *** * **** *.***** * *   

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 112655 : 122632 9 Pandoravirus(25.0%) tRNA,protease NA
DBSCAN-SWA_2 660036 : 666931 8 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_3 1022474 : 1089708 59 Prochlorococcus_phage(18.18%) transposase,holin NA
DBSCAN-SWA_4 1545093 : 1600188 42 Agrobacterium_phage(22.22%) tRNA,protease,transposase NA
DBSCAN-SWA_5 1950401 : 2029504 60 Diachasmimorpha_longicaudata_entomopoxvirus(25.0%) tRNA,protease,transposase NA
DBSCAN-SWA_6 2283209 : 2366770 58 Diachasmimorpha_longicaudata_entomopoxvirus(20.0%) protease,transposase NA
DBSCAN-SWA_7 2464945 : 2532266 54 Catovirus(25.0%) transposase NA
DBSCAN-SWA_8 3121766 : 3180302 59 Staphylococcus_phage(20.0%) protease,transposase NA
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NC_010407.1|WP_012299476.1|2294516_2294948_+|hypothetical-protein 2294516_2294948_+ 143 aa aa NA NA NA 2283209-2366770 yes
2. NC_010408
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_010408_1 86624-86699 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_010408_1 1.1|86648|28|NC_010408|CRISPRCasFinder 86648-86675 28 NC_010408 Clavibacter michiganensis subsp. sepedonicus plasmid pCSL1, complete sequence 86648-86675 0 1.0
NC_010408_1 1.1|86648|28|NC_010408|CRISPRCasFinder 86648-86675 28 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 553169-553196 4 0.857
NC_010408_1 1.1|86648|28|NC_010408|CRISPRCasFinder 86648-86675 28 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 1260369-1260396 4 0.857
NC_010408_1 1.1|86648|28|NC_010408|CRISPRCasFinder 86648-86675 28 MK894438 Microbacterium phage LilyLou, complete genome 4942-4969 4 0.857
NC_010408_1 1.1|86648|28|NC_010408|CRISPRCasFinder 86648-86675 28 NZ_CP021119 Streptomyces sp. CLI2509 strain CLI2905 plasmid unnamed1, complete sequence 30137-30164 5 0.821
NC_010408_1 1.1|86648|28|NC_010408|CRISPRCasFinder 86648-86675 28 NZ_CP054841 Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence 157230-157257 5 0.821
NC_010408_1 1.1|86648|28|NC_010408|CRISPRCasFinder 86648-86675 28 NZ_AP014579 Burkholderia sp. RPE67 plasmid p1, complete sequence 500706-500733 6 0.786
NC_010408_1 1.1|86648|28|NC_010408|CRISPRCasFinder 86648-86675 28 NC_010408 Clavibacter michiganensis subsp. sepedonicus plasmid pCSL1, complete sequence 3424-3451 7 0.75
NC_010408_1 1.1|86648|28|NC_010408|CRISPRCasFinder 86648-86675 28 NC_010408 Clavibacter michiganensis subsp. sepedonicus plasmid pCSL1, complete sequence 91342-91369 7 0.75

1. spacer 1.1|86648|28|NC_010408|CRISPRCasFinder matches to NC_010408 (Clavibacter michiganensis subsp. sepedonicus plasmid pCSL1, complete sequence) position: , mismatch: 0, identity: 1.0

ccacgctgtggtcggcgctcgccgaggc	CRISPR spacer
ccacgctgtggtcggcgctcgccgaggc	Protospacer
****************************

2. spacer 1.1|86648|28|NC_010408|CRISPRCasFinder matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 4, identity: 0.857

ccacgctgtggtcggcgctcgccgaggc	CRISPR spacer
gcccgctgtggacggcgcccgccgaggc	Protospacer
 * ******** ******.*********

3. spacer 1.1|86648|28|NC_010408|CRISPRCasFinder matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 4, identity: 0.857

ccacgctgtggtcggcgctcgccgaggc	CRISPR spacer
gcccgctgtggacggcgcccgccgaggc	Protospacer
 * ******** ******.*********

4. spacer 1.1|86648|28|NC_010408|CRISPRCasFinder matches to MK894438 (Microbacterium phage LilyLou, complete genome) position: , mismatch: 4, identity: 0.857

ccacgctgtggtcggcgctcgccgaggc	CRISPR spacer
cgacgctgtggtcgtcgctcgcccagtc	Protospacer
* ************ ******** ** *

5. spacer 1.1|86648|28|NC_010408|CRISPRCasFinder matches to NZ_CP021119 (Streptomyces sp. CLI2509 strain CLI2905 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

ccacgctgtggtcggcgctcgccgaggc	CRISPR spacer
ccgcgctgtggtcggtgctcgccgccgg	Protospacer
**.************.********  * 

6. spacer 1.1|86648|28|NC_010408|CRISPRCasFinder matches to NZ_CP054841 (Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

ccacgctgtggtcggcgctcgccgaggc	CRISPR spacer
gcccgctgcggtcggcgcgcgccgagtc	Protospacer
 * *****.********* ******* *

7. spacer 1.1|86648|28|NC_010408|CRISPRCasFinder matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.786

ccacgctgtggtcggcgctcgccgaggc	CRISPR spacer
tcacgctgtcgccggcgctcgccgcgct	Protospacer
.******** *.************ * .

8. spacer 1.1|86648|28|NC_010408|CRISPRCasFinder matches to NC_010408 (Clavibacter michiganensis subsp. sepedonicus plasmid pCSL1, complete sequence) position: , mismatch: 7, identity: 0.75

ccacgctgtggtcggcgctcgccgaggc	CRISPR spacer
ctggcgggtgttcggcgctcgccgaggc	Protospacer
*..    *** *****************

9. spacer 1.1|86648|28|NC_010408|CRISPRCasFinder matches to NC_010408 (Clavibacter michiganensis subsp. sepedonicus plasmid pCSL1, complete sequence) position: , mismatch: 7, identity: 0.75

ccacgctgtggtcggcgctcgccgaggc	CRISPR spacer
ctggcgggtgttcggcgctcgccgaggc	Protospacer
*..    *** *****************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage