Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_013511 Mycoplasma hominis ATCC 23114, complete genome 1 crisprs NA 0 1 1 0

Results visualization

1. NC_013511
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_013511_1 112562-112669 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_013511_1 1.1|112594|44|NC_013511|CRISPRCasFinder 112594-112637 44 NZ_LR214939 Mycoplasma salivarium strain NCTC10113 plasmid 2 664655-664698 0 1.0
NC_013511_1 1.1|112594|44|NC_013511|CRISPRCasFinder 112594-112637 44 NZ_CP054613 Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence 1581498-1581541 12 0.727

1. spacer 1.1|112594|44|NC_013511|CRISPRCasFinder matches to NZ_LR214939 (Mycoplasma salivarium strain NCTC10113 plasmid 2) position: , mismatch: 0, identity: 1.0

cttgcaccattgcggatgtagttcaatggtagaacatcaggttg	CRISPR spacer
cttgcaccattgcggatgtagttcaatggtagaacatcaggttg	Protospacer
********************************************

2. spacer 1.1|112594|44|NC_013511|CRISPRCasFinder matches to NZ_CP054613 (Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence) position: , mismatch: 12, identity: 0.727

cttgcaccattgcggatgtagttcaatggtagaacatcaggttg	CRISPR spacer
atctttcttttgcgggtgtagttcaatggtagaacttcagcctt	Protospacer
 *. . *. ******.******************* **** .* 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 548509 : 556539 6 Mycoplasma_phage(83.33%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage