1. spacer 2.10|1780677|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844
ggcgctg-tagcggtggggtttgccgtcgcggc CRISPR spacer
-gcgttgcttgcggtggggtatgccgccgcggc Protospacer
***.** * ********** *****.******
2. spacer 3.54|1788226|32|NC_014216|CRISPRCasFinder,CRT matches to JF412299 (EBPR siphovirus 4, partial sequence) position: , mismatch: 5, identity: 0.844
gatcatggtccgcatgctgctgccctggatca CRISPR spacer
gattcgggtgcgcatgctgatgccctggatca Protospacer
***. *** ********* ************
3. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP035512 (Haematobacter massiliensis strain OT1 plasmid pOT1-2, complete sequence) position: , mismatch: 6, identity: 0.812
tccagcagctcctccagctgcagg--ccgccgat CRISPR spacer
tccagcatctcctccagctggaggatctggcg-- Protospacer
******* ************ *** *.* **
4. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP029211 (Aquabacterium olei strain NBRC 110486 plasmid pTB101, complete sequence) position: , mismatch: 6, identity: 0.812
tccagcagctcctccagctgcaggccgccgat- CRISPR spacer
tccagcagatcctccagccgcagg-ggcagacg Protospacer
******** *********.***** ** **.
5. spacer 2.4|1780311|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812
tagtcggagcggatcagcgccaccatgtcggt CRISPR spacer
gaaccggagcgggtcagcgccaccacgtcggc Protospacer
*..********.************.*****.
6. spacer 2.4|1780311|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023551 (Rhodobacter sp. CZR27 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.812
tagtcgga-gcggatcagcgccaccatgtcggt CRISPR spacer
-agcagcacgcggatcagggcgaccatgtcggt Protospacer
**. * * ********* ** ***********
7. spacer 2.18|1781166|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 6, identity: 0.812
tcagttgcatgatgctcctccctggtcatagc CRISPR spacer
tcaggtgcatgctgctcctccctggtcgttat Protospacer
**** ****** ***************.* ..
8. spacer 2.28|1781777|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NC_006824 (Aromatoleum aromaticum EbN1 plasmid 2, complete sequence) position: , mismatch: 6, identity: 0.812
ctcaaccaggaggcaacacgatgaacgatgca CRISPR spacer
agcaacctggaggcaacacgatgaacgatctg Protospacer
***** ********************* ..
9. spacer 2.35|1782204|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to CP000622 (Burkholderia phage phiE255, complete genome) position: , mismatch: 6, identity: 0.812
gacacccgcatccaagacggcaagctacattt CRISPR spacer
gacacgcgcatcgaagacggcaagctcgaact Protospacer
***** ****** ************* * .*
10. spacer 2.35|1782204|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NC_009237 (Burkholderia phage phiE255 chromosome, complete genome) position: , mismatch: 6, identity: 0.812
gacacccgcatccaagacggcaagctacattt CRISPR spacer
gacacgcgcatcgaagacggcaagctcgaact Protospacer
***** ****** ************* * .*
11. spacer 2.35|1782204|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to AY539836 (Burkholderia cenocepacia phage BcepMu, complete genome) position: , mismatch: 6, identity: 0.812
gacacccgcatccaagacggcaagctacattt CRISPR spacer
gacacgcgcatcgaagacggcaagctcgaact Protospacer
***** ****** ************* * .*
12. spacer 3.53|1788165|33|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP022192 (Yangia pacifica strain YSBP01 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.818
gacggggc---aggccggcgagaatccagaggcgca CRISPR spacer
---gcggcccgaggctggcgagaatccagacgcgca Protospacer
* *** ****.************** *****
13. spacer 3.87|1790215|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to MN813685 (Gordonia phage Gudmit, complete genome) position: , mismatch: 6, identity: 0.812
ctggccgccatcggcgttggtgc---cgcgatttt CRISPR spacer
gtggccgccatcggcctcggtgccggcgcgat--- Protospacer
************** *.***** ******
14. spacer 2.1|1780128|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.781
gacggtgaagccctgctcctgccaatcgaagc CRISPR spacer
ggcgccgatgccctgctcctgcaaatcgacgg Protospacer
*.** .** ************* ****** *
15. spacer 2.2|1780189|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.781
gacggtgaagccctgctcctgccaatcgaagc CRISPR spacer
ggcgccgatgccctgctcctgcaaatcgacgg Protospacer
*.** .** ************* ****** *
16. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 7, identity: 0.781
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tgcagttcgtcctcgtgctgcaggccgccgat Protospacer
* ***. ***** ****************
17. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP025737 (Salmonella enterica strain FORC_079 plasmid pFORC79_2, complete sequence) position: , mismatch: 7, identity: 0.781
tccagcagctcctccagctgcaggccgccgat- CRISPR spacer
tcgagcagcgcctccagctgca-gcatctgctc Protospacer
** ****** ************ ** *.* *
18. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 7, identity: 0.781
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tgcagttcgtcctcgtgctgcaggccgccgat Protospacer
* ***. ***** ****************
19. spacer 2.4|1780311|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_HG938354 (Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence) position: , mismatch: 7, identity: 0.781
tagtcggagcggatcagcgccaccatgtcggt CRISPR spacer
atgacggagccgatcagcgccaccatgaaggc Protospacer
* ****** **************** **.
20. spacer 2.4|1780311|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP007214 (Burkholderia plantarii strain ATCC 43733 plasmid bpln_1p, complete sequence) position: , mismatch: 7, identity: 0.781
tagtcg--gagcggatcagcgccaccatgtcggt CRISPR spacer
--ctcggcgcgcggatcagcaccaccaggtcggc Protospacer
*** * **********.****** *****.
21. spacer 2.4|1780311|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 7, identity: 0.781
tagtcg-gagcggatcagcgccaccatgtcggt CRISPR spacer
-agctgcgcgccgatcagctccaccatgtcggc Protospacer
**..* * ** ******* ************.
22. spacer 2.5|1780372|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013069 (Pannonibacter phragmitetus strain 31801 plasmid p.p-1, complete sequence) position: , mismatch: 7, identity: 0.781
tttcactgtgccccagcagctcctgaaccagc CRISPR spacer
tctcgcccggccgcagcagctcctgcaccagc Protospacer
*.**.*. *** ************ ******
23. spacer 2.5|1780372|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032313 (Pannonibacter phragmitetus BB plasmid p.BB_1, complete sequence) position: , mismatch: 7, identity: 0.781
tttcactgtgccccagcagctcctgaaccagc CRISPR spacer
tctcgcccggccgcagcagctcctgcaccagc Protospacer
*.**.*. *** ************ ******
24. spacer 2.5|1780372|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to MT843276 (Serratia phage vB_SspS_OS31, complete genome) position: , mismatch: 7, identity: 0.781
tttcactgtgccccagcagctcctgaaccagc CRISPR spacer
cttcaaccggccccagcagctcctgccccagc Protospacer
.**** . **************** *****
25. spacer 2.10|1780677|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020539 (Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence) position: , mismatch: 7, identity: 0.781
ggcgctgtagcggtggggtttgccgtcgcggc CRISPR spacer
atcgctgtagcgctgggctttgccgtcatggt Protospacer
. ********** **** *********..**.
26. spacer 2.10|1780677|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP040452 (Halomonas sp. PA16-9 plasmid p_unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
ggcgc-tgtagcggtggggtttgccgtcgcggc CRISPR spacer
-gcgcacatagcggtggggttggccttcgcgaa Protospacer
**** ..************* *** *****.
27. spacer 2.11|1780738|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034154 (Rhodococcus sp. NJ-530 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781
cagttac--ccaccacaaacccacccacctaaca CRISPR spacer
--gctgccaccaacacaaacccacacacctaacg Protospacer
*.*.* *** *********** ********.
28. spacer 2.13|1780861|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KM085450 (Escherichia coli O104:H21 strain 94-3024 plasmid pO104_H21, complete sequence) position: , mismatch: 7, identity: 0.781
tgcgccacccatgatgcaattgcggctcgcac CRISPR spacer
ttcgcaaccaatgatgcaattgcggctttaag Protospacer
* *** *** *****************. *
29. spacer 2.13|1780861|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009107 (Escherichia coli strain 94-3024 plasmid pO104_H21, complete sequence) position: , mismatch: 7, identity: 0.781
tgcgccacccatgatgcaattgcggctcgcac CRISPR spacer
ttcgcaaccaatgatgcaattgcggctttaag Protospacer
* *** *** *****************. *
30. spacer 2.13|1780861|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027463 (Escherichia coli isolate 07-4299 plasmid unnamed) position: , mismatch: 7, identity: 0.781
tgcgccacccatgatgcaattgcggctcgcac CRISPR spacer
ttcgcaaccaatgatgcaattgcggctttaag Protospacer
* *** *** *****************. *
31. spacer 2.13|1780861|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027453 (Escherichia coli strain 2014C-3338 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
tgcgccacccatgatgcaattgcggctcgcac CRISPR spacer
ttcgcaaccaatgatgcaattgcggctttaag Protospacer
* *** *** *****************. *
32. spacer 2.13|1780861|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023542 (Escherichia coli O104:H21 str. CFSAN002236 strain ATCC BAA-178 plasmid pO104_H21, complete sequence) position: , mismatch: 7, identity: 0.781
tgcgccacccatgatgcaattgcggctcgcac CRISPR spacer
ttcgcaaccaatgatgcaattgcggctttaag Protospacer
* *** *** *****************. *
33. spacer 2.14|1780922|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013105 (Paraburkholderia caribensis strain MWAP64 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.781
ctggacctccttgcagaagccggaatcaaagc CRISPR spacer
ctcgcgatgcttgccgaagccggaatcacagc Protospacer
** * * ***** ************* ***
34. spacer 2.21|1781349|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034351 (Streptomyces sp. W1SF4 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781
gcctccgtgtccggaccgaacgacaggttgac CRISPR spacer
acctccgtgtccggaccggacggcagggccgc Protospacer
.*****************.***.**** . .*
35. spacer 2.21|1781349|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to MK937609 (Gordonia phage Sekhmet, complete genome) position: , mismatch: 7, identity: 0.781
gcctccgtgtccggaccgaacgacaggttgac CRISPR spacer
ggcgccgcgtccgcaccgaacgacaggtgatc Protospacer
* * ***.***** ************** . *
36. spacer 2.28|1781777|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NC_006824 (Aromatoleum aromaticum EbN1 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.781
ctcaaccaggaggcaacacgatgaacgatgca CRISPR spacer
agcaacctggaggcaatacgatgaacgatctg Protospacer
***** ********.************ ..
37. spacer 2.36|1782265|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
agctctgcctcgaacgtcacgccggggaaatg CRISPR spacer
cgcgctgcctcgaacgttacgccgacgacgtg Protospacer
** *************.******. ** .**
38. spacer 3.15|1785883|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP024791 (Nostoc flagelliforme CCNUN1 plasmid pNFSY06, complete sequence) position: , mismatch: 7, identity: 0.781
ttgtactt----actttctttcttctttgccatttt CRISPR spacer
----aattcaaaactttctttcttcttcaccatttt Protospacer
* ** ***************..*******
39. spacer 3.16|1785943|32|NC_014216|CRISPRCasFinder,CRT matches to NC_030917 (Gordonia phage OneUp, complete genome) position: , mismatch: 7, identity: 0.781
gaagcgcagcgacttgcggaactcttcgacct CRISPR spacer
tgaccgcagcgacatgcggagctcttcgttct Protospacer
.* ********* ******.******* .**
40. spacer 3.21|1786244|33|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP027239 (Dietzia sp. oral taxon 368 strain W5195 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.788
gcagatcaccccggccatggtcgatgcctacaa CRISPR spacer
cggcatcaccccggccatggtcgatggccacac Protospacer
. ********************** *.***
41. spacer 3.39|1787325|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP031226 (Pseudomonas amygdali pv. lachrymans str. M301315 plasmid pMPPla107, complete sequence) position: , mismatch: 7, identity: 0.781
gccatttgtttgtgggcataaaagtccgacag- CRISPR spacer
gcgatttgtttgtgggca-aaaaatcaaaccta Protospacer
** *************** ****.** .**
42. spacer 3.46|1787745|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
ttcccggagagcccggtcaacccggccttcct CRISPR spacer
ctgctgccgagcccgttcaacccgggcttcct Protospacer
.* *.* ******* ********* ******
43. spacer 3.54|1788226|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP044989 (Deinococcus sp. AJ005 plasmid p380k, complete sequence) position: , mismatch: 7, identity: 0.781
gatcatggtccgcatgctgctgccc---tggatca CRISPR spacer
gctcatggtgcgcaggctgctgcccagttggg--- Protospacer
* ******* **** ********** ***.
44. spacer 3.55|1788286|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.781
ccttgcagcgccgcccatagccgctggccgta CRISPR spacer
ctttgcatcgccgcccatagccgctgcaactc Protospacer
*.***** ****************** *
45. spacer 3.57|1788406|33|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023072 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666a, complete sequence) position: , mismatch: 7, identity: 0.788
gttgttatcagccgggctggtgcggatggtcca CRISPR spacer
gttgttaccagccgggctggagcgggacgccga Protospacer
*******.************ ****. *.* *
46. spacer 3.57|1788406|33|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023072 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666a, complete sequence) position: , mismatch: 7, identity: 0.788
gttgttatcagccgggctggtgcggatggtcca CRISPR spacer
gttgttaccagccgggctggagcgggacgccga Protospacer
*******.************ ****. *.* *
47. spacer 3.57|1788406|33|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023065 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631a, complete sequence) position: , mismatch: 7, identity: 0.788
gttgttatcagccgggctggtgcggatggtcca CRISPR spacer
gttgttaccagccgggctggagcgggacgccga Protospacer
*******.************ ****. *.* *
48. spacer 3.65|1788889|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045374 (Sulfitobacter sp. THAF37 plasmid pTHAF37_b, complete sequence) position: , mismatch: 7, identity: 0.781
acctgggcagagatccccgccagccattacaa CRISPR spacer
acctgggcagagatcccggccagagacgccag Protospacer
***************** ***** *. **.
49. spacer 3.80|1789794|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 7, identity: 0.781
tccaccgggccgctggaacccgccccgtttta CRISPR spacer
tccaccgggcggctggaactcgccgccggtca Protospacer
********** ********.**** * *.*
50. spacer 3.87|1790215|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.781
ctggccgccatcggcgttggtgccgcgatttt CRISPR spacer
ggcgcggccatcggcgtgggtgccgcgatgct Protospacer
** *********** *********** .*
51. spacer 3.87|1790215|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027239 (Dietzia sp. oral taxon 368 strain W5195 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
ctggccgccatcggcgttggtgccgcgatttt CRISPR spacer
ctggccgccgtcggcgttggtgacggtgatct Protospacer
*********.************ ** . *.*
52. spacer 3.91|1790455|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NC_020157 (Anabaena cylindrica PCC 7122 plasmid pANACY.02, complete sequence) position: , mismatch: 7, identity: 0.781
caaatggtggatgaaatgattgaataccttca CRISPR spacer
caaatgattgatgaaatgattgaaacctatga Protospacer
******.* *************** *. * *
53. spacer 3.103|1791176|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NC_011248 (Borrelia duttonii Ly plasmid pl35, complete sequence) position: , mismatch: 7, identity: 0.781
-ttcacgatattcattttatttgcctcattatt CRISPR spacer
acttat-ctattcattttattcgcctccttatt Protospacer
.*.*. *************.***** *****
54. spacer 3.103|1791176|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to MG250483 (Aeromonas phage Ah1, complete genome) position: , mismatch: 7, identity: 0.781
ttcacga---tattcattttatttgcctcattatt CRISPR spacer
---aagaacttattcattttattttcctcattagc Protospacer
* ** ************** ******** .
55. spacer 3.103|1791176|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to LR746311 (Shigella phage vB_SsoM_113 genome assembly, chromosome: 1) position: , mismatch: 7, identity: 0.781
ttcacgatattcattttatttgcctcattatt CRISPR spacer
ttgaaagttttcattttattttcctaattatt Protospacer
** * ..* ************ *** ******
56. spacer 3.115|1791897|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP042276 (Agrobacterium tumefaciens strain 186 plasmid pAt, complete sequence) position: , mismatch: 7, identity: 0.781
gatttcgccaacctgcacgatgcctggctgaa CRISPR spacer
gattccgccaaactgcacgatgccgacctggc Protospacer
****.****** ************ . ***.
57. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 8, identity: 0.75
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
gcgcgcagctcctccagcagcaggccgacctc Protospacer
* ************** ******** * .
58. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 8, identity: 0.75
---tccagcagctcctccagctgcaggccgccgat CRISPR spacer
gtgtcgcgca---cctccagcagcaggccgccgtc Protospacer
** *** ******** *********** .
59. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to AP021850 (Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome) position: , mismatch: 8, identity: 0.75
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
cgcagcagctgctccagcggcaggcccgccgt Protospacer
. ******** ******* ******* * .*
60. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 8, identity: 0.75
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tccagcagctcctcgagatgcagccggatcac Protospacer
************** ** ***** * * . *.
61. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 8, identity: 0.75
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
cccagcagctcctccagctcctggatgctggc Protospacer
.****************** * ** .**.*..
62. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP044332 (Methylocystis parvus strain BRCS2 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
ttgaccagctcctccaccggcaggccgcagtg Protospacer
*. * *********** * ********* *
63. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to NC_016586 (Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence) position: , mismatch: 8, identity: 0.75
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
cgcacgacctcgtccagctgcaggccggcgaa Protospacer
. ** * *** *************** ***
64. spacer 2.4|1780311|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017058 (Citrobacter freundii strain SL151 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
tagtcggagcggatcagcgccaccatgtcggt CRISPR spacer
tgcgcctcgcggatcagcgccaccatctcggc Protospacer
*. * ****************** ****.
65. spacer 2.4|1780311|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029730 (Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
tagtcggagcggatcagcgccaccatgtcggt CRISPR spacer
tgtgcctcgcggatcagcgccaccatctcggc Protospacer
*. * ****************** ****.
66. spacer 2.4|1780311|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026552 (Citrobacter sp. SL156 plasmid unnamed3) position: , mismatch: 8, identity: 0.75
tagtcggagcggatcagcgccaccatgtcggt CRISPR spacer
tgcgcctcgcggatcagcgccaccatctcggc Protospacer
*. * ****************** ****.
67. spacer 2.4|1780311|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP044976 (Hydrogenophaga sp. PBL-H3 substr. PBL-H3(B2) plasmid pPBL-H3_B2-1, complete sequence) position: , mismatch: 8, identity: 0.75
tagtcggagcggatcagcgccaccatgtcggt CRISPR spacer
tgcgcctcgcggatcagcgccaccatctcggc Protospacer
*. * ****************** ****.
68. spacer 2.4|1780311|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 8, identity: 0.75
tagtcggagcggatcagcgccaccatgtcggt CRISPR spacer
ccgtcatgacggatcagccccgccatgtcggt Protospacer
. ***. ..********* **.**********
69. spacer 2.4|1780311|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022191 (Yangia pacifica strain YSBP01 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
tagtcggagcggatcagcgccaccatgtcggt CRISPR spacer
gcgccgatgcggatcagctcctccatgtcggc Protospacer
*.**. ********** ** *********.
70. spacer 2.4|1780311|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 8, identity: 0.75
tagtcggagcggatcagcgccaccatgtcggt-- CRISPR spacer
acgtcggagcgcatcaacgccacca--ccggcag Protospacer
********* ****.******** .***.
71. spacer 2.4|1780311|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NC_008757 (Polaromonas naphthalenivorans CJ2 plasmid pPNAP01, complete sequence) position: , mismatch: 8, identity: 0.75
tagtcggagcggatcagcgccaccatgtcggt CRISPR spacer
tgggcctcgcggatcaacgccaccatctcggc Protospacer
*.* * ********.********* ****.
72. spacer 2.4|1780311|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010857 (Marinovum algicola DG 898 plasmid pMaD2, complete sequence) position: , mismatch: 8, identity: 0.75
tagtcggagcggatcagcgccacc--atgtcggt CRISPR spacer
caggcggagcggatcaacgccaccgggcatcg-- Protospacer
.** ************.******* ...***
73. spacer 2.4|1780311|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR026982 (Rhodoplanes piscinae isolate Rhod_plasmid plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75
tagtcggagcggatcagcgccaccatgtcggt CRISPR spacer
tggtgggagcggatcagcgcgaccagggacgc Protospacer
*.** *************** **** * *.
74. spacer 2.5|1780372|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049906 (Diaphorobacter sp. HDW4B plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
tttcactgtgccccagcagctcctgaaccagc CRISPR spacer
tgtccgagtgccccagcaactgctgaaccatg Protospacer
* ** ***********.** ********
75. spacer 2.9|1780616|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP054618 (Azospirillum oryzae strain KACC 14407 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.75
accctgcgtcgggtccagaagtatgccaccac CRISPR spacer
atctaccgttgggtccagaagtatgcccccga Protospacer
*.*. ***.***************** **.
76. spacer 2.10|1780677|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034355 (Pseudomonas aeruginosa strain IMP-13 plasmid pPYO_TB, complete sequence) position: , mismatch: 8, identity: 0.75
ggcgctgtagcggtggggtttgccgtcgcggc CRISPR spacer
gttgcgaaggcggtggggtctgcggtcgcggc Protospacer
* .** . .**********.*** ********
77. spacer 2.10|1780677|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to MN961671 (Pseudomonas aeruginosa strain 201330 plasmid p201330-IMP, complete sequence) position: , mismatch: 8, identity: 0.75
ggcgctgtagcggtggggtttgccgtcgcggc CRISPR spacer
gttgcgacggcggtggggtctgcggtcgcggc Protospacer
* .** ...**********.*** ********
78. spacer 2.10|1780677|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to MN961672 (Pseudomonas aeruginosa strain PA15W plasmid pPA15W-NR, complete sequence) position: , mismatch: 8, identity: 0.75
ggcgctgtagcggtggggtttgccgtcgcggc CRISPR spacer
gttgcgacggcggtggggtctgcggtcgcggc Protospacer
* .** ...**********.*** ********
79. spacer 2.13|1780861|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031899 (Escherichia coli O113:H21 strain FWSEC0010 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
tgcgccacccatgatgcaattgcggctcgcac CRISPR spacer
ttagcaaccaatgatgcaattgcggcttttag Protospacer
* ** *** *****************. .*
80. spacer 2.13|1780861|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KM085449 (Escherichia coli O104:H7 strain RM9387 plasmid pO104_H7, complete sequence) position: , mismatch: 8, identity: 0.75
tgcgccacccatgatgcaattgcggctcgcac CRISPR spacer
ttagcaaccaatgatgcaattgcggctttaag Protospacer
* ** *** *****************. *
81. spacer 2.13|1780861|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009105 (Escherichia coli strain RM9387 plasmid pO104_H7, complete sequence) position: , mismatch: 8, identity: 0.75
tgcgccacccatgatgcaattgcggctcgcac CRISPR spacer
ttagcaaccaatgatgcaattgcggctttaag Protospacer
* ** *** *****************. *
82. spacer 2.13|1780861|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027375 (Escherichia coli strain 05-3629 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
tgcgccacccatgatgcaattgcggctcgcac CRISPR spacer
ttagcaaccaatgatgcaattgcggctttaag Protospacer
* ** *** *****************. *
83. spacer 2.13|1780861|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028382 (Escherichia coli strain RM10466 plasmid pRM10466-1, complete sequence) position: , mismatch: 8, identity: 0.75
tgcgccacccatgatgcaattgcggctcgcac CRISPR spacer
ttagcaaccaatgatgcaattgcggcttttag Protospacer
* ** *** *****************. .*
84. spacer 2.13|1780861|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027441 (Escherichia coli strain 2012C-4502 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tgcgccacccatgatgcaattgcggctcgcac CRISPR spacer
ttagcaaccaatgatgcaattgcggcttttag Protospacer
* ** *** *****************. .*
85. spacer 2.13|1780861|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027585 (Escherichia coli strain 00-3076 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tgcgccacccatgatgcaattgcggctcgcac CRISPR spacer
ttagcaaccaatgatgcaattgcggcttttag Protospacer
* ** *** *****************. .*
86. spacer 2.13|1780861|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027458 (Escherichia coli strain 88-3493 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tgcgccacccatgatgcaattgcggctcgcac CRISPR spacer
ttagcaaccaatgatgcaattgcggcttttag Protospacer
* ** *** *****************. .*
87. spacer 2.13|1780861|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027451 (Escherichia coli strain 2014C-3097 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
tgcgccacccatgatgcaattgcggctcgcac CRISPR spacer
ttagcaaccaatgatgcaattgcggcttttag Protospacer
* ** *** *****************. .*
88. spacer 2.13|1780861|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027372 (Escherichia coli strain 2015C-3905 plasmid unnamed) position: , mismatch: 8, identity: 0.75
tgcgccacccatgatgcaattgcggctcgcac CRISPR spacer
ttagcaaccaatgatgcaattgcggcttttag Protospacer
* ** *** *****************. .*
89. spacer 2.13|1780861|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NC_007365 (Escherichia coli EH41 plasmid pO113, complete sequence) position: , mismatch: 8, identity: 0.75
tgcgccacccatgatgcaattgcggctcgcac CRISPR spacer
ttagcaaccaatgatgcaattgcggcttttag Protospacer
* ** *** *****************. .*
90. spacer 2.13|1780861|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024291 (Escherichia coli O178:H19 strain 2012C-4431 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
tgcgccacccatgatgcaattgcggctcgcac CRISPR spacer
ttagcaaccaatgatgcaattgcggcttttag Protospacer
* ** *** *****************. .*
91. spacer 2.13|1780861|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to CP027581 (Escherichia coli strain 2013C-4282 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
tgcgccacccatgatgcaattgcggctcgcac CRISPR spacer
ttagcaaccaatgatgcaattgcggctttaag Protospacer
* ** *** *****************. *
92. spacer 2.14|1780922|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
ctggacctccttgcagaagccggaatcaaagc CRISPR spacer
ctggacctccctgcagaagctggatccggcgg Protospacer
**********.*********.*** .*.. *
93. spacer 2.14|1780922|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029091 (Pseudomonas aeruginosa strain AR441 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
ctggac-ctccttgcagaagccggaatcaaagc CRISPR spacer
-tgtatgctcgttgctgaagccggaatcaagta Protospacer
** *. *** **** **************.
94. spacer 2.14|1780922|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to MN583270 (Pseudomonas aeruginosa strain NK546 plasmid pNK546b, complete sequence) position: , mismatch: 8, identity: 0.75
ctggac-ctccttgcagaagccggaatcaaagc CRISPR spacer
-tgcatgctcgttgcggaagccggaatcaagta Protospacer
** *. *** ****.**************.
95. spacer 2.14|1780922|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027167 (Pseudomonas aeruginosa strain AR_0356 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75
ctggac-ctccttgcagaagccggaatcaaagc CRISPR spacer
-tgtatgctcgttgctgaagccggaatcaagta Protospacer
** *. *** **** **************.
96. spacer 2.16|1781044|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022999 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence) position: , mismatch: 8, identity: 0.75
gatgacctgtcggacatgcagttcggcgaggt CRISPR spacer
catacgctgtcggccatgcagatcggcgacat Protospacer
**. ******* ******* ******* .*
97. spacer 2.17|1781105|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP018784 (Curtobacterium pusillum strain AA3 plasmid pCPAA3, complete sequence) position: , mismatch: 8, identity: 0.75
gggatcagcgccagcgggcgtccctcgtcatc CRISPR spacer
agcgtgcccgccaccgggcatccctcgtcatc Protospacer
.* .* ***** *****.************
98. spacer 2.17|1781105|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
gggatcagcgccagcgggcgtccctcgtcatc CRISPR spacer
gccgccagcgccagcgcgcgtcccttgtcgcc Protospacer
* ..*********** ********.***..*
99. spacer 2.21|1781349|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to MK820641 (Gordonia phage EnalisNailo, complete genome) position: , mismatch: 8, identity: 0.75
gcctccgtgtccggaccgaacgacaggttgac CRISPR spacer
gcagacgggtccgcaccgaacgacaggtgatc Protospacer
** ** ***** ************** . *
100. spacer 2.21|1781349|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to MK284520 (Gordonia phage Lilas, complete genome) position: , mismatch: 8, identity: 0.75
gcctccgtgtccggaccgaacgacaggttgac CRISPR spacer
gcagacgggtccgcaccgaacgacaggtgatc Protospacer
** ** ***** ************** . *
101. spacer 2.21|1781349|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to MN062715 (Gordonia phage Marteena, complete genome) position: , mismatch: 8, identity: 0.75
gcctccgtgtccggaccgaacgacaggttgac CRISPR spacer
gcagacgggtccgcaccgaacgacaggtgatc Protospacer
** ** ***** ************** . *
102. spacer 2.21|1781349|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to MK433275 (Gordonia phage EMsquaredA, complete genome) position: , mismatch: 8, identity: 0.75
gcctccgtgtccggaccgaacgacaggttgac CRISPR spacer
gcagacgggtccgcaccgaacgacaggtgatc Protospacer
** ** ***** ************** . *
103. spacer 2.21|1781349|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to MH513979 (Gordonia phage Pollux, complete genome) position: , mismatch: 8, identity: 0.75
gcctccgtgtccggaccgaacgacaggttgac CRISPR spacer
gcagacgggtccgcaccgaacgacaggtgatc Protospacer
** ** ***** ************** . *
104. spacer 2.24|1781533|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023526 (Cedecea neteri strain FDAARGOS_392 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gaaagatacctgaccactgctattaagcctgc CRISPR spacer
tagagaaaccagaccactgctattaaccagga Protospacer
*.*** *** *************** * *
105. spacer 2.26|1781655|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 8, identity: 0.75
aagtatgccctgcaaatgcaatggcaaatggc CRISPR spacer
gggcacgagcttcaaatacaatggcaaatggc Protospacer
..*.*.* ** *****.**************
106. spacer 2.32|1782021|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010723 (Phaeobacter piscinae strain P18 plasmid pP18_h, complete sequence) position: , mismatch: 8, identity: 0.75
gaggctgccgaggctatgcaccagccccgcgc CRISPR spacer
caggtgcgcgaggctatggaccagcgccgcga Protospacer
***. ********** ****** *****
107. spacer 2.32|1782021|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028920 (Gemmobacter sp. HYN0069 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
gaggctgccgaggctatgcaccagccccgcgc CRISPR spacer
caggtgcgcgaggctatggaccagcgccgcga Protospacer
***. ********** ****** *****
108. spacer 2.35|1782204|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NC_009669 (Ochrobactrum anthropi ATCC 49188 plasmid pOANT01, complete sequence) position: , mismatch: 8, identity: 0.75
gacacccgcatccaagacggcaagctacattt CRISPR spacer
gacacccgcatccacggcggcaagaaccgtcg Protospacer
************** *.******* *.*.
109. spacer 2.36|1782265|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75
agctctgcctcgaacgtcacgccggggaaatg CRISPR spacer
agaaaatgctcgaacgtcgcgccgggaaaatg Protospacer
** **********.*******.*****
110. spacer 2.36|1782265|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026559 (Pseudomonas amygdali pv. morsprunorum strain R15244 plasmid p2_tig3, complete sequence) position: , mismatch: 8, identity: 0.75
agctctgcctcgaacgtcacgccggggaaatg CRISPR spacer
ggcttgcgctcgaacgtctcgccgtggaaata Protospacer
.***. ********** ***** ******.
111. spacer 2.36|1782265|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LT963404 (Pseudomonas syringae pv. avii isolate CFBP3846 plasmid PP2, complete sequence) position: , mismatch: 8, identity: 0.75
agctctgcctcgaacgtcacgccggggaaatg CRISPR spacer
ggcttgcgctcgaacgtctcgccgtggaaata Protospacer
.***. ********** ***** ******.
112. spacer 2.36|1782265|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LT963405 (Pseudomonas syringae pv. avii isolate CFBP3846 plasmid PP3, complete sequence) position: , mismatch: 8, identity: 0.75
agctctgcctcgaacgtcacgccggggaaatg CRISPR spacer
ggcttgcgctcgaacgtctcgccgtggaaata Protospacer
.***. ********** ***** ******.
113. spacer 2.36|1782265|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LT985190 (Pseudomonas syringae group genomosp. 3 strain CFBP 3800 plasmid PP1, complete sequence) position: , mismatch: 8, identity: 0.75
agctctgcctcgaacgtcacgccggggaaatg CRISPR spacer
ggcttgcgctcgaacgtctcgccgtggaaata Protospacer
.***. ********** ***** ******.
114. spacer 2.36|1782265|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031227 (Pseudomonas amygdali pv. lachrymans str. M301315 plasmid pPla107-1, complete sequence) position: , mismatch: 8, identity: 0.75
agctctgcctcgaacgtcacgccggggaaatg CRISPR spacer
ggcttgcgctcgaacgtctcgccgtggaaata Protospacer
.***. ********** ***** ******.
115. spacer 2.36|1782265|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031228 (Pseudomonas amygdali pv. lachrymans str. M301315 plasmid pPla107-2) position: , mismatch: 8, identity: 0.75
agctctgcctcgaacgtcacgccggggaaatg CRISPR spacer
ggcttgcgctcgaacgtctcgccgtggaaata Protospacer
.***. ********** ***** ******.
116. spacer 2.36|1782265|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to LT985194 (Pseudomonas syringae strain CFBP 2116 genome assembly, plasmid: PP3) position: , mismatch: 8, identity: 0.75
agctctgcctcgaacgtcacgccggggaaatg CRISPR spacer
ggcttgcgctcgaacgtctcgccgtggaaata Protospacer
.***. ********** ***** ******.
117. spacer 2.36|1782265|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LT963413 (Pseudomonas syringae isolate CFBP3840 plasmid PP4, complete sequence) position: , mismatch: 8, identity: 0.75
agctctgcctcgaacgtcacgccggggaaatg CRISPR spacer
ggcttgcgctcgaacgtctcgccgtggaaata Protospacer
.***. ********** ***** ******.
118. spacer 2.36|1782265|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NC_019265 (Pseudomonas savastanoi NCPPB 3335 native plasmid pPsv48A complete sequence) position: , mismatch: 8, identity: 0.75
agctctgcctcgaacgtcacgccggggaaatg CRISPR spacer
ggcttgcgctcgaacgtctcgccgtggaaata Protospacer
.***. ********** ***** ******.
119. spacer 2.36|1782265|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_FR820585 (Pseudomonas savastanoi pv. savastanoi strain NCPPB 3335 plasmid pPsv48A, complete sequence) position: , mismatch: 8, identity: 0.75
agctctgcctcgaacgtcacgccggggaaatg CRISPR spacer
ggcttgcgctcgaacgtctcgccgtggaaata Protospacer
.***. ********** ***** ******.
120. spacer 2.36|1782265|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026563 (Pseudomonas avellanae strain R2leaf plasmid p1_tig4, complete sequence) position: , mismatch: 8, identity: 0.75
agctctgcctcgaacgtcacgccggggaaatg CRISPR spacer
ggcttgcgctcgaacgtctcgccgtggaaata Protospacer
.***. ********** ***** ******.
121. spacer 2.36|1782265|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026565 (Pseudomonas avellanae strain R2leaf plasmid p3_tig6, complete sequence) position: , mismatch: 8, identity: 0.75
agctctgcctcgaacgtcacgccggggaaatg CRISPR spacer
ggcttgcgctcgaacgtctcgccgtggaaata Protospacer
.***. ********** ***** ******.
122. spacer 2.37|1782326|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to AP021851 (Deinococcus grandis ATCC 43672 plasmid: pDEGR-2 DNA, complete genome) position: , mismatch: 8, identity: 0.75
tcctcgtgcgttgcccccgcctcgtctcgtac CRISPR spacer
tcgccgtgcgtggcccccgcctcgtctgccgg Protospacer
** .******* *************** ..
123. spacer 3.1|1785042|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP023670 (Methylomonas koyamae strain LM6 plasmid pLM6, complete sequence) position: , mismatch: 8, identity: 0.75
aagtccaccggctttgccgatatggacctgtg CRISPR spacer
aaaaaagccggctttgccgatatcgacgtggg Protospacer
**. .**************** *** ** *
124. spacer 3.5|1785282|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP016462 (Blastomonas sp. RAC04 plasmid pBSY18_1, complete sequence) position: , mismatch: 8, identity: 0.75
tgatggcccggacatcggcgacattgaaggat CRISPR spacer
cgatggcctgcacatcggcgacattcatgcca Protospacer
.*******.* ************** * *
125. spacer 3.5|1785282|32|NC_014216|CRISPRCasFinder,CRT matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 8, identity: 0.75
tgatggcccggacatcggcgacattgaaggat CRISPR spacer
cgatcagtcggacatcggcgacatcgagggaa Protospacer
.*** . .****************.**.***
126. spacer 3.14|1785823|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_KY494864 (Pseudomonas aeruginosa strain FFUP_PS_37 plasmid pJB37, complete sequence) position: , mismatch: 8, identity: 0.75
gtggccctttgcttcagccggacaaccatctt CRISPR spacer
ctgtcgggatgcttcagtcggacaacgatctt Protospacer
** * ********.******** *****
127. spacer 3.14|1785823|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_KU130294 (Pseudomonas putida strain 12969 plasmid p12969-DIM, complete sequence) position: , mismatch: 8, identity: 0.75
gtggccctttgcttcagccggacaaccatctt CRISPR spacer
ctgtcgggatgcttcagtcggacaacgatctt Protospacer
** * ********.******** *****
128. spacer 3.14|1785823|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_LT969519 (Pseudomonas aeruginosa isolate RW109 genome assembly, plasmid: RW109 plasmid 1) position: , mismatch: 8, identity: 0.75
gtggccctttgcttcagccggacaaccatctt CRISPR spacer
ctgtcgggatgcttcagtcggacaacgatctt Protospacer
** * ********.******** *****
129. spacer 3.14|1785823|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP009975 (Pseudomonas putida S12 plasmid pTTS12, complete sequence) position: , mismatch: 8, identity: 0.75
gtggccctttgcttcagccggacaaccatctt CRISPR spacer
ctgtcgggatgcttcagtcggacaacgatctt Protospacer
** * ********.******** *****
130. spacer 3.14|1785823|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP039989 (Pseudomonas aeruginosa strain T2436 plasmid pBT2436, complete sequence) position: , mismatch: 8, identity: 0.75
gtggccctttgcttcagccggacaaccatctt CRISPR spacer
ctgtcgggatgcttcagtcggacaacgatctt Protospacer
** * ********.******** *****
131. spacer 3.14|1785823|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP039991 (Pseudomonas aeruginosa strain T2101 plasmid pBT2101, complete sequence) position: , mismatch: 8, identity: 0.75
gtggccctttgcttcagccggacaaccatctt CRISPR spacer
ctgtcgggatgcttcagtcggacaacgatctt Protospacer
** * ********.******** *****
132. spacer 3.14|1785823|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_MN433457 (Pseudomonas aeruginosa strain PAB546 plasmid pNK546-KPC, complete sequence) position: , mismatch: 8, identity: 0.75
gtggccctttgcttcagccggacaaccatctt CRISPR spacer
ctgtcgggatgcttcagtcggacaacgatctt Protospacer
** * ********.******** *****
133. spacer 3.14|1785823|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP045003 (Pseudomonas aeruginosa strain PAG5 plasmid pPAG5, complete sequence) position: , mismatch: 8, identity: 0.75
gtggccctttgcttcagccggacaaccatctt CRISPR spacer
ctgtcgggatgcttcagtcggacaacgatctt Protospacer
** * ********.******** *****
134. spacer 3.14|1785823|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP045917 (Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence) position: , mismatch: 8, identity: 0.75
gtggccctttgcttcagccggacaaccatctt CRISPR spacer
ctgtcgggatgcttcagtcggacaacgatctt Protospacer
** * ********.******** *****
135. spacer 3.14|1785823|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP029094 (Pseudomonas aeruginosa strain AR441 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75
gtggccctttgcttcagccggacaaccatctt CRISPR spacer
ctgtcgggatgcttcagtcggacaacgatctt Protospacer
** * ********.******** *****
136. spacer 3.14|1785823|32|NC_014216|CRISPRCasFinder,CRT matches to MF344571 (Pseudomonas aeruginosa plasmid pR31014-IMP, complete sequence) position: , mismatch: 8, identity: 0.75
gtggccctttgcttcagccggacaaccatctt CRISPR spacer
ctgtcgggatgcttcagtcggacaacgatctt Protospacer
** * ********.******** *****
137. spacer 3.14|1785823|32|NC_014216|CRISPRCasFinder,CRT matches to MF344568 (Pseudomonas aeruginosa plasmid p727-IMP, complete sequence) position: , mismatch: 8, identity: 0.75
gtggccctttgcttcagccggacaaccatctt CRISPR spacer
ctgtcgggatgcttcagtcggacaacgatctt Protospacer
** * ********.******** *****
138. spacer 3.14|1785823|32|NC_014216|CRISPRCasFinder,CRT matches to MF344569 (Pseudomonas aeruginosa plasmid p12939-PER, complete sequence) position: , mismatch: 8, identity: 0.75
gtggccctttgcttcagccggacaaccatctt CRISPR spacer
ctgtcgggatgcttcagtcggacaacgatctt Protospacer
** * ********.******** *****
139. spacer 3.14|1785823|32|NC_014216|CRISPRCasFinder,CRT matches to MF344570 (Pseudomonas aeruginosa plasmid pA681-IMP, complete sequence) position: , mismatch: 8, identity: 0.75
gtggccctttgcttcagccggacaaccatctt CRISPR spacer
ctgtcgggatgcttcagtcggacaacgatctt Protospacer
** * ********.******** *****
140. spacer 3.14|1785823|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP039294 (Pseudomonas aeruginosa strain PABL048 plasmid pPABL048, complete sequence) position: , mismatch: 8, identity: 0.75
gtggccctttgcttcagccggacaaccatctt CRISPR spacer
ctgtcgggatgcttcagtcggacaacgatctt Protospacer
** * ********.******** *****
141. spacer 3.14|1785823|32|NC_014216|CRISPRCasFinder,CRT matches to CP027478 (Pseudomonas koreensis strain P19E3 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75
gtggccctttgcttcagccggacaaccatctt CRISPR spacer
ctgtcgggatgcttcagtcggacaacgatctt Protospacer
** * ********.******** *****
142. spacer 3.14|1785823|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP027170 (Pseudomonas aeruginosa strain AR_0356 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
gtggccctttgcttcagccggacaaccatctt CRISPR spacer
ctgtcgggatgcttcagtcggacaacgatctt Protospacer
** * ********.******** *****
143. spacer 3.14|1785823|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP040126 (Pseudomonas aeruginosa strain PA298 plasmid pBM908, complete sequence) position: , mismatch: 8, identity: 0.75
gtggccctttgcttcagccggacaaccatctt CRISPR spacer
ctgtcgggatgcttcagtcggacaacgatctt Protospacer
** * ********.******** *****
144. spacer 3.14|1785823|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP015879 (Pseudomonas citronellolis strain SJTE-3 plasmid pRBL16, complete sequence) position: , mismatch: 8, identity: 0.75
gtggccctttgcttcagccggacaaccatctt CRISPR spacer
ctgtcgggatgcttcagtcggacaacgatctt Protospacer
** * ********.******** *****
145. spacer 3.14|1785823|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP016215 (Pseudomonas aeruginosa strain PA121617 plasmid pBM413, complete sequence) position: , mismatch: 8, identity: 0.75
gtggccctttgcttcagccggacaaccatctt CRISPR spacer
ctgtcgggatgcttcagtcggacaacgatctt Protospacer
** * ********.******** *****
146. spacer 3.14|1785823|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_KY883660 (Pseudomonas putida strain SY153 plasmid pSY153-MDR, complete sequence) position: , mismatch: 8, identity: 0.75
gtggccctttgcttcagccggacaaccatctt CRISPR spacer
ctgtcgggatgcttcagtcggacaacgatctt Protospacer
** * ********.******** *****
147. spacer 3.15|1785883|32|NC_014216|CRISPRCasFinder,CRT matches to KF669662 (Bacillus phage Spock, complete genome) position: , mismatch: 8, identity: 0.75
ttgtacttactttctttcttctttgccatttt CRISPR spacer
ttgtacttaccctctttcttctttagagcatt Protospacer
**********..************. .. **
148. spacer 3.15|1785883|32|NC_014216|CRISPRCasFinder,CRT matches to JN797796 (Bacillus phage B5S, complete genome) position: , mismatch: 8, identity: 0.75
ttgtacttactttctttcttctttgccatttt CRISPR spacer
ttgtacttaccctctttcttctttagagcatt Protospacer
**********..************. .. **
149. spacer 3.15|1785883|32|NC_014216|CRISPRCasFinder,CRT matches to NC_018863 (Bacillus phage B4, complete genome) position: , mismatch: 8, identity: 0.75
ttgtacttactttctttcttctttgccatttt CRISPR spacer
ttgtacttaccctctttcttctttagagcatt Protospacer
**********..************. .. **
150. spacer 3.16|1785943|32|NC_014216|CRISPRCasFinder,CRT matches to NC_015685 (Oligotropha carboxidovorans OM5 plasmid pOC167, complete sequence) position: , mismatch: 8, identity: 0.75
gaagcgcagcgacttgcggaactctt--cgacct CRISPR spacer
tacgcgcagcgacatgcggaactgttgctggc-- Protospacer
* ********** ********* ** .*.*
151. spacer 3.25|1786485|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP045381 (Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence) position: , mismatch: 8, identity: 0.75
acggtgaaaatcttgtcgccggtttcgttaat CRISPR spacer
acggtgaaaatcatgtcgtcggttgagctgtc Protospacer
************ *****.***** *.*. .
152. spacer 3.35|1787085|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP015867 (Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence) position: , mismatch: 8, identity: 0.75
tcggat---atcaccgagacgcagaccacgatcca CRISPR spacer
---gatgtagtcaccgagactcagcccacgatcag Protospacer
*** .********** *** ******** .
153. spacer 3.36|1787145|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP010676 (Phaeobacter gallaeciensis strain P75 plasmid pP75_c, complete sequence) position: , mismatch: 8, identity: 0.75
tcctccgc-caatcgtgatccgaaccccggtca CRISPR spacer
-attgggcacaaccgtgatcagaaccccggtcg Protospacer
.* ** ***.******* ***********.
154. spacer 3.36|1787145|32|NC_014216|CRISPRCasFinder,CRT matches to NC_023139 (Phaeobacter gallaeciensis DSM 26640 plasmid pGal_C110, complete sequence) position: , mismatch: 8, identity: 0.75
tcctccgc-caatcgtgatccgaaccccggtca CRISPR spacer
-attgggcacaaccgtgatcagaaccccggtcg Protospacer
.* ** ***.******* ***********.
155. spacer 3.36|1787145|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP010591 (Phaeobacter gallaeciensis strain P11 plasmid pP11_c, complete sequence) position: , mismatch: 8, identity: 0.75
tcctccgc-caatcgtgatccgaaccccggtca CRISPR spacer
-attgggcacaaccgtgatcagaaccccggtcg Protospacer
.* ** ***.******* ***********.
156. spacer 3.41|1787445|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP046575 (Rhodococcus sp. WAY2 plasmid pRWAY03, complete sequence) position: , mismatch: 8, identity: 0.75
gttgaaaataaccctcatcgtttcacctcgat CRISPR spacer
actacacagaaccctcatcgattcaccgcgat Protospacer
..*. * * *********** ****** ****
157. spacer 3.50|1787985|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP015419 (Rhodovulum sulfidophilum DSM 1374 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
ggtgacaacatcctcgccgcccctgtctggtc CRISPR spacer
tgcggccgcatccgcgccgccccggtctggtt Protospacer
*.*.* .***** ********* *******.
158. spacer 3.50|1787985|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP015422 (Rhodovulum sulfidophilum strain SNK001 plasmid, complete sequence) position: , mismatch: 8, identity: 0.75
ggtgacaacatcctcgccgcccctgtctggtc CRISPR spacer
tgcggccgcatccgcgccgccccggtctggtt Protospacer
*.*.* .***** ********* *******.
159. spacer 3.54|1788226|32|NC_014216|CRISPRCasFinder,CRT matches to NC_016654 (Rhodococcus phage REQ3, complete genome) position: , mismatch: 8, identity: 0.75
-gatcatggtccgcatgctgctgccctggatca CRISPR spacer
cgactac-atccgcatcctgctgcgctggatcg Protospacer
**..*. .******* ******* *******.
160. spacer 3.62|1788709|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020041 (Streptomyces sp. 3211 isolate 3 plasmid p3211-2, complete sequence) position: , mismatch: 8, identity: 0.75
cctgcgtagcagtttccggggccggaactcaa CRISPR spacer
caggcgcagcagttgccggggccggaccggga Protospacer
* ***.******* *********** * .*
161. spacer 3.62|1788709|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to MF185719 (Mycobacterium phage Edugator, complete genome) position: , mismatch: 8, identity: 0.75
cctgcgtagcagtttccggggccggaactcaa CRISPR spacer
ctcgcggagcggtttccggggccggatcacgc Protospacer
*..*** ***.*************** * *.
162. spacer 3.65|1788889|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to LR597649 (Escherichia phage ESSI2_ev015 genome assembly, chromosome: 1) position: , mismatch: 8, identity: 0.75
acctgggcagagatccccgccagccattacaa CRISPR spacer
gctgaagcaaagatccccgccagccatttcac Protospacer
.*. ..***.****************** **
163. spacer 3.65|1788889|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NC_049393 (Escherichia phage ESSI2_ev040 genome assembly, chromosome: 1) position: , mismatch: 8, identity: 0.75
acctgggcagagatccccgccagccattacaa CRISPR spacer
gctgaagcaaagatccccgccagccatttcac Protospacer
.*. ..***.****************** **
164. spacer 3.65|1788889|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NC_049394 (Escherichia phage ESSI2_ev129 genome assembly, chromosome: 1) position: , mismatch: 8, identity: 0.75
acctgggcagagatccccgccagccattacaa CRISPR spacer
gctgaagcaaagatccccgccagccatttcac Protospacer
.*. ..***.****************** **
165. spacer 3.73|1789370|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020441 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
gaaccactgctttccggcctgcggctggtgct CRISPR spacer
catgcgccgctttccggccagccgctggtgcg Protospacer
* *.*.*********** ** ********
166. spacer 3.80|1789794|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75
tccaccgggccgctggaacccgccccgtttta CRISPR spacer
ctcaccgggccgctggatcccggcctcttcca Protospacer
..*************** **** **. **..*
167. spacer 3.80|1789794|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to MF541405 (Streptomyces phage Celeste, complete genome) position: , mismatch: 8, identity: 0.75
tccaccgggccgctggaacccgccccgtttta CRISPR spacer
gcgaccgtgccgctggaacgcgccccaggtga Protospacer
* **** *********** ******. * *
168. spacer 3.80|1789794|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to KX507345 (Streptomyces phage Brataylor, complete genome) position: , mismatch: 8, identity: 0.75
tccaccgggccgctggaacccgccccgtttta CRISPR spacer
gcgaccgtgccgctggaacgcgccccaggtga Protospacer
* **** *********** ******. * *
169. spacer 3.80|1789794|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NC_041860 (Streptomyces phage Danzina, complete genome) position: , mismatch: 8, identity: 0.75
tccaccgggccgctggaacccgccccgtttta CRISPR spacer
gcgaccgtgccgctggaacgcgccccaggtga Protospacer
* **** *********** ******. * *
170. spacer 3.80|1789794|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NC_021339 (Streptomyces phage Zemlya, complete genome) position: , mismatch: 8, identity: 0.75
tccaccgggccgctggaacccgccccgtttta CRISPR spacer
gcgaccgtgccgctggaacgcgccccaggtga Protospacer
* **** *********** ******. * *
171. spacer 3.87|1790215|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021116 (Rhodobacteraceae bacterium strain G7 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
ctggccgccatcggcgttggtgccgcgatttt CRISPR spacer
gtcatcgccatcggcggcggtgccgcgattga Protospacer
* ..*********** .************
172. spacer 3.92|1790515|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP006991 (Rhizobium sp. IE4771 plasmid pRetIE4771e, complete sequence) position: , mismatch: 8, identity: 0.75
gccggggatcagtcgggtgcgcaggtcgtcct CRISPR spacer
ggctgacatcggtcgggcgcgcaggtcgtcgc Protospacer
* * *. ***.******.************ .
173. spacer 3.92|1790515|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021128 (Rhizobium sp. Kim5 plasmid pRetKim5d, complete sequence) position: , mismatch: 8, identity: 0.75
gccggggatcagtcgggtgcgcaggtcgtcct CRISPR spacer
ggctgacatcggtcgggcgcgcaggtcgtcgc Protospacer
* * *. ***.******.************ .
174. spacer 3.92|1790515|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to CP007645 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803d, complete sequence) position: , mismatch: 8, identity: 0.75
gccggggatcagtcgggtgcgcaggtcgtcct CRISPR spacer
ggctgacatcggtcgggcgcgcaggtcgtcgc Protospacer
* * *. ***.******.************ .
175. spacer 3.94|1790635|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NC_004719 (Streptomyces avermitilis MA-4680 = NBRC 14893 plasmid SAP1, complete sequence) position: , mismatch: 8, identity: 0.75
-cggtggagcaacaaagcgaagcgtcgggcctt CRISPR spacer
gccgt-ctgcaacaaagcgaggcgtcggccccg Protospacer
* ** ************.******* **.
176. spacer 3.99|1790936|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015623 (Corynebacterium crudilactis strain JZ16 plasmid pCRULAC1, complete sequence) position: , mismatch: 8, identity: 0.75
ctccagccaggccagggagtactgatagtact CRISPR spacer
ctttccccaggcatgggagtactgatagtcca Protospacer
**.. ****** *************** *
177. spacer 3.103|1791176|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NC_011250 (Borrelia duttonii Ly plasmid pl40, complete sequence) position: , mismatch: 8, identity: 0.75
ttcacgatattcattttatttgcctcattatt CRISPR spacer
acttctctattcattttctttgcctccttatt Protospacer
.. * ********** ******** *****
178. spacer 3.103|1791176|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NC_008442 (Borrelia duttonii plasmid DNA, complete sequence, strain: Ly) position: , mismatch: 8, identity: 0.75
ttcacgatattcattttatttgcctcattatt CRISPR spacer
ccttctacattcattttctttgcctccttatt Protospacer
... * *.********* ******** *****
179. spacer 3.110|1791597|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020910 (Rhizobium etli strain NXC12 plasmid pRetNXC12d, complete sequence) position: , mismatch: 8, identity: 0.75
gtcgggaaggttgatggcgtcgatgttgatca CRISPR spacer
gtcgggaaggtcggtggcgtcgaacatggtgg Protospacer
***********.*.********* **.* .
180. spacer 3.112|1791717|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to MK373790 (Escherichia phage vB_EcoS_WF5505, complete genome) position: , mismatch: 8, identity: 0.75
tttgcccggtacttgctggcctggcgcttggt CRISPR spacer
cctacgccgtattcgctggcctggcgcttggc Protospacer
..*.* * ***.*.*****************.
181. spacer 3.112|1791717|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to MK373790 (Escherichia phage vB_EcoS_WF5505, complete genome) position: , mismatch: 8, identity: 0.75
tttgcccggtacttgctggcctggcgcttggt CRISPR spacer
cctacgccgtattcgctggcctggcgcttggc Protospacer
..*.* * ***.*.*****************.
182. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
gcgcgcagttcctccagcagcaggccgacctc Protospacer
* ****.********* ******** * .
183. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 9, identity: 0.719
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tccagcagctcgtccagccgcagctggggcag Protospacer
*********** ******.**** . * *
184. spacer 2.4|1780311|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
--tagtcggagcggatcagcgccaccatgtcggt CRISPR spacer
ttcagct--tgcggatctccgccaccatgtcggc Protospacer
.**.. ******* **************.
185. spacer 2.4|1780311|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 9, identity: 0.719
--tagtcggagcggatcagcgccaccatgtcggt CRISPR spacer
ttcagct--tgcggatctccgccaccatgtcggc Protospacer
.**.. ******* **************.
186. spacer 2.4|1780311|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 9, identity: 0.719
--tagtcggagcggatcagcgccaccatgtcggt CRISPR spacer
ttcagct--tgcggatctccgccaccatgtcggc Protospacer
.**.. ******* **************.
187. spacer 2.4|1780311|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
--tagtcggagcggatcagcgccaccatgtcggt CRISPR spacer
ttcagct--tgcggatctccgccaccatgtcggc Protospacer
.**.. ******* **************.
188. spacer 2.4|1780311|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015867 (Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence) position: , mismatch: 9, identity: 0.719
tagtcggagcggatcagcgccaccatgtcggt CRISPR spacer
cggccggagcggtacagcgccaccatggcctg Protospacer
..*.******** ************* *
189. spacer 2.4|1780311|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026305 (Streptomyces lunaelactis strain MM109 plasmid pSLUN1, complete sequence) position: , mismatch: 9, identity: 0.719
tagtcggagcggatcagcgccaccatgtcggt CRISPR spacer
cggccggagcggtacagcgccaccatggcctg Protospacer
..*.******** ************* *
190. spacer 2.4|1780311|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.719
tagtcggagcggatcagcgccaccatgtcggt CRISPR spacer
tcctcggaacggttcagcgccaccatcatcgc Protospacer
* *****.*** ************* . *.
191. spacer 2.4|1780311|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 9, identity: 0.719
tagtcggagcggatcagcgccaccatgtcggt CRISPR spacer
tcctcggaacggttcagcgccaccatcatcgc Protospacer
* *****.*** ************* . *.
192. spacer 2.4|1780311|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
tagtcggagcggatcagcgccaccatgtcggt CRISPR spacer
agcacggagcggatcagccccgccatgcccgc Protospacer
. ************** **.*****.* *.
193. spacer 2.4|1780311|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 9, identity: 0.719
tagtcggagcggatcagcgccaccatgtcggt-- CRISPR spacer
acgtcggagcgcatcaacgccacca--ccagcag Protospacer
********* ****.******** .*.*.
194. spacer 2.4|1780311|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
--tagtcggagcggatcagcgccaccatgtcggt CRISPR spacer
ttcagct--tgcggatctccgccaccatgtcggc Protospacer
.**.. ******* **************.
195. spacer 2.4|1780311|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 9, identity: 0.719
--tagtcggagcggatcagcgccaccatgtcggt CRISPR spacer
ttcagct--tgcggatctccgccaccatgtcggc Protospacer
.**.. ******* **************.
196. spacer 2.4|1780311|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
tagtcggagcggatcagcgccaccatgtcggt CRISPR spacer
tcctccgagcggttcagcgccaccatcatcgc Protospacer
* ** ****** ************* . *.
197. spacer 2.4|1780311|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045549 (Streptomyces sp. SYP-A7193 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
tagtcggagcggatcagcgccaccatgtcggt CRISPR spacer
cggccggagcggtacagcgccaccatggcctg Protospacer
..*.******** ************* *
198. spacer 2.5|1780372|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020539 (Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence) position: , mismatch: 9, identity: 0.719
tttcactgtgccccagcagctcctgaaccagc CRISPR spacer
tctgcaaccgccccagcagctcctcaaacagc Protospacer
*.* .*************** ** ****
199. spacer 2.5|1780372|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to KY940711 (Bradyrhizobium phage BDU-MI-1, complete genome) position: , mismatch: 9, identity: 0.719
tttcactgtgccccagcagctcctgaaccagc CRISPR spacer
ctttcgaacgccccagcagcttctgcaccagc Protospacer
.**. ..************.*** ******
200. spacer 2.8|1780555|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013255 (Kocuria flava strain HO-9041 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.719
ggtcggggtcggggtggcggtgtctttaattt CRISPR spacer
ggtcggggccggggtgccggtgtccgggttcg Protospacer
********.******* *******. . *.
201. spacer 2.8|1780555|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LN832562 (Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence) position: , mismatch: 9, identity: 0.719
ggtcggggtcggggtggcggtgtctttaattt CRISPR spacer
tgtcggggtcgtagtggcggtgtcggttgtag Protospacer
********** .*********** * .*
202. spacer 2.8|1780555|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
ggtcggggtcggggtggcggtgtctttaattt CRISPR spacer
ggtcggggtcacggtggcggtgtgccggatgg Protospacer
**********. *********** .. .**
203. spacer 2.10|1780677|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NC_007959 (Nitrobacter hamburgensis X14 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.719
ggcgctgtagcggtggggtttgccgtcgcggc CRISPR spacer
ggcgctggtgcggtggggtttgcggctcgagg Protospacer
******* ************** *.. .*
204. spacer 2.16|1781044|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.719
gatgacctgtcggacatgcagttcggcgaggt CRISPR spacer
gtcaacctgtcgcccatgcagttcggccaccc Protospacer
* ..******** ************* * .
205. spacer 2.20|1781288|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgcttgcgccgctcctcgctcatctcagagac CRISPR spacer
tgcttgcgctgttcctcgctcatccaaccaag Protospacer
.********.*.************. * .*
206. spacer 2.20|1781288|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to KM659093 (Paracoccus yeei strain LM20 plasmid pLM20P1, complete sequence) position: , mismatch: 9, identity: 0.719
cgcttgcgccgctcctcgctcatctcagagac CRISPR spacer
tccttgcgccgctcctcggtcagcttgggcag Protospacer
. **************** *** **..*. *
207. spacer 2.20|1781288|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgcttgcgccgctcctcgctcatctcagagac CRISPR spacer
tgcttgcgctgttcctcgctcatccaaccaag Protospacer
.********.*.************. * .*
208. spacer 2.22|1781410|33|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP042333 (Bosea sp. F3-2 plasmid pB32-2, complete sequence) position: , mismatch: 9, identity: 0.727
cccgatgctggagcgggtaccacgttctcatcc CRISPR spacer
gacgatgctggagcgcgtatcacgttgataatc Protospacer
************* ***.****** .* .*
209. spacer 2.23|1781472|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to AP014051 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C12B-MedDCM-OCT-S26-C131, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 9, identity: 0.719
tggttggaggggctggaatggtagccactgag CRISPR spacer
tactgcttggggctggaatggtacgcactgac Protospacer
*. * *************** ******
210. spacer 2.23|1781472|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to AP014056 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C12B-MedDCM-OCT-S41-C215, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 9, identity: 0.719
tggttggaggggctggaatggtagccactgag CRISPR spacer
tactgcttggggctggaatggtacgcactgac Protospacer
*. * *************** ******
211. spacer 2.23|1781472|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to AP014054 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C12B-MedDCM-OCT-S33-C14, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 9, identity: 0.719
tggttggaggggctggaatggtagccactgag CRISPR spacer
tactgcttggggctggaatggtacgcactgac Protospacer
*. * *************** ******
212. spacer 2.23|1781472|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to AP014483 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C12B-MedDCM-OCT-S39-C115, *** SEQUENCING IN PROGRESS ***, 2 ordered pieces) position: , mismatch: 9, identity: 0.719
tggttggaggggctggaatggtagccactgag CRISPR spacer
tactgcttggggctggaatggtacgcactgac Protospacer
*. * *************** ******
213. spacer 2.23|1781472|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to AP014052 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C12B-MedDCM-OCT-S27-C13, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 9, identity: 0.719
tggttggaggggctggaatggtagccactgag CRISPR spacer
tactgcttggggctggaatggtacgcactgac Protospacer
*. * *************** ******
214. spacer 2.23|1781472|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to AP014053 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C12B-MedDCM-OCT-S29-C16, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 9, identity: 0.719
tggttggaggggctggaatggtagccactgag CRISPR spacer
tactgcttggggctggaatggtacgcactgac Protospacer
*. * *************** ******
215. spacer 2.23|1781472|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to AP014058 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C12B-MedDCM-OCT-S42-C22, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 9, identity: 0.719
tggttggaggggctggaatggtagccactgag CRISPR spacer
tactgcttggggctggaatggtacgcactgac Protospacer
*. * *************** ******
216. spacer 2.23|1781472|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to AP014060 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C12B-MedDCM-OCT-S45-C20, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 9, identity: 0.719
tggttggaggggctggaatggtagccactgag CRISPR spacer
tactgcttggggctggaatggtacgcactgac Protospacer
*. * *************** ******
217. spacer 2.28|1781777|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031226 (Pseudomonas amygdali pv. lachrymans str. M301315 plasmid pMPPla107, complete sequence) position: , mismatch: 9, identity: 0.719
ctcaaccaggaggcaacacgatgaacgatgca CRISPR spacer
gtacagacgggggcaacacgatgaacaatgcc Protospacer
* * **.***************.****
218. spacer 2.32|1782021|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LT559121 (Nonomuraea gerenzanensis isolate nono1 plasmid II, complete sequence) position: , mismatch: 9, identity: 0.719
gaggctgccgaggctatgcaccagccccgcgc CRISPR spacer
gatcgggcccaggctatgcaccagcaccgtca Protospacer
** *** *************** ***.
219. spacer 2.32|1782021|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016617 (Microvirga ossetica strain V5/3m plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
gaggctgccgaggctatgcaccagccccgcgc CRISPR spacer
gcgactgccgaggctgtgctccagcccgagct Protospacer
* *.***********.*** ******* . .
220. spacer 2.32|1782021|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016617 (Microvirga ossetica strain V5/3m plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
gaggctgccgaggctatgcaccagccccgcgc CRISPR spacer
gcgactgccgaggctgtgctccagcccgagct Protospacer
* *.***********.*** ******* . .
221. spacer 2.32|1782021|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016619 (Microvirga ossetica strain V5/3m plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
gaggctgccgaggctatgcaccagccccgcgc CRISPR spacer
gcgactgccgaggctgtgctccagcccgagct Protospacer
* *.***********.*** ******* . .
222. spacer 2.32|1782021|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016619 (Microvirga ossetica strain V5/3m plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
gaggctgccgaggctatgcaccagccccgcgc CRISPR spacer
gcgactgccgaggctgtgctccagcccgagct Protospacer
* *.***********.*** ******* . .
223. spacer 2.32|1782021|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016619 (Microvirga ossetica strain V5/3m plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
gaggctgccgaggctatgcaccagccccgcgc CRISPR spacer
gcgactgccgaggctgtgctccagcccgagct Protospacer
* *.***********.*** ******* . .
224. spacer 2.32|1782021|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016619 (Microvirga ossetica strain V5/3m plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
gaggctgccgaggctatgcaccagccccgcgc CRISPR spacer
gcgactgccgaggctgtgctccagcccgagct Protospacer
* *.***********.*** ******* . .
225. spacer 2.32|1782021|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016620 (Microvirga ossetica strain V5/3m plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.719
gaggctgccgaggctatgcaccagccccgcgc CRISPR spacer
gcgactgccgaggctgtgctccagcccgagct Protospacer
* *.***********.*** ******* . .
226. spacer 2.34|1782143|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to MT778840 (Rhizobium phage P11VFA, complete genome) position: , mismatch: 9, identity: 0.719
aaataaaccaaccggggccgggcaaccggccc CRISPR spacer
tcgggaaccaatccgggccgggcaaccggcat Protospacer
. .******.* **************** .
227. spacer 2.34|1782143|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to KF614509 (Rhizobium phage vB_RleS_L338C, complete genome) position: , mismatch: 9, identity: 0.719
aaataaaccaaccggggccgggcaaccggccc CRISPR spacer
tcgggaaccaatccgggccgggcaaccggcat Protospacer
. .******.* **************** .
228. spacer 2.36|1782265|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 9, identity: 0.719
agctctgcctcgaacgtcacgccggggaaatg CRISPR spacer
agaaaatgttcgaacgtcgcgccgggaaaatg Protospacer
** .*********.*******.*****
229. spacer 2.37|1782326|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021796 (Sinorhizobium meliloti strain USDA1157 plasmid accessoryA, complete sequence) position: , mismatch: 9, identity: 0.719
tcctcgtgcgttgcccccgcctcgtctcgtac CRISPR spacer
aacgcgtgggttgcccccgcctcgactttggc Protospacer
* **** *************** **. .*
230. spacer 3.15|1785883|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP024657 (Bacillus cereus strain MLY1 plasmid pMLY1.1, complete sequence) position: , mismatch: 9, identity: 0.719
ttgtacttactttctttcttctttgccatttt CRISPR spacer
tttctattactttcttttttctttaccataaa Protospacer
** . ***********.******.****
231. spacer 3.15|1785883|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP015351 (Bacillus thuringiensis strain MYBT18246 plasmid p150790, complete sequence) position: , mismatch: 9, identity: 0.719
ttgtacttactttctttcttctttgccatttt CRISPR spacer
tttctattactttcttttttctttaccataaa Protospacer
** . ***********.******.****
232. spacer 3.15|1785883|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP015352 (Bacillus thuringiensis strain MYBT18246 plasmid p142098, complete sequence) position: , mismatch: 9, identity: 0.719
ttgtacttactttctttcttctttgccatttt CRISPR spacer
tttctattactttcttttttctttaccataaa Protospacer
** . ***********.******.****
233. spacer 3.15|1785883|32|NC_014216|CRISPRCasFinder,CRT matches to NC_018516 (Bacillus thuringiensis HD-789 plasmid pBTHD789-1, complete sequence) position: , mismatch: 9, identity: 0.719
ttgtacttactttctttcttctttgccatttt CRISPR spacer
ttattcttactttctttcttcttacgtttctc Protospacer
**.* ****************** . *.*.
234. spacer 3.15|1785883|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP053970 (Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
ttgtacttactttctttcttctttgccatttt CRISPR spacer
ttattcttactttctttcttcttacgtttctc Protospacer
**.* ****************** . *.*.
235. spacer 3.15|1785883|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP053979 (Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719
ttgtacttactttctttcttctttgccatttt CRISPR spacer
ttattcttactttctttcttcttacgtttctc Protospacer
**.* ****************** . *.*.
236. spacer 3.15|1785883|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP013277 (Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-2-350K, complete sequence) position: , mismatch: 9, identity: 0.719
ttgtacttactttctttcttctttgccatttt CRISPR spacer
ttattcttactttctttcttcttacgtttctc Protospacer
**.* ****************** . *.*.
237. spacer 3.15|1785883|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP039723 (Bacillus thuringiensis strain BT-59 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.719
ttgtacttactttctttcttctttgccatttt CRISPR spacer
ttattcttactttctttcttcttacgtttctc Protospacer
**.* ****************** . *.*.
238. spacer 3.15|1785883|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP009348 (Bacillus thuringiensis HD1002 plasmid 2, complete sequence) position: , mismatch: 9, identity: 0.719
ttgtacttactttctttcttctttgccatttt CRISPR spacer
ttattcttactttctttcttcttacgtttctc Protospacer
**.* ****************** . *.*.
239. spacer 3.15|1785883|32|NC_014216|CRISPRCasFinder,CRT matches to NC_022875 (Bacillus thuringiensis YBT-1518 plasmid pBMB0230, complete sequence) position: , mismatch: 9, identity: 0.719
ttgtacttactttctttcttctttgccatttt CRISPR spacer
tttctattactttcttttttctttaccataaa Protospacer
** . ***********.******.****
240. spacer 3.15|1785883|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP009334 (Bacillus thuringiensis strain HD1011 plasmid 2, complete sequence) position: , mismatch: 9, identity: 0.719
ttgtacttactttctttcttctttgccatttt CRISPR spacer
ttattcttactttctttcttcttacgtttctc Protospacer
**.* ****************** . *.*.
241. spacer 3.15|1785883|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP045024 (Bacillus thuringiensis strain JW-1 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.719
ttgtacttactttctttcttctttgccatttt CRISPR spacer
ttattcttactttctttcttcttacgtttctc Protospacer
**.* ****************** . *.*.
242. spacer 3.16|1785943|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP034782 (Pseudomonas sp. MPC6 plasmid pMPC6-328K, complete sequence) position: , mismatch: 9, identity: 0.719
gaagcgcagcgacttgcggaactcttc---gacct CRISPR spacer
agcacgctgcgccttgcggaactcttctcaga--- Protospacer
.. .*** *** *************** **
243. spacer 3.18|1786063|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP026601 (Clostridiaceae bacterium 14S0207 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
ttgatgagtgtaaaccttattaatttcgtctt CRISPR spacer
tattttgctgttaaccttattaaattcgtcta Protospacer
* * . *** *********** *******
244. spacer 3.20|1786184|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 9, identity: 0.719
aacgacgccttcaacatggtcagcctgaccaa CRISPR spacer
tacggcgccttcaacctggtcagcggcatcgc Protospacer
***.********** ******** *.*.
245. spacer 3.20|1786184|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
aacgacgccttcaacatggtcagcctgaccaa CRISPR spacer
tacggcgccttcaacctggtcagcggcatcgc Protospacer
***.********** ******** *.*.
246. spacer 3.24|1786425|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
ctttgcccggctagcgcccagccactcaagct CRISPR spacer
cctgccccggccagcgcccagccgctcagcac Protospacer
*.* ******.***********.****. .
247. spacer 3.33|1786965|32|NC_014216|CRISPRCasFinder,CRT matches to NC_022050 (Paracoccus aminophilus JCM 7686 plasmid pAMI8, complete sequence) position: , mismatch: 9, identity: 0.719
ttaaacaacttggcagaattgaaaagcttttt CRISPR spacer
cttgaagccttggcagaagtgaagagcttttc Protospacer
.* .* . ********** ****.*******.
248. spacer 3.34|1787025|32|NC_014216|CRISPRCasFinder,CRT matches to KF356199 (Microcystis phage MaMV-DC, complete genome) position: , mismatch: 9, identity: 0.719
ataagaggttttgattggtgttgggggtaatg CRISPR spacer
accatctactttgagtggtggtgggggtaatg Protospacer
*. * ..***** ***** ***********
249. spacer 3.34|1787025|32|NC_014216|CRISPRCasFinder,CRT matches to NC_008562 (Microcystis phage Ma-LMM01 DNA, complete genome) position: , mismatch: 9, identity: 0.719
ataagaggttttgattggtgttgggggtaatg CRISPR spacer
accatctactttgagtggtggtgggggtaatg Protospacer
*. * ..***** ***** ***********
250. spacer 3.35|1787085|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP049244 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719
tcggatatcaccgagacgcagaccacgatcca CRISPR spacer
gcgatgttcaccgagatgaagaccacgatcat Protospacer
**. *********.* ***********
251. spacer 3.46|1787745|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.719
ttcccggagagcccggtcaacccggccttcct CRISPR spacer
gtaaagatcagcgcgatcaacccggccttcct Protospacer
* *. *** **.****************
252. spacer 3.46|1787745|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
ttcccggagagcccggtcaacccggccttcct CRISPR spacer
gtaaagatcagcgcgatcaacccggccttcct Protospacer
* *. *** **.****************
253. spacer 3.48|1787865|32|NC_014216|CRISPRCasFinder,CRT matches to GQ478082 (Enterococcus phage phiFL1B, complete genome) position: , mismatch: 9, identity: 0.719
ggcaggatcatcattgtctgcaccccttgttt CRISPR spacer
aactttttaatcattgtctgaacccgttgttt Protospacer
..* * *********** **** ******
254. spacer 3.48|1787865|32|NC_014216|CRISPRCasFinder,CRT matches to GQ478087 (Enterococcus phage phiFL3B, complete genome) position: , mismatch: 9, identity: 0.719
ggcaggatcatcattgtctgcaccccttgttt CRISPR spacer
aactttttaatcattgtctgaacccgttgttt Protospacer
..* * *********** **** ******
255. spacer 3.48|1787865|32|NC_014216|CRISPRCasFinder,CRT matches to GQ478083 (Enterococcus phage phiFL1C, complete genome) position: , mismatch: 9, identity: 0.719
ggcaggatcatcattgtctgcaccccttgttt CRISPR spacer
aactttttaatcattgtctgaacccgttgttt Protospacer
..* * *********** **** ******
256. spacer 3.48|1787865|32|NC_014216|CRISPRCasFinder,CRT matches to GQ478085 (Enterococcus phage phiFL2B, complete genome) position: , mismatch: 9, identity: 0.719
ggcaggatcatcattgtctgcaccccttgttt CRISPR spacer
aactttttaatcattgtctgaacccgttgttt Protospacer
..* * *********** **** ******
257. spacer 3.48|1787865|32|NC_014216|CRISPRCasFinder,CRT matches to NC_013646 (Enterococcus phage phiFL1A, complete genome) position: , mismatch: 9, identity: 0.719
ggcaggatcatcattgtctgcaccccttgttt CRISPR spacer
aactttttaatcattgtctgaacccgttgttt Protospacer
..* * *********** **** ******
258. spacer 3.48|1787865|32|NC_014216|CRISPRCasFinder,CRT matches to NC_013648 (Enterococcus phage phiFL3A, complete genome) position: , mismatch: 9, identity: 0.719
ggcaggatcatcattgtctgcaccccttgttt CRISPR spacer
aactttttaatcattgtctgaacccgttgttt Protospacer
..* * *********** **** ******
259. spacer 3.48|1787865|32|NC_014216|CRISPRCasFinder,CRT matches to NC_013643 (Enterococcus phage phiFL2A, complete genome) position: , mismatch: 9, identity: 0.719
ggcaggatcatcattgtctgcaccccttgttt CRISPR spacer
aactttttaatcattgtctgaacccgttgttt Protospacer
..* * *********** **** ******
260. spacer 3.53|1788165|33|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP013419 (Burkholderia sp. MSMB0266 plasmid pMSMB0266, complete sequence) position: , mismatch: 9, identity: 0.727
gacggggcaggccggcgagaatccagaggcgca CRISPR spacer
cgccgggcaggccggcgagaaaccggagggctc Protospacer
.* ***************** **.**** .
261. spacer 3.54|1788226|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP015231 (Epibacterium mobile F1926 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
gatcatggtccgcatgctgctgccctggatca CRISPR spacer
ggacggcatccccatgccgctgccctggatcg Protospacer
*. *. .*** *****.*************.
262. spacer 3.55|1788286|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP023452 (Rhizorhabdus dicambivorans strain Ndbn-20 plasmid p3, complete sequence) position: , mismatch: 9, identity: 0.719
ccttgcagcgccgcccatagccgctggccgta CRISPR spacer
ggaaacagcgccgcccataaccgctggcacaa Protospacer
.**************.******** *
263. spacer 3.55|1788286|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP018223 (Tardibacter chloracetimidivorans strain JJ-A5 plasmid pHSL2, complete sequence) position: , mismatch: 9, identity: 0.719
ccttgcagcgccgcccatagccgctggccgta CRISPR spacer
ggaaacagcgccgcccataaccgctggcacaa Protospacer
.**************.******** *
264. spacer 3.59|1788528|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to MN508817 (Yersinia phage JC221, partial genome) position: , mismatch: 9, identity: 0.719
caaatgacaccttcacaaattgccaggatatt CRISPR spacer
atttttccaccttcacaaattgataggatact Protospacer
* *************** .******.*
265. spacer 3.61|1788648|33|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to MN693560 (Marine virus AFVG_25M298, complete genome) position: , mismatch: 9, identity: 0.727
tttcagtgcctcgttggcgtctttgtggcccag CRISPR spacer
tgtcaatacctcgttggcgtctttgtagttgcc Protospacer
* ***.*.******************.*..
266. spacer 3.63|1788769|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029776 (Deinococcus actinosclerus strain Deinococcus actinosclerus SJTR plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
gaaatcagaattgaggaagacgggacggtgaa CRISPR spacer
gtcgcggtaattgaggaagacgggcgggtgaa Protospacer
* .. . **************** ******
267. spacer 3.73|1789370|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049249 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719
gaaccactgctttccggcctgcggctggtgct CRISPR spacer
tcgcgcaagctttcgagcctgcggctggtgct Protospacer
.* ****** .****************
268. spacer 3.73|1789370|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024423 (Paracoccus yeei strain TT13 plasmid pTT13-1, complete sequence) position: , mismatch: 9, identity: 0.719
gaaccactgctttccggcctgcggctggtgct CRISPR spacer
catgtgccgctttccggccagccgctggtgcg Protospacer
* ..*.*********** ** ********
269. spacer 3.79|1789734|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009357 (Vibrio tubiashii ATCC 19109 plasmid p123, complete sequence) position: , mismatch: 9, identity: 0.719
cattttgttgatgtatggtgccaagccttcaa CRISPR spacer
ttgattcgtgatgtatggtgccaactcttcag Protospacer
. ** **************** .*****.
270. spacer 3.82|1789914|33|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134452 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence) position: , mismatch: 9, identity: 0.727
gcccgagta---cccgcgctgattcccgtccgctga CRISPR spacer
---cgagcggttcccgcgctgatgcccgtccgcaac Protospacer
****.. *********** ********* .
271. spacer 3.87|1790215|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032697 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525a, complete sequence) position: , mismatch: 9, identity: 0.719
ctggccgccatcggcgttggtgccgcgatttt CRISPR spacer
ggctcttccatcggcgttggcgccgcgtttta Protospacer
*. *************.****** ***
272. spacer 3.87|1790215|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NC_014035 (Rhodobacter capsulatus SB 1003 plasmid pRCB133, complete sequence) position: , mismatch: 9, identity: 0.719
ctggccgccatcggcgttggtgccgcgatttt CRISPR spacer
ggcgccgacatcggcgtcggtgccgcgcgatc Protospacer
**** *********.********* *.
273. spacer 3.87|1790215|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024582 (Roseomonas sp. FDAARGOS_362 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
ctggccgccatcggcgttggtgccgcgatttt CRISPR spacer
gtttccgccatcggcttcggtgccgcgccgct Protospacer
* *********** *.********* . .*
274. spacer 3.87|1790215|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025613 (Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
ctggccgccatcggcgttggtgccgcgatttt CRISPR spacer
acgccggccattggcggtggtgccgcgatgca Protospacer
.* * *****.**** ************ .
275. spacer 3.87|1790215|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP051297 (Alicycliphilus denitrificans strain DP3 plasmid pDP3, complete sequence) position: , mismatch: 9, identity: 0.719
ctggccgccatcggcgttggtgccgcgatttt CRISPR spacer
agggccgccatcggcatgggtgccgtattgat Protospacer
*************.* *******.. * *
276. spacer 3.87|1790215|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP051297 (Alicycliphilus denitrificans strain DP3 plasmid pDP3, complete sequence) position: , mismatch: 9, identity: 0.719
ctggccgccatcggcgttggtgccgcgatttt CRISPR spacer
agggccgccatcggcatgggtgccgtattgat Protospacer
*************.* *******.. * *
277. spacer 3.87|1790215|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016620 (Microvirga ossetica strain V5/3m plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.719
ctggccgccatcggcgttggtgccgcgatttt CRISPR spacer
ctggctgccatcggtgttggtgcaatcctctc Protospacer
*****.********.******** .. *.*.
278. spacer 3.87|1790215|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
ctggccgccatcggcgttggtgccgcgatttt CRISPR spacer
ggcgccgccatcggcgctggtgcagccaatgg Protospacer
*************.****** ** * *
279. spacer 3.87|1790215|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025188 (Roseomonas mucosa strain AD2 plasmid p1-AD2, complete sequence) position: , mismatch: 9, identity: 0.719
ctggccgccatcggcgttggtgccgcgatttt CRISPR spacer
gtttccgccatcggcttcggtgccgcgccgct Protospacer
* *********** *.********* . .*
280. spacer 3.92|1790515|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NC_010335 (Caulobacter sp. K31 plasmid pCAUL01, complete sequence) position: , mismatch: 9, identity: 0.719
gccggggatcagtcgggtgcgcaggtcgtcct CRISPR spacer
cgcctggatcagtcgggcgcgcatgtcggcgc Protospacer
* ************.***** **** * .
281. spacer 3.93|1790575|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023993 (Streptomyces malaysiensis strain DSM 4137 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
ctttggacggagccggttcggcggttgtttta CRISPR spacer
ttttggccggagccgggtcggcgggcggtgcg Protospacer
.***** ********* ******* .* * ..
282. spacer 3.100|1790996|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 9, identity: 0.719
tgatccctgacgatgtgatttccttttctgat CRISPR spacer
ctaggcgcgacgatgcgatttccttttcagaa Protospacer
. * * .*******.************ **
283. spacer 3.103|1791176|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to MN657037 (Psychrobacter sp. strain ANT_P17B plasmid pA17BP2, complete sequence) position: , mismatch: 9, identity: 0.719
ttcacgatattcattttatttgcctcattatt CRISPR spacer
acatggatattcattttatttgccttattgag Protospacer
. ********************.***.
284. spacer 3.103|1791176|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NC_011255 (Borrelia recurrentis A1 plasmid pl35, complete sequence) position: , mismatch: 9, identity: 0.719
ttcacgatattcattttatttgcctcattatt CRISPR spacer
acttctctcttcattttcttcgcctcattatt Protospacer
.. * * ******** **.***********
285. spacer 3.103|1791176|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017591 (Pantoea stewartii subsp. stewartii DC283 plasmid pDSJ10, complete sequence) position: , mismatch: 9, identity: 0.719
ttcacgatattcattttatttgcctcattatt CRISPR spacer
tcaaggatattcattgtatttccctcatacgc Protospacer
*. * ********** ***** ****** .
286. spacer 3.103|1791176|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049116 (Pantoea stewartii strain ZJ-FGZX1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
ttcacgatattcattttatttgcctcattatt CRISPR spacer
tcaaggatattcattgtatttccctcatacgc Protospacer
*. * ********** ***** ****** .
287. spacer 3.104|1791236|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033045 (Bacillus foraminis strain Bac44 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
atctccttgttcaatcaatccaactgcgtcgt CRISPR spacer
atcacctttttcaatcaatccaatcgtttgtc Protospacer
*** **** **************..*. * .
288. spacer 3.105|1791296|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to MT900487 (Streptococcus phage 23TH, complete genome) position: , mismatch: 9, identity: 0.719
acagcctcccccggcattcccggcagttgtca CRISPR spacer
gacttctcccacggcattcccgacagttgaaa Protospacer
. .***** ***********.****** *
289. spacer 3.110|1791597|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to KR063280 (Gordonia phage GMA6, complete genome) position: , mismatch: 9, identity: 0.719
gtcgggaaggttgatggcgtcgatgttgatca CRISPR spacer
ctgactgacgttgatggcgtcgttgttgctca Protospacer
* . .* ************* ***** ***
290. spacer 3.112|1791717|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NC_023136 (Leisingera methylohalidivorans DSM 14336 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
tttgcccggtacttgctggcctggcgcttggt CRISPR spacer
cgggcccggttcttgctggcatggcgcagcgg Protospacer
. ******* ********* ****** *
291. spacer 3.112|1791717|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NC_006912 (Streptomyces sp. FQ1 plasmid pFP1, complete sequence) position: , mismatch: 9, identity: 0.719
tttgcccggtacttgctggcctggcgcttggt CRISPR spacer
ctgtcgacgtccttgcgggcctggcgcttggc Protospacer
.* * ** ***** **************.
292. spacer 3.112|1791717|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029602 (Streptomyces sp. WAC 01438 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
tttgcccggtacttgctggcctggcgcttggt CRISPR spacer
ctgtcgacgtccttgcgggcctggcgcttggc Protospacer
.* * ** ***** **************.
293. spacer 3.113|1791777|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP035420 (Leisingera sp. NJS204 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719
tcggggtcacttttgagcctgcccccggtcaa CRISPR spacer
ccgctttcacggttgagcctgcccccggtttc Protospacer
.** **** *****************.
294. spacer 3.115|1791897|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to MN602268 (Bacteriophage DSS3_MAL1, complete genome) position: , mismatch: 9, identity: 0.719
gatttcgccaacctgcacgatgcctggctgaa CRISPR spacer
tttgcccccaaccagcacgatgactggctgtg Protospacer
* .* ****** ******** ******* .
295. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
ttgtcgcgcacctccagcagcaggccgccgtc Protospacer
*. ** ******** *********** .
296. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 10, identity: 0.688
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
aacaccagctcctccagcggcaggcgcttgcg Protospacer
** ************* ****** ..*
297. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP021083 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI2, complete sequence) position: , mismatch: 10, identity: 0.688
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
agcgtgagcggctccagctgcaggccgcccgc Protospacer
*. *** ****************** ..
298. spacer 2.4|1780311|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688
tagtcggagcggatcagcgccaccatgtcggt CRISPR spacer
cgcccggagcggtacagcgccaccatggcctg Protospacer
.. .******** ************* *
299. spacer 2.4|1780311|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012941 (Ralstonia solanacearum strain UW163 plasmid pUW163a, complete sequence) position: , mismatch: 10, identity: 0.688
tagtcggagcggatcagcgccaccatgtcggt CRISPR spacer
ctgaaatcgctgatcagcgccaccatggcggc Protospacer
. * . ** **************** ***.
300. spacer 2.4|1780311|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NC_004808 (Streptomyces rochei plasmid pSLA2-L DNA, complete sequence) position: , mismatch: 10, identity: 0.688
tagtcggagcggatcagcgccaccatgtcggt CRISPR spacer
cggccggagcggtacagcgccaccatgaactg Protospacer
..*.******** *************
301. spacer 2.5|1780372|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP044425 (Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence) position: , mismatch: 10, identity: 0.688
tttcactgtgccccagcagctcctgaaccagc CRISPR spacer
catgctcgtgccccagcagcgcctgatccatg Protospacer
. * ..************* ***** ***
302. spacer 2.5|1780372|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025552 (Streptomyces rimosus strain WT5260 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
tttcactgtgccccagcagctcctgaaccagc CRISPR spacer
ggtgcttgtgccccagcagcacctggacctcg Protospacer
* .************** ****.***
303. spacer 2.13|1780861|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 10, identity: 0.688
tgcgccacccatgatgcaattgcggctcgcac CRISPR spacer
ctcgccacccatgatgccaatgcggaattcct Protospacer
. *************** * ***** . * .
304. spacer 2.17|1781105|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 10, identity: 0.688
gggatcagcgccagcgggcgtccctcgtcatc CRISPR spacer
tgcctcagcgccagcggtcgtcccccggggcg Protospacer
* ************* ******.** ..
305. spacer 2.18|1781166|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP007796 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence) position: , mismatch: 10, identity: 0.688
tcagttgcatgatgctcctccctggtcatagc CRISPR spacer
gtgacttcatgatgctcctcccatgtcatatg Protospacer
....* *************** ******
306. spacer 2.36|1782265|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 10, identity: 0.688
agctctgcctcgaacgtcacgccggggaaatg CRISPR spacer
cgcgctgcctcgaacgtctcgccgaccacgac Protospacer
** ************** *****. * .
307. spacer 2.37|1782326|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009112 (Rhodococcus opacus strain 1CP plasmid pR1CP1, complete sequence) position: , mismatch: 10, identity: 0.688
tcctcgtgcgttgcccccgcctcgtctcgtac CRISPR spacer
caaacgtgcgttgccaccgccttgtctgtggc Protospacer
. *********** ******.**** .*
308. spacer 3.5|1785282|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP015203 (Rhodococcus sp. 008 plasmid pR8L1, complete sequence) position: , mismatch: 10, identity: 0.688
tgatggcccggacatcggcgacattgaaggat CRISPR spacer
tcggacagcggccaccggcgacattgaaggag Protospacer
* . . *** **.****************
309. spacer 3.5|1785282|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP044283 (Rhodococcus erythropolis strain X5 plasmid pRhX5, complete sequence) position: , mismatch: 10, identity: 0.688
tgatggcccggacatcggcgacattgaaggat CRISPR spacer
tcggacagcggccaccggcgacattgaaggag Protospacer
* . . *** **.****************
310. spacer 3.5|1785282|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP017303 (Rhodococcus sp. YL-1 plasmid pYLL1 sequence) position: , mismatch: 10, identity: 0.688
tgatggcccggacatcggcgacattgaaggat CRISPR spacer
tcggacagcggccaccggcgacattgaaggag Protospacer
* . . *** **.****************
311. spacer 3.5|1785282|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP034156 (Rhodococcus sp. NJ-530 plasmid unnamed4, complete sequence) position: , mismatch: 10, identity: 0.688
tgatggcccggacatcggcgacattgaaggat CRISPR spacer
tcggacagcggccaccggcgacattgaaggag Protospacer
* . . *** **.****************
312. spacer 3.5|1785282|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP042915 (Rhodococcus qingshengii strain RL1 plasmid unnamed2) position: , mismatch: 10, identity: 0.688
tgatggcccggacatcggcgacattgaaggat CRISPR spacer
tcggacagcggccaccggcgacattgaaggag Protospacer
* . . *** **.****************
313. spacer 3.17|1786003|32|NC_014216|CRISPRCasFinder,CRT matches to MG592562 (Vibrio phage 1.193.O._10N.286.52.C6, partial genome) position: , mismatch: 10, identity: 0.688
cctgtgttgcgtttttataccttacctagtag CRISPR spacer
taagtgttgcggttttctaccttaccgtcaaa Protospacer
. ******** **** ********* *.
314. spacer 3.17|1786003|32|NC_014216|CRISPRCasFinder,CRT matches to HQ634195 (Vibrio phage eugene 12A10 genomic sequence) position: , mismatch: 10, identity: 0.688
cctgtgttgcgtttttataccttacctagtag CRISPR spacer
taagtgttgcggttttctaccttaccgtcaaa Protospacer
. ******** **** ********* *.
315. spacer 3.23|1786365|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP021821 (Sinorhizobium meliloti strain M162 plasmid accessoryA, complete sequence) position: , mismatch: 10, identity: 0.688
cacaaacctccccgcgatatagcattccgggc CRISPR spacer
tctcttcctccccgcgatcaagcattccggtt Protospacer
. . ************ ********** .
316. spacer 3.23|1786365|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP021794 (Sinorhizobium meliloti strain USDA1157 plasmid psymA, complete sequence) position: , mismatch: 10, identity: 0.688
cacaaacctccccgcgatatagcattccgggc CRISPR spacer
tctcttcctccccgcgatcgagcattccggtt Protospacer
. . ************ ********** .
317. spacer 3.31|1786845|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP048880 (Oceanospirillales bacterium S2-4-1H plasmid pB, complete sequence) position: , mismatch: 10, identity: 0.688
ggaaagagatggacaacagttaactattgaga CRISPR spacer
tcgtccagatggaaaacagttacctattgaac Protospacer
. ******* ******** *******.
318. spacer 3.32|1786905|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP026382 (Sphingopyxis sp. MG plasmid pCMS1, complete sequence) position: , mismatch: 10, identity: 0.688
atattcagcccgtgaaataggcgaggaaacct CRISPR spacer
cggtatagccggcgaaataggcgaggaaattc Protospacer
.* .**** *.****************...
319. spacer 3.36|1787145|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP031960 (Phaeobacter sp. LSS9 plasmid unnamed4, complete sequence) position: , mismatch: 10, identity: 0.688
tcctccgccaatcgtgatccgaaccccggtca CRISPR spacer
gttggggacaaccgtgatcagaaccccggtcg Protospacer
.. * ***.******* ***********.
320. spacer 3.36|1787145|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP010602 (Phaeobacter inhibens strain P83 plasmid pP83_c, complete sequence) position: , mismatch: 10, identity: 0.688
tcctccgccaatcgtgatccgaaccccggtca CRISPR spacer
gttggggacaaccgtgatcagaaccccggtcg Protospacer
.. * ***.******* ***********.
321. spacer 3.36|1787145|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP010769 (Phaeobacter piscinae strain P13 plasmid pP13_b, complete sequence) position: , mismatch: 10, identity: 0.688
tcctccgccaatcgtgatccgaaccccggtca CRISPR spacer
gttggggacaaccgtgatcagaaccccggtcg Protospacer
.. * ***.******* ***********.
322. spacer 3.36|1787145|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP010708 (Phaeobacter inhibens strain P66 plasmid pP66_c, complete sequence) position: , mismatch: 10, identity: 0.688
tcctccgccaatcgtgatccgaaccccggtca CRISPR spacer
gttggggacaaccgtgatcagaaccccggtcg Protospacer
.. * ***.******* ***********.
323. spacer 3.36|1787145|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP010737 (Phaeobacter inhibens strain P72 plasmid pP72_b, complete sequence) position: , mismatch: 10, identity: 0.688
tcctccgccaatcgtgatccgaaccccggtca CRISPR spacer
gttggggacaaccgtgatcagaaccccggtcg Protospacer
.. * ***.******* ***********.
324. spacer 3.44|1787625|32|NC_014216|CRISPRCasFinder,CRT matches to KP238129 (Sulfolobus monocaudavirus SMV2, complete genome) position: , mismatch: 10, identity: 0.688
aaatgtcgactggttgatggagatgggttggt CRISPR spacer
tcatgtcgagtggttgatggagagggaagcag Protospacer
******* ************* **. .
325. spacer 3.55|1788286|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP009296 (Novosphingobium pentaromativorans US6-1 plasmid pLA2, complete sequence) position: , mismatch: 10, identity: 0.688
ccttgcagcgccgcccatagccgctggccgta CRISPR spacer
ggaaacagcgccgctcataaccgctggcacaa Protospacer
.*********.****.******** *
326. spacer 3.55|1788286|32|NC_014216|CRISPRCasFinder,CRT matches to NC_025133 (Sphingobium wenxiniae strain JZ-1 plasmid pPBA, complete sequence) position: , mismatch: 10, identity: 0.688
ccttgcagcgccgcccatagccgctggccgta CRISPR spacer
ggaaacagcgccgcccacaaccgctggcacaa Protospacer
.************.*.******** *
327. spacer 3.55|1788286|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP005192 (Sphingobium sp. MI1205 plasmid pMI3, complete sequence) position: , mismatch: 10, identity: 0.688
ccttgcagcgccgcccatagccgctggccgta CRISPR spacer
ggaaacagcgccgcccacaaccgctggcacaa Protospacer
.************.*.******** *
328. spacer 3.55|1788286|32|NC_014216|CRISPRCasFinder,CRT matches to AB244976 (Uncultured bacterium plasmid pLB1 DNA, complete sequence) position: , mismatch: 10, identity: 0.688
ccttgcagcgccgcccatagccgctggccgta CRISPR spacer
ggaaacagcgccgcccacaaccgctggcacaa Protospacer
.************.*.******** *
329. spacer 3.55|1788286|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP022749 (Sphingobium hydrophobicum strain C1 plasmid p3, complete sequence) position: , mismatch: 10, identity: 0.688
ccttgcagcgccgcccatagccgctggccgta CRISPR spacer
ggaaacagcgccgctcataaccgctggcacaa Protospacer
.*********.****.******** *
330. spacer 3.55|1788286|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP033229 (Sphingobium yanoikuyae strain SJTF8 plasmid pF3, complete sequence) position: , mismatch: 10, identity: 0.688
ccttgcagcgccgcccatagccgctggccgta CRISPR spacer
ggaaacagcgccgctcataaccgctggcacaa Protospacer
.*********.****.******** *
331. spacer 3.87|1790215|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 10, identity: 0.688
ctggccgccatcggcgttggtgccgcgatttt CRISPR spacer
atggccgccataggccttggtgccctgcaaca Protospacer
********** *** ******** .* .
332. spacer 3.87|1790215|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.688
ctggccgccatcggcgttggtgccgcgatttt CRISPR spacer
atggccgccataggccttggtgccctgcaaca Protospacer
********** *** ******** .* .
333. spacer 3.87|1790215|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 10, identity: 0.688
ctggccgccatcggcgttggtgccgcgatttt CRISPR spacer
atggccgccataggccttggtgccctggagca Protospacer
********** *** ******** .*. .
334. spacer 3.87|1790215|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 10, identity: 0.688
ctggccgccatcggcgttggtgccgcgatttt CRISPR spacer
atggccgccataggccttggtgccctgcaaca Protospacer
********** *** ******** .* .
335. spacer 3.89|1790335|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021236 (Pontibacter actiniarum strain DSM 19842 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
gatacaggggcgcttatggtggtcgggggtct CRISPR spacer
atgggaggggcgcttatcgtggtcgtggccgt Protospacer
. . ************ ******* ** . *
336. spacer 3.95|1790695|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ttgctcggccatgatgtacccggcgagagcat CRISPR spacer
cggcgcggccatgatgttcccggcggtacagg Protospacer
. ** ************ *******. * .
337. spacer 3.103|1791176|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NC_015063 (Rahnella sp. Y9602 plasmid pRAHAQ02, complete sequence) position: , mismatch: 10, identity: 0.688
ttcacgatattcattttatttgcctcattatt CRISPR spacer
acggtaatattctttttattggcctcattctg Protospacer
. ...****** ******* ******** *
338. spacer 3.103|1791176|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NC_017773 (Rahnella aquatilis HX2 plasmid PRA2, complete sequence) position: , mismatch: 10, identity: 0.688
ttcacgatattcattttatttgcctcattatt CRISPR spacer
acggtaatattctttttattggcctcattctg Protospacer
. ...****** ******* ******** *
339. spacer 3.110|1791597|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026382 (Sphingopyxis sp. MG plasmid pCMS1, complete sequence) position: , mismatch: 10, identity: 0.688
gtcgggaaggttgatggcgtcgatgttgatca CRISPR spacer
tatcttaagtttgatggcgttgatgttgaact Protospacer
. *** **********.******** *
340. spacer 3.110|1791597|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to MT310878 (Mycobacterium phage MK4, complete genome) position: , mismatch: 10, identity: 0.688
gtcgggaaggttgatggcgtcgatgttgatca CRISPR spacer
gtcggcaaggttgatggtgtcgagggccgaag Protospacer
***** ***********.***** * . . .
341. spacer 3.110|1791597|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to MT310881 (Mycobacterium phage JF2, complete genome) position: , mismatch: 10, identity: 0.688
gtcgggaaggttgatggcgtcgatgttgatca CRISPR spacer
gtcggcaaggttgatggtgtcgagggccgaag Protospacer
***** ***********.***** * . . .
342. spacer 3.110|1791597|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NC_042036 (Mycobacterium phage Rockstar, complete genome) position: , mismatch: 10, identity: 0.688
gtcgggaaggttgatggcgtcgatgttgatca CRISPR spacer
gtcggcaaggttgatggtgtcgagggccgaag Protospacer
***** ***********.***** * . . .
343. spacer 3.110|1791597|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to MN586063 (Mycobacterium phage Isca, complete genome) position: , mismatch: 10, identity: 0.688
gtcgggaaggttgatggcgtcgatgttgatca CRISPR spacer
gtcggcaaggttgatggtgtcgagggccgaag Protospacer
***** ***********.***** * . . .
344. spacer 3.110|1791597|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to AP018485 (Mycobacterium phage B1 DNA, complete genome) position: , mismatch: 10, identity: 0.688
gtcgggaaggttgatggcgtcgatgttgatca CRISPR spacer
gtcggcaaggttgatggtgtcgagggccgaag Protospacer
***** ***********.***** * . . .
345. spacer 3.110|1791597|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to MT310880 (Mycobacterium phage JF4, complete genome) position: , mismatch: 10, identity: 0.688
gtcgggaaggttgatggcgtcgatgttgatca CRISPR spacer
gtcggcaaggttgatggtgtcgagggccgaag Protospacer
***** ***********.***** * . . .
346. spacer 3.113|1791777|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to MN176225 (Bacillus phage 031MP004, complete genome) position: , mismatch: 10, identity: 0.688
tcggggtcacttttgagcctgcccccggtcaa CRISPR spacer
tcggggtcacgtgtgagcctgcctataatgtg Protospacer
********** * **********. ...* .
347. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_KX683283 (Escherichia coli strain EcU443 plasmid pECSE_01, complete sequence) position: , mismatch: 11, identity: 0.656
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tcgagcagcgcctccagctgcagcatctgcgc Protospacer
** ****** ************* . . ..
348. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to NC_022651 (Escherichia coli JJ1886 plasmid pJJ1886_5, complete sequence) position: , mismatch: 11, identity: 0.656
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tcgagcagcgcctccagctgcagcatctgcgc Protospacer
** ****** ************* . . ..
349. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP023854 (Escherichia coli strain 2/0 plasmid p2_0.1, complete sequence) position: , mismatch: 11, identity: 0.656
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tcgagcagcgcctccagctgcagcatctgcgc Protospacer
** ****** ************* . . ..
350. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_KT988018 (Escherichia coli strain V282 plasmid pEcoV282, complete sequence) position: , mismatch: 11, identity: 0.656
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tcgagcagcgcctccagctgcagcatctgcgc Protospacer
** ****** ************* . . ..
351. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP015077 (Escherichia coli strain Ecol_448 plasmid pEC448_1, complete sequence) position: , mismatch: 11, identity: 0.656
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tcgagcagcgcctccagctgcagcatctgcgc Protospacer
** ****** ************* . . ..
352. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP041338 (Escherichia coli strain CCUG 73778 plasmid pSUH-1, complete sequence) position: , mismatch: 11, identity: 0.656
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tcgagcagcgcctccagctgcagcatctgcgc Protospacer
** ****** ************* . . ..
353. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP023850 (Escherichia coli strain 4/0 plasmid p4_0.1, complete sequence) position: , mismatch: 11, identity: 0.656
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tcgagcagcgcctccagctgcagcatctgcgc Protospacer
** ****** ************* . . ..
354. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP048331 (Escherichia coli strain 10 plasmid p010_A, complete sequence) position: , mismatch: 11, identity: 0.656
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tcgagcagcgcctccagctgcagcatctgcgc Protospacer
** ****** ************* . . ..
355. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_KT754160 (Shigella dysenteriae strain 80-547 plasmid p80-547, complete sequence) position: , mismatch: 11, identity: 0.656
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tcgagcagcgcctccagctgcagcatctgcgc Protospacer
** ****** ************* . . ..
356. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP048338 (Escherichia coli strain 142 plasmid p142_A-OXA181, complete sequence) position: , mismatch: 11, identity: 0.656
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tcgagcagcgcctccagctgcagcatctgcgc Protospacer
** ****** ************* . . ..
357. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_LS992182 (Escherichia coli isolate Escherichia coli str. TO124 plasmid 3, complete sequence) position: , mismatch: 11, identity: 0.656
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tcgagcagcgcctccagctgcagcatctgcgc Protospacer
** ****** ************* . . ..
358. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_LR130556 (Escherichia coli strain MS14385 isolate MS14385 plasmid 2) position: , mismatch: 11, identity: 0.656
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tcgagcagcgcctccagctgcagcatctgcgc Protospacer
** ****** ************* . . ..
359. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to NC_013122 (Escherichia coli plasmid pEK499, complete sequence) position: , mismatch: 11, identity: 0.656
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tcgagcagcgcctccagctgcagcatctgcgc Protospacer
** ****** ************* . . ..
360. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP013836 (Escherichia coli strain JJ1897 plasmid pJJ1897_1, complete sequence) position: , mismatch: 11, identity: 0.656
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tcgagcagcgcctccagctgcagcatctgcgc Protospacer
** ****** ************* . . ..
361. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP026724 (Escherichia coli strain 266917_2 plasmid p266917_2_01, complete sequence) position: , mismatch: 11, identity: 0.656
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tcgagcagcgcctccagctgcagcatctgcgc Protospacer
** ****** ************* . . ..
362. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP054941 (Escherichia coli strain MS6192 plasmid pMS6192A-NDM, complete sequence) position: , mismatch: 11, identity: 0.656
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tcgagcagcgcctccagctgcagcatctgcgc Protospacer
** ****** ************* . . ..
363. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP020515 (Escherichia coli strain 219 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.656
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tcgagcagcgcctccagctgcagcatctgcgc Protospacer
** ****** ************* . . ..
364. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP036244 (Escherichia coli strain S65EC plasmid pS65EC, complete sequence) position: , mismatch: 11, identity: 0.656
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tcgagcagcgcctccagctgcagcatctgcgc Protospacer
** ****** ************* . . ..
365. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP024718 (Escherichia coli strain LS4 plasmid p1LS4, complete sequence) position: , mismatch: 11, identity: 0.656
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tcgagcagcgcctccagctgcagcatctgcgc Protospacer
** ****** ************* . . ..
366. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP023845 (Escherichia coli strain 4/1-1 plasmid p4_1_1.1, complete sequence) position: , mismatch: 11, identity: 0.656
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tcgagcagcgcctccagctgcagcatctgcgc Protospacer
** ****** ************* . . ..
367. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP024721 (Escherichia coli isolate NQ3 plasmid p1NQ3, complete sequence) position: , mismatch: 11, identity: 0.656
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tcgagcagcgcctccagctgcagcatctgcgc Protospacer
** ****** ************* . . ..
368. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP040922 (Escherichia coli strain FC853_EC plasmid p853EC3, complete sequence) position: , mismatch: 11, identity: 0.656
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tcgagcagcgcctccagctgcagcatctgcgc Protospacer
** ****** ************* . . ..
369. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP013832 (Escherichia coli strain CD306 plasmid pCD306, complete sequence) position: , mismatch: 11, identity: 0.656
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tcgagcagcgcctccagctgcagcatctgcgc Protospacer
** ****** ************* . . ..
370. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP013833 (Escherichia coli strain JJ2434 plasmid pJJ2434_1, complete sequence) position: , mismatch: 11, identity: 0.656
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tcgagcagcgcctccagctgcagcatctgcgc Protospacer
** ****** ************* . . ..
371. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP019014 (Escherichia coli strain Ecol_AZ162 plasmid pECAZ162_KPC, complete sequence) position: , mismatch: 11, identity: 0.656
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tcgagcagcgcctccagctgcagcatctgcgc Protospacer
** ****** ************* . . ..
372. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP024831 (Escherichia coli strain CREC-532 plasmid pCREC-532_1, complete sequence) position: , mismatch: 11, identity: 0.656
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tcgagcagcgcctccagctgcagcatctgcgc Protospacer
** ****** ************* . . ..
373. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP024831 (Escherichia coli strain CREC-532 plasmid pCREC-532_1, complete sequence) position: , mismatch: 11, identity: 0.656
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tcgagcagcgcctccagctgcagcatctgcgc Protospacer
** ****** ************* . . ..
374. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP008715 (Escherichia coli strain ST648 plasmid pEC648_1, complete sequence) position: , mismatch: 11, identity: 0.656
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tcgagcagcgcctccagctgcagcatctgcgc Protospacer
** ****** ************* . . ..
375. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP051695 (Escherichia coli strain SCU-313 plasmid pSCU-313-1, complete sequence) position: , mismatch: 11, identity: 0.656
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tcgagcagcgcctccagctgcagcatctgcgc Protospacer
** ****** ************* . . ..
376. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP024816 (Escherichia coli strain CREC-629 plasmid pCREC-629_1, complete sequence) position: , mismatch: 11, identity: 0.656
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tcgagcagcgcctccagctgcagcatctgcgc Protospacer
** ****** ************* . . ..
377. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP009860 (Escherichia coli strain ECONIH1 plasmid pECO-824, complete sequence) position: , mismatch: 11, identity: 0.656
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tcgagcagcgcctccagctgcagcatctgcgc Protospacer
** ****** ************* . . ..
378. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to LO017738 (Escherichia coli str. 690 plasmid pRCS57, complete genome) position: , mismatch: 11, identity: 0.656
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tcgagcagcgcctccagctgcagcatctgcgc Protospacer
** ****** ************* . . ..
379. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_LR025102 (Escherichia coli isolate EC-1639 plasmid 2, complete sequence) position: , mismatch: 11, identity: 0.656
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tcgagcagcgcctccagctgcagcatctgcgc Protospacer
** ****** ************* . . ..
380. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP018978 (Escherichia coli strain Ecol_656 plasmid pEC656_1, complete sequence) position: , mismatch: 11, identity: 0.656
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tcgagcagcgcctccagctgcagcatctgcgc Protospacer
** ****** ************* . . ..
381. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP013657 (Escherichia coli strain uk_P46212 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.656
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tcgagcagcgcctccagctgcagcatctgcgc Protospacer
** ****** ************* . . ..
382. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to NC_014385 (Escherichia coli plasmid pEC_L46, complete sequence) position: , mismatch: 11, identity: 0.656
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tcgagcagcgcctccagctgcagcatctgcgc Protospacer
** ****** ************* . . ..
383. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to NC_014384 (Escherichia coli plasmid pEC_L8, complete sequence) position: , mismatch: 11, identity: 0.656
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tcgagcagcgcctccagctgcagcatctgcgc Protospacer
** ****** ************* . . ..
384. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP018947 (Escherichia coli strain Ecol_224 plasmid pEC224_1, complete sequence) position: , mismatch: 11, identity: 0.656
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tcgagcagcgcctccagctgcagcatctgcgc Protospacer
** ****** ************* . . ..
385. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP019028 (Escherichia coli strain Ecol_881 plasmid pEC881_1, complete sequence) position: , mismatch: 11, identity: 0.656
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tcgagcagcgcctccagctgcagcatctgcgc Protospacer
** ****** ************* . . ..
386. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP047406 (Escherichia coli strain MS6193 plasmid pMS6193A-NDM, complete sequence) position: , mismatch: 11, identity: 0.656
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tcgagcagcgcctccagctgcagcatctgcgc Protospacer
** ****** ************* . . ..
387. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_LS992191 (Escherichia coli isolate Escherichia coli str. TO148 plasmid 2, complete sequence) position: , mismatch: 11, identity: 0.656
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tcgagcagcgcctccagctgcagcatctgcgc Protospacer
** ****** ************* . . ..
388. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP023361 (Escherichia coli strain 1943 plasmid p80, complete sequence) position: , mismatch: 11, identity: 0.656
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tcgagcagcgcctccagctgcagcatctgcgc Protospacer
** ****** ************* . . ..
389. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to AP022364 (Escherichia coli E309 plasmid pE309_IMP6 DNA, complete sequence) position: , mismatch: 11, identity: 0.656
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tcgagcagcgcctccagctgcagcatctgcgc Protospacer
** ****** ************* . . ..
390. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to AP022366 (Escherichia coli E312 plasmid pE312_IMP6 DNA, complete sequence) position: , mismatch: 11, identity: 0.656
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tcgagcagcgcctccagctgcagcatctgcgc Protospacer
** ****** ************* . . ..
391. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to AP022367 (Escherichia coli E317 plasmid pE317_IMP6 DNA, complete sequence) position: , mismatch: 11, identity: 0.656
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tcgagcagcgcctccagctgcagcatctgcgc Protospacer
** ****** ************* . . ..
392. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to AP022368 (Escherichia coli E318 plasmid pE318_IMP6 DNA, complete sequence) position: , mismatch: 11, identity: 0.656
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tcgagcagcgcctccagctgcagcatctgcgc Protospacer
** ****** ************* . . ..
393. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to AP022369 (Escherichia coli E319 plasmid pE319_IMP6 DNA, complete sequence) position: , mismatch: 11, identity: 0.656
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tcgagcagcgcctccagctgcagcatctgcgc Protospacer
** ****** ************* . . ..
394. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP025708 (Escherichia coli strain YDC107 plasmid pYDC107_184, complete sequence) position: , mismatch: 11, identity: 0.656
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tcgagcagcgcctccagctgcagcatctgcgc Protospacer
** ****** ************* . . ..
395. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to AP022363 (Escherichia coli E303 plasmid pE303_IMP6 DNA, complete sequence) position: , mismatch: 11, identity: 0.656
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tcgagcagcgcctccagctgcagcatctgcgc Protospacer
** ****** ************* . . ..
396. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to CP025574 (Escherichia coli strain E-1246 plasmid pE1246_1, complete sequence) position: , mismatch: 11, identity: 0.656
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tcgagcagcgcctccagctgcagcatctgcgc Protospacer
** ****** ************* . . ..
397. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to AP022361 (Escherichia coli E301 plasmid pE301_IMP6 DNA, complete sequence) position: , mismatch: 11, identity: 0.656
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tcgagcagcgcctccagctgcagcatctgcgc Protospacer
** ****** ************* . . ..
398. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP021937 (Escherichia coli strain AR_0055 plasmid unitig_3j3rc_linear, complete sequence) position: , mismatch: 11, identity: 0.656
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tcgagcagcgcctccagctgcagcatctgcgc Protospacer
** ****** ************* . . ..
399. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_LR130546 (Escherichia coli strain B36 isolate B36 plasmid 2) position: , mismatch: 11, identity: 0.656
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tcgagcagcgcctccagctgcagcatctgcgc Protospacer
** ****** ************* . . ..
400. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP033847 (Escherichia coli strain FDAARGOS_497 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.656
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tcgagcagcgcctccagctgcagcatctgcgc Protospacer
** ****** ************* . . ..
401. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP033761 (Escherichia coli strain FDAARGOS_536 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.656
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tcgagcagcgcctccagctgcagcatctgcgc Protospacer
** ****** ************* . . ..
402. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to MK295821 (Escherichia coli O25b:H4-ST131 strain B316 plasmid pB316, complete sequence) position: , mismatch: 11, identity: 0.656
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tcgagcagcgcctccagctgcagcatctgcgc Protospacer
** ****** ************* . . ..
403. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to MK295822 (Escherichia coli O25b:H4-ST131 strain 76 plasmid p76, complete sequence) position: , mismatch: 11, identity: 0.656
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tcgagcagcgcctccagctgcagcatctgcgc Protospacer
** ****** ************* . . ..
404. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to MK295823 (Escherichia coli O25b:H4-ST131 strain 461 plasmid p461, complete sequence) position: , mismatch: 11, identity: 0.656
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tcgagcagcgcctccagctgcagcatctgcgc Protospacer
** ****** ************* . . ..
405. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to MK295831 (Escherichia coli O25b:H4-ST131 strain 396 plasmid p396, complete sequence) position: , mismatch: 11, identity: 0.656
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tcgagcagcgcctccagctgcagcatctgcgc Protospacer
** ****** ************* . . ..
406. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to MK295833 (Escherichia coli O25b:H4-ST131 strain 418 plasmid p418, complete sequence) position: , mismatch: 11, identity: 0.656
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tcgagcagcgcctccagctgcagcatctgcgc Protospacer
** ****** ************* . . ..
407. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to JX127248 (Uncultured bacterium plasmid pRSB225, complete sequence) position: , mismatch: 11, identity: 0.656
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tcgagcagcgcctccagctgcagcatctgcgc Protospacer
** ****** ************* . . ..
408. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP014321 (Escherichia coli JJ1887 plasmid pJJ1887-4, complete sequence) position: , mismatch: 11, identity: 0.656
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tcgagcagcgcctccagctgcagcatctgcgc Protospacer
** ****** ************* . . ..
409. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_LT985271 (Escherichia coli strain 661 plasmid RCS59_p, complete sequence) position: , mismatch: 11, identity: 0.656
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tcgagcagcgcctccagctgcagcatctgcgc Protospacer
** ****** ************* . . ..
410. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_LT985213 (Escherichia coli strain 708 plasmid RCS102_p, complete sequence) position: , mismatch: 11, identity: 0.656
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tcgagcagcgcctccagctgcagcatctgcgc Protospacer
** ****** ************* . . ..
411. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_LT985221 (Escherichia coli strain TN03 plasmid RCS22_p, complete sequence) position: , mismatch: 11, identity: 0.656
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tcgagcagcgcctccagctgcagcatctgcgc Protospacer
** ****** ************* . . ..
412. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_CP018954 (Escherichia coli strain Ecol_316 plasmid pEC316_3, complete sequence) position: , mismatch: 11, identity: 0.656
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tcgagcagcgcctccagctgcagcatctgcgc Protospacer
** ****** ************* . . ..
413. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to MK295818 (Escherichia coli O25b:H4-ST131 strain U60 plasmid pU60, complete sequence) position: , mismatch: 11, identity: 0.656
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tcgagcagcgcctccagctgcagcatctgcgc Protospacer
** ****** ************* . . ..
414. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to MK295820 (Escherichia coli O25b:H4-ST131 strain B28 plasmid pB28, complete sequence) position: , mismatch: 11, identity: 0.656
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tcgagcagcgcctccagctgcagcatctgcgc Protospacer
** ****** ************* . . ..
415. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_MK797990 (Salmonella enterica subsp. enterica serovar Wien strain ZM3 plasmid pZM3, complete sequence) position: , mismatch: 11, identity: 0.656
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tcgagcagcgcctccagctgcagcatctgcgc Protospacer
** ****** ************* . . ..
416. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_AP018939 (Escherichia coli strain JSWP006 plasmid pJSWP006_1, complete sequence) position: , mismatch: 11, identity: 0.656
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tcgagcagcgcctccagctgcagcatctgcgc Protospacer
** ****** ************* . . ..
417. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_MN218686 (Escherichia coli strain 5M plasmid pISV_IncFII_NDM-5, complete sequence) position: , mismatch: 11, identity: 0.656
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tcgagcagcgcctccagctgcagcatctgcgc Protospacer
** ****** ************* . . ..
418. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_MF156697 (Escherichia coli strain BTR plasmid pBTR-CTXM, complete sequence) position: , mismatch: 11, identity: 0.656
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tcgagcagcgcctccagctgcagcatctgcgc Protospacer
** ****** ************* . . ..
419. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_KY706108 (Escherichia coli strain pAA-ST131 plasmid ESBL20150001, complete sequence) position: , mismatch: 11, identity: 0.656
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tcgagcagcgcctccagctgcagcatctgcgc Protospacer
** ****** ************* . . ..
420. spacer 2.3|1780250|32|NC_014216|CRISPRCasFinder,CRT matches to NZ_LC492469 (Escherichia coli strain M216 plasmid pM216_mF, complete sequence) position: , mismatch: 11, identity: 0.656
tccagcagctcctccagctgcaggccgccgat CRISPR spacer
tcgagcagcgcctccagctgcagcatctgcgc Protospacer
** ****** ************* . . ..
421. spacer 2.27|1781716|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to CP007157 (Corynebacterium falsenii DSM 44353 strain BL 8171 plasmid phiCFAL8171I, complete sequence) position: , mismatch: 11, identity: 0.656
aattattgaagaggaggtgtggccgtgagata CRISPR spacer
ctcggatgatgagggggtgtggccgtgagcct Protospacer
. . *** ****.************** .
422. spacer 2.37|1782326|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to MN234179 (Gordonia phage Pipp, complete genome) position: , mismatch: 11, identity: 0.656
tcctcgtgcgttgcccccgcctcgtctcgtac CRISPR spacer
cggcgttgcggtgcccgcgcctcgtctcgagg Protospacer
. . **** ***** ************ .
423. spacer 3.1|1785042|32|NC_014216|CRISPRCasFinder,CRT matches to NC_008757 (Polaromonas naphthalenivorans CJ2 plasmid pPNAP01, complete sequence) position: , mismatch: 11, identity: 0.656
aagtccaccggctttgccgatatggacctgtg CRISPR spacer
gcttccagcggctttgacgatatggatgacga Protospacer
. **** ******** *********. .
424. spacer 3.24|1786425|32|NC_014216|CRISPRCasFinder,CRT matches to MK919484 (Arthrobacter phage DreamTeam, complete genome) position: , mismatch: 11, identity: 0.656
ctttgcccggctagcgcccagccactcaagct CRISPR spacer
gaaagcccggcttgcgcccagcccctcttcga Protospacer
******** ********** ***
425. spacer 3.24|1786425|32|NC_014216|CRISPRCasFinder,CRT matches to MT498050 (Arthrobacter phage Gisselle, complete genome) position: , mismatch: 11, identity: 0.656
ctttgcccggctagcgcccagccactcaagct CRISPR spacer
gaaagcccggcttgcgcccagcccctcttcga Protospacer
******** ********** ***
426. spacer 3.69|1789129|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025613 (Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.656
cgggatgatgaagaataccggggcgcgattga CRISPR spacer
ggggatgatgaagatttccggggctttggccg Protospacer
************* * ******* . . . .
427. spacer 3.87|1790215|32|NC_014216|CRISPRCasFinder,CRT,PILER-CR matches to NC_008771 (Verminephrobacter eiseniae EF01-2 plasmid pVEIS01, complete sequence) position: , mismatch: 11, identity: 0.656
ctggccgccatcggcgttggtgccgcgatttt CRISPR spacer
tgcttggccatcggctttggtggcgcgataac Protospacer
. . ********* ****** ****** .
