Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_014169 Bifidobacterium longum subsp. longum JDM301, complete sequence 4 crisprs c2c9_V-U4,cas3,WYL,DEDDh,casR 0 1 3 0

Results visualization

1. NC_014169
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014169_1 321251-321336 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014169_2 1589818-1589973 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014169_3 2052432-2052517 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014169_4 2189090-2189164 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_014169_1 1.1|321277|34|NC_014169|CRISPRCasFinder 321277-321310 34 MH051917 Enterobacteria phage vB_EcoM_IME341, complete genome 77783-77816 9 0.735
NC_014169_1 1.1|321277|34|NC_014169|CRISPRCasFinder 321277-321310 34 NC_014260 Enterobacteria phage IME08, complete genome 96611-96644 9 0.735
NC_014169_1 1.1|321277|34|NC_014169|CRISPRCasFinder 321277-321310 34 MT150133 Enterobacteria phage vB_EcoM_IME540, complete genome 143362-143395 9 0.735
NC_014169_1 1.1|321277|34|NC_014169|CRISPRCasFinder 321277-321310 34 MK234886 Escherichia phage AnYang, complete genome 65312-65345 9 0.735
NC_014169_1 1.1|321277|34|NC_014169|CRISPRCasFinder 321277-321310 34 HM071924 Enterobacteria phage IME08, complete sequence 96611-96644 9 0.735

1. spacer 1.1|321277|34|NC_014169|CRISPRCasFinder matches to MH051917 (Enterobacteria phage vB_EcoM_IME341, complete genome) position: , mismatch: 9, identity: 0.735

atttgtagggaaatcctccagttcaaattcgtta	CRISPR spacer
acctccaaacaaatccaccagttcaacttcgtta	Protospacer
*..* .*.. ****** ********* *******

2. spacer 1.1|321277|34|NC_014169|CRISPRCasFinder matches to NC_014260 (Enterobacteria phage IME08, complete genome) position: , mismatch: 9, identity: 0.735

atttgtagggaaatcctccagttcaaattcgtta	CRISPR spacer
acctccaaacaaatccaccagttcaacttcgtta	Protospacer
*..* .*.. ****** ********* *******

3. spacer 1.1|321277|34|NC_014169|CRISPRCasFinder matches to MT150133 (Enterobacteria phage vB_EcoM_IME540, complete genome) position: , mismatch: 9, identity: 0.735

atttgtagggaaatcctccagttcaaattcgtta	CRISPR spacer
acctccaaacaaatccaccagttcaacttcgtta	Protospacer
*..* .*.. ****** ********* *******

4. spacer 1.1|321277|34|NC_014169|CRISPRCasFinder matches to MK234886 (Escherichia phage AnYang, complete genome) position: , mismatch: 9, identity: 0.735

atttgtagggaaatcctccagttcaaattcgtta	CRISPR spacer
acctccaaacaaatccaccagttcaacttcgtta	Protospacer
*..* .*.. ****** ********* *******

5. spacer 1.1|321277|34|NC_014169|CRISPRCasFinder matches to HM071924 (Enterobacteria phage IME08, complete sequence) position: , mismatch: 9, identity: 0.735

atttgtagggaaatcctccagttcaaattcgtta	CRISPR spacer
acctccaaacaaatccaccagttcaacttcgtta	Protospacer
*..* .*.. ****** ********* *******

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 368139 : 434483 58 Thermus_phage(15.38%) protease,tRNA,transposase NA
DBSCAN-SWA_2 893095 : 906002 12 Gordonia_phage(33.33%) integrase,transposase attL 894178:894237|attR 897569:897667
DBSCAN-SWA_3 2270899 : 2359419 57 Bacillus_phage(25.0%) integrase,tRNA,transposase attL 2301381:2301397|attR 2359672:2359688
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage