Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_009494 Legionella pneumophila str. Corby, complete sequence 2 crisprs DEDDh,DinG,cas3,WYL,RT,csa3 0 1 6 0

Results visualization

1. NC_009494
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_009494_1 1253558-1253705 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_009494_2 1661585-1661673 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_009494_2 2.1|1661614|31|NC_009494|CRISPRCasFinder 1661614-1661644 31 NZ_CP021285 Legionella pneumophila subsp. pneumophila strain Allentown 1 (D-7475) plasmid unnamed2, complete sequence 33893-33923 4 0.871
NC_009494_2 2.1|1661614|31|NC_009494|CRISPRCasFinder 1661614-1661644 31 NZ_CP021285 Legionella pneumophila subsp. pneumophila strain Allentown 1 (D-7475) plasmid unnamed2, complete sequence 35384-35414 4 0.871
NC_009494_2 2.1|1661614|31|NC_009494|CRISPRCasFinder 1661614-1661644 31 NC_006366 Legionella pneumophila str. Lens plasmid pLPL, complete sequence 43967-43997 4 0.871
NC_009494_2 2.1|1661614|31|NC_009494|CRISPRCasFinder 1661614-1661644 31 MH319723 Marine virus AG-345-D19 Ga0172267_104 genomic sequence 8623-8653 9 0.71

1. spacer 2.1|1661614|31|NC_009494|CRISPRCasFinder matches to NZ_CP021285 (Legionella pneumophila subsp. pneumophila strain Allentown 1 (D-7475) plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.871

ccagcagtaccagcagcatttgacggcttat	CRISPR spacer
aaagcagttccagcagcatttgatggcttat	Protospacer
  ****** **************.*******

2. spacer 2.1|1661614|31|NC_009494|CRISPRCasFinder matches to NZ_CP021285 (Legionella pneumophila subsp. pneumophila strain Allentown 1 (D-7475) plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.871

ccagcagtaccagcagcatttgacggcttat	CRISPR spacer
ccagcagtaccagcagcatttgatggttcac	Protospacer
***********************.**.*.*.

3. spacer 2.1|1661614|31|NC_009494|CRISPRCasFinder matches to NC_006366 (Legionella pneumophila str. Lens plasmid pLPL, complete sequence) position: , mismatch: 4, identity: 0.871

ccagcagtaccagcagcatttgacggcttat	CRISPR spacer
aaagcagttccagcagcatttgatggcttat	Protospacer
  ****** **************.*******

4. spacer 2.1|1661614|31|NC_009494|CRISPRCasFinder matches to MH319723 (Marine virus AG-345-D19 Ga0172267_104 genomic sequence) position: , mismatch: 9, identity: 0.71

ccagcagtaccagcagcatttgacggcttat	CRISPR spacer
ccagcagttccagcagcagttgatacttggc	Protospacer
******** ********* ****.. .* ..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1018596 : 1025435 9 Acinetobacter_phage(42.86%) NA NA
DBSCAN-SWA_2 1279687 : 1302783 26 Acidithiobacillus_phage(44.44%) transposase,integrase attL 1287730:1287752|attR 1302785:1302807
DBSCAN-SWA_3 1315248 : 1367903 41 Acidithiobacillus_phage(25.0%) transposase NA
DBSCAN-SWA_4 1421352 : 1431087 9 Staphylococcus_phage(42.86%) NA NA
DBSCAN-SWA_5 2201208 : 2256068 49 Escherichia_phage(22.22%) transposase,tRNA,integrase attL 2237733:2237750|attR 2264124:2264141
DBSCAN-SWA_6 2372669 : 2382792 7 Bacillus_phage(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage