Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_014153 Thiomonas intermedia K12, complete genome 9 crisprs Cas14u_CAS-V,c2c9_V-U4,csa3,DEDDh,DinG 2 0 3 0
NC_014154 Thiomonas intermedia K12 plasmid pTINT01, complete sequence 0 crisprs DEDDh 0 0 0 0
NC_014155 Thiomonas intermedia K12 plasmid pTINT02, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NC_014153
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014153_1 157050-157134 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014153_2 423058-423159 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014153_3 533351-533447 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014153_4 1967896-1968021 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014153_5 2166179-2166348 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014153_6 2220675-2220769 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014153_7 2311189-2311316 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014153_8 2887174-2887280 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014153_9 3057618-3057744 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_014153_3 3.1|533385|29|NC_014153|CRISPRCasFinder 533385-533413 29 NC_014153.1 157107-157135 1 0.966
NC_014153_3 3.1|533385|29|NC_014153|CRISPRCasFinder 533385-533413 29 NC_014153.1 616853-616881 1 0.966
NC_014153_8 8.1|2887200|55|NC_014153|CRISPRCasFinder 2887200-2887254 55 NC_014153.1 270557-270611 1 0.982
NC_014153_3 3.1|533385|29|NC_014153|CRISPRCasFinder 533385-533413 29 NC_014153.1 1498661-1498689 2 0.931
NC_014153_8 8.1|2887200|55|NC_014153|CRISPRCasFinder 2887200-2887254 55 NC_014153.1 366530-366584 2 0.964
NC_014153_8 8.1|2887200|55|NC_014153|CRISPRCasFinder 2887200-2887254 55 NC_014153.1 2105801-2105855 2 0.964

1. spacer 3.1|533385|29|NC_014153|CRISPRCasFinder matches to position: 157107-157135, mismatch: 1, identity: 0.966

cctcccccacaagtgggggaggtgagaac	CRISPR spacer
cctcccccacaagtggaggaggtgagaac	Protospacer
****************.************

2. spacer 3.1|533385|29|NC_014153|CRISPRCasFinder matches to position: 616853-616881, mismatch: 1, identity: 0.966

cctcccccacaagtgggggaggtgagaac	CRISPR spacer
cctcccccacaagtggaggaggtgagaac	Protospacer
****************.************

3. spacer 8.1|2887200|55|NC_014153|CRISPRCasFinder matches to position: 270557-270611, mismatch: 1, identity: 0.982

tctcatcccccttggggggcctgacgcgaacgcggcaggtctgggggcgctctca	CRISPR spacer
tctcatccccctcggggggcctgacgcgaacgcggcaggtctgggggcgctctca	Protospacer
************.******************************************

4. spacer 3.1|533385|29|NC_014153|CRISPRCasFinder matches to position: 1498661-1498689, mismatch: 2, identity: 0.931

cctcccccacaagtgggggaggtgagaac	CRISPR spacer
cctcccccacaagtggaggaggttagaac	Protospacer
****************.****** *****

5. spacer 8.1|2887200|55|NC_014153|CRISPRCasFinder matches to position: 366530-366584, mismatch: 2, identity: 0.964

tctcatcccccttggggggcctgacgcgaacgcggcaggtctgggggcgctctca	CRISPR spacer
tctcatccccctcggggggcctgacgcgaacgcggcaggtctgggggcactctca	Protospacer
************.***********************************.******

6. spacer 8.1|2887200|55|NC_014153|CRISPRCasFinder matches to position: 2105801-2105855, mismatch: 2, identity: 0.964

tctcatcccccttggggggcctgacgcgaacgcggcaggtctgggggcgctctca	CRISPR spacer
tctcatcccccttggggggcctgacgcgaacgcggcaggtctggggggcctctca	Protospacer
***********************************************  ******

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1626836 : 1690925 48 Acidithiobacillus_phage(21.43%) transposase,holin,integrase attL 1627323:1627341|attR 1692364:1692382
DBSCAN-SWA_2 2002991 : 2068291 52 Bacillus_phage(13.33%) transposase,integrase,tRNA attL 2049720:2049735|attR 2071668:2071683
DBSCAN-SWA_3 3299965 : 3306948 7 Acinetobacter_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage