Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_014168 Segniliparus rotundus DSM 44985, complete sequence 5 crisprs PD-DExK,cas3,WYL,csa3,DinG,cas4 0 1 4 0

Results visualization

1. NC_014168
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014168_1 431804-431919 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014168_2 1559669-1559774 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014168_3 1641144-1641351 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014168_4 1798805-1798940 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014168_5 2959022-2959133 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_014168_4 4.1|1798856|34|NC_014168|CRISPRCasFinder 1798856-1798889 34 NZ_CP054615 Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence 234318-234351 11 0.676

1. spacer 4.1|1798856|34|NC_014168|CRISPRCasFinder matches to NZ_CP054615 (Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.676

cggcgctcccccgttcgccacggaggcatttcga	CRISPR spacer
gaatggattcccgttcgccacggcgggatttcgg	Protospacer
 ...*  ..************** ** ******.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 25875 : 34037 18 Mycobacterium_phage(25.0%) NA NA
DBSCAN-SWA_2 42806 : 58500 18 Mycobacterium_phage(50.0%) terminase,capsid,portal NA
DBSCAN-SWA_3 1080771 : 1162952 87 Gordonia_phage(30.43%) portal,capsid,protease,integrase,holin,transposase,head,tRNA,terminase attL 1134842:1134881|attR 1162984:1163023
DBSCAN-SWA_4 2374847 : 2384240 13 Mycobacterium_phage(50.0%) integrase attL 2371137:2371152|attR 2381199:2381214
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage