Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_014330 Brachyspira pilosicoli 95/1000, complete sequence 2 crisprs cas4,DinG,csa3 1 0 1 0

Results visualization

1. NC_014330
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014330_1 950336-950488 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014330_2 2008853-2009476 Orphan NA
8 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_014330_1 1.1|950390|45|NC_014330|CRISPRCasFinder 950390-950434 45 NC_014330.1 814973-815017 1 0.978

1. spacer 1.1|950390|45|NC_014330|CRISPRCasFinder matches to position: 814973-815017, mismatch: 1, identity: 0.978

cttcataatataaaagtggtagaacttctaatacaaaaaggtgct	CRISPR spacer
cttcataatataaaagtgatagaacttctaatacaaaaaggtgct	Protospacer
******************.**************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1574388 : 1637339 64 Pseudomonas_phage(20.0%) tail,protease,portal,integrase,capsid,tRNA,terminase,head attL 1574317:1574334|attR 1637930:1637947
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage