Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_014484 Spirochaeta thermophila DSM 6192, complete sequence 3 crisprs cas3,cas5,cas8c,cas7,cas4,cas1,cas2,DinG,csa3,DEDDh,cas6 0 1 1 0

Results visualization

1. NC_014484
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014484_1 461101-462491 TypeI I-C
20 spacers
cas2,cas1,cas4,cas7,cas8c,cas5,cas3,WYL

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014484_2 756901-756991 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014484_3 797244-797332 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_014484_1 1.9|461474|34|NC_014484|CRISPRCasFinder,CRT,PILER-CR 461474-461507 34 NZ_CP046715 Nostoc sp. ATCC 53789 plasmid pNsp_l, complete sequence 18029-18062 11 0.676

1. spacer 1.9|461474|34|NC_014484|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP046715 (Nostoc sp. ATCC 53789 plasmid pNsp_l, complete sequence) position: , mismatch: 11, identity: 0.676

cagcaggggcaagcgtctgcacaattactatgag	CRISPR spacer
ttgaccgggcaagcgtttgcacaattaatactca	Protospacer
. *   **********.********** **.  .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1361070 : 1371311 7 Microbacterium_phage(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage