Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_015592 Sinorhizobium meliloti AK83 plasmid pSINME02, complete sequence 0 crisprs NA 0 0 0 0
NC_015596 Sinorhizobium meliloti AK83 chromosome 2, complete sequence 1 crisprs csa3,RT 0 1 1 0
NC_015590 Sinorhizobium meliloti AK83 chromosome 1, complete sequence 3 crisprs csa3,WYL,cas3,DEDDh 0 1 9 0
NC_015591 Sinorhizobium meliloti AK83 chromosome 3, complete sequence 0 crisprs DEDDh,RT 0 0 4 0
NC_015597 Sinorhizobium meliloti AK83 plasmid pSINME01, complete sequence 0 crisprs NA 0 0 1 0

Results visualization

1. NC_015596
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_015596_1 1080019-1080255 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_015596_1 1.2|1080175|48|NC_015596|PILER-CR 1080175-1080222 48 NC_019849 Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence 651280-651327 3 0.938
NC_015596_1 1.2|1080175|48|NC_015596|PILER-CR 1080175-1080222 48 NC_017326 Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence 636274-636321 3 0.938
NC_015596_1 1.2|1080175|48|NC_015596|PILER-CR 1080175-1080222 48 NC_017323 Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence 233321-233368 3 0.938
NC_015596_1 1.2|1080175|48|NC_015596|PILER-CR 1080175-1080222 48 NZ_CP009146 Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence 644339-644386 3 0.938
NC_015596_1 1.2|1080175|48|NC_015596|PILER-CR 1080175-1080222 48 NC_018701 Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence 634148-634195 3 0.938
NC_015596_1 1.2|1080175|48|NC_015596|PILER-CR 1080175-1080222 48 NZ_CP021802 Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence 1302076-1302123 3 0.938
NC_015596_1 1.2|1080175|48|NC_015596|PILER-CR 1080175-1080222 48 NZ_CP021831 Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence 895572-895619 3 0.938
NC_015596_1 1.2|1080175|48|NC_015596|PILER-CR 1080175-1080222 48 NZ_CP021814 Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence 558325-558372 3 0.938
NC_015596_1 1.2|1080175|48|NC_015596|PILER-CR 1080175-1080222 48 NZ_CP021810 Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence 1422939-1422986 3 0.938
NC_015596_1 1.2|1080175|48|NC_015596|PILER-CR 1080175-1080222 48 NZ_CP021218 Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence 794880-794927 3 0.938
NC_015596_1 1.2|1080175|48|NC_015596|PILER-CR 1080175-1080222 48 NZ_CP026527 Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence 657953-658000 3 0.938
NC_015596_1 1.2|1080175|48|NC_015596|PILER-CR 1080175-1080222 48 NC_003078 Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence 1085460-1085507 3 0.938
NC_015596_1 1.2|1080175|48|NC_015596|PILER-CR 1080175-1080222 48 NZ_CP021799 Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence 1151682-1151729 3 0.938
NC_015596_1 1.2|1080175|48|NC_015596|PILER-CR 1080175-1080222 48 NZ_CP021823 Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence 773080-773127 3 0.938
NC_015596_1 1.2|1080175|48|NC_015596|PILER-CR 1080175-1080222 48 NZ_CP021795 Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence 292537-292584 3 0.938
NC_015596_1 1.2|1080175|48|NC_015596|PILER-CR 1080175-1080222 48 NZ_CP021806 Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence 373452-373499 3 0.938
NC_015596_1 1.2|1080175|48|NC_015596|PILER-CR 1080175-1080222 48 NZ_CP019484 Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence 1226039-1226086 3 0.938
NC_015596_1 1.2|1080175|48|NC_015596|PILER-CR 1080175-1080222 48 NZ_CP019487 Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence 998722-998769 3 0.938
NC_015596_1 1.2|1080175|48|NC_015596|PILER-CR 1080175-1080222 48 NC_020560 Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence 1085465-1085512 3 0.938

1. spacer 1.2|1080175|48|NC_015596|PILER-CR matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 3, identity: 0.938

caacaagatcgatcgtgtggctgtgctctttctcggcggccgtgctgc	CRISPR spacer
cgacgagatcgatcgtgtggctgtgctctttttcggcggccgtgctgc	Protospacer
*.**.**************************.****************

2. spacer 1.2|1080175|48|NC_015596|PILER-CR matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 3, identity: 0.938

caacaagatcgatcgtgtggctgtgctctttctcggcggccgtgctgc	CRISPR spacer
cgacgagatcgatcgtgtggctgtgctctttttcggcggccgtgctgc	Protospacer
*.**.**************************.****************

3. spacer 1.2|1080175|48|NC_015596|PILER-CR matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 3, identity: 0.938

caacaagatcgatcgtgtggctgtgctctttctcggcggccgtgctgc	CRISPR spacer
cgacgagatcgatcgtgtggctgtgctctttttcggcggccgtgctgc	Protospacer
*.**.**************************.****************

4. spacer 1.2|1080175|48|NC_015596|PILER-CR matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 3, identity: 0.938

caacaagatcgatcgtgtggctgtgctctttctcggcggccgtgctgc	CRISPR spacer
cgacgagatcgatcgtgtggctgtgctctttttcggcggccgtgctgc	Protospacer
*.**.**************************.****************

5. spacer 1.2|1080175|48|NC_015596|PILER-CR matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 3, identity: 0.938

caacaagatcgatcgtgtggctgtgctctttctcggcggccgtgctgc	CRISPR spacer
cgacgagatcgatcgtgtggctgtgctctttttcggcggccgtgctgc	Protospacer
*.**.**************************.****************

6. spacer 1.2|1080175|48|NC_015596|PILER-CR matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 3, identity: 0.938

caacaagatcgatcgtgtggctgtgctctttctcggcggccgtgctgc	CRISPR spacer
cgacgagatcgatcgtgtggctgtgctctttttcggcggccgtgctgc	Protospacer
*.**.**************************.****************

7. spacer 1.2|1080175|48|NC_015596|PILER-CR matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 3, identity: 0.938

caacaagatcgatcgtgtggctgtgctctttctcggcggccgtgctgc	CRISPR spacer
cgacgagatcgatcgtgtggctgtgctctttttcggcggccgtgctgc	Protospacer
*.**.**************************.****************

8. spacer 1.2|1080175|48|NC_015596|PILER-CR matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 3, identity: 0.938

caacaagatcgatcgtgtggctgtgctctttctcggcggccgtgctgc	CRISPR spacer
cgacgagatcgatcgtgtggctgtgctctttttcggcggccgtgctgc	Protospacer
*.**.**************************.****************

9. spacer 1.2|1080175|48|NC_015596|PILER-CR matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 3, identity: 0.938

caacaagatcgatcgtgtggctgtgctctttctcggcggccgtgctgc	CRISPR spacer
cgacgagatcgatcgtgtggctgtgctctttttcggcggccgtgctgc	Protospacer
*.**.**************************.****************

10. spacer 1.2|1080175|48|NC_015596|PILER-CR matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 3, identity: 0.938

caacaagatcgatcgtgtggctgtgctctttctcggcggccgtgctgc	CRISPR spacer
cgacgagatcgatcgtgtggctgtgctctttttcggcggccgtgctgc	Protospacer
*.**.**************************.****************

11. spacer 1.2|1080175|48|NC_015596|PILER-CR matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 3, identity: 0.938

caacaagatcgatcgtgtggctgtgctctttctcggcggccgtgctgc	CRISPR spacer
cgacgagatcgatcgtgtggctgtgctctttttcggcggccgtgctgc	Protospacer
*.**.**************************.****************

12. spacer 1.2|1080175|48|NC_015596|PILER-CR matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 3, identity: 0.938

caacaagatcgatcgtgtggctgtgctctttctcggcggccgtgctgc	CRISPR spacer
cgacgagatcgatcgtgtggctgtgctctttttcggcggccgtgctgc	Protospacer
*.**.**************************.****************

13. spacer 1.2|1080175|48|NC_015596|PILER-CR matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 3, identity: 0.938

caacaagatcgatcgtgtggctgtgctctttctcggcggccgtgctgc	CRISPR spacer
cgacgagatcgatcgtgtggctgtgctctttttcggcggccgtgctgc	Protospacer
*.**.**************************.****************

14. spacer 1.2|1080175|48|NC_015596|PILER-CR matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 3, identity: 0.938

caacaagatcgatcgtgtggctgtgctctttctcggcggccgtgctgc	CRISPR spacer
cgacgagatcgatcgtgtggctgtgctctttttcggcggccgtgctgc	Protospacer
*.**.**************************.****************

15. spacer 1.2|1080175|48|NC_015596|PILER-CR matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 3, identity: 0.938

caacaagatcgatcgtgtggctgtgctctttctcggcggccgtgctgc	CRISPR spacer
cgacgagatcgatcgtgtggctgtgctctttttcggcggccgtgctgc	Protospacer
*.**.**************************.****************

16. spacer 1.2|1080175|48|NC_015596|PILER-CR matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 3, identity: 0.938

caacaagatcgatcgtgtggctgtgctctttctcggcggccgtgctgc	CRISPR spacer
cgacgagatcgatcgtgtggctgtgctctttttcggcggccgtgctgc	Protospacer
*.**.**************************.****************

17. spacer 1.2|1080175|48|NC_015596|PILER-CR matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 3, identity: 0.938

caacaagatcgatcgtgtggctgtgctctttctcggcggccgtgctgc	CRISPR spacer
cgacgagatcgatcgtgtggctgtgctctttttcggcggccgtgctgc	Protospacer
*.**.**************************.****************

18. spacer 1.2|1080175|48|NC_015596|PILER-CR matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 3, identity: 0.938

caacaagatcgatcgtgtggctgtgctctttctcggcggccgtgctgc	CRISPR spacer
cgacgagatcgatcgtgtggctgtgctctttttcggcggccgtgctgc	Protospacer
*.**.**************************.****************

19. spacer 1.2|1080175|48|NC_015596|PILER-CR matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 3, identity: 0.938

caacaagatcgatcgtgtggctgtgctctttctcggcggccgtgctgc	CRISPR spacer
cgacgagatcgatcgtgtggctgtgctctttttcggcggccgtgctgc	Protospacer
*.**.**************************.****************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 705882 : 713830 8 Escherichia_phage(33.33%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_015590
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_015590_1 780002-780115 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_015590_2 1773926-1774038 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_015590_3 3597676-3597822 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_015590_1 1.1|780040|38|NC_015590|CRISPRCasFinder 780040-780077 38 NZ_CP015741 Shinella sp. HZN7 plasmid pShin-05, complete sequence 7231-7268 4 0.895
NC_015590_1 1.1|780040|38|NC_015590|CRISPRCasFinder 780040-780077 38 NC_011370 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG203, complete sequence 250765-250802 5 0.868
NC_015590_1 1.1|780040|38|NC_015590|CRISPRCasFinder 780040-780077 38 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 1691497-1691534 6 0.842
NC_015590_1 1.1|780040|38|NC_015590|CRISPRCasFinder 780040-780077 38 NZ_CP015881 Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence 126743-126780 6 0.842
NC_015590_1 1.1|780040|38|NC_015590|CRISPRCasFinder 780040-780077 38 NZ_CP050082 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b4, complete sequence 188971-189008 6 0.842
NC_015590_1 1.1|780040|38|NC_015590|CRISPRCasFinder 780040-780077 38 NZ_CP024308 Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3a, complete sequence 99915-99952 8 0.789
NC_015590_1 1.1|780040|38|NC_015590|CRISPRCasFinder 780040-780077 38 NZ_CP013632 Rhizobium sp. N324 plasmid pRspN324b, complete sequence 155054-155091 9 0.763

1. spacer 1.1|780040|38|NC_015590|CRISPRCasFinder matches to NZ_CP015741 (Shinella sp. HZN7 plasmid pShin-05, complete sequence) position: , mismatch: 4, identity: 0.895

gggggcgaagggccggtctatccgaacatgtgaatgtc	CRISPR spacer
ggcggcgaaggcccggtctatccgaacatgtgaatttt	Protospacer
** ******** *********************** *.

2. spacer 1.1|780040|38|NC_015590|CRISPRCasFinder matches to NC_011370 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG203, complete sequence) position: , mismatch: 5, identity: 0.868

gggggcgaagggccggtctatccgaacatgtgaatgtc	CRISPR spacer
ggcggcgaagggccggtctatccgaatatgtgatcatc	Protospacer
** ***********************.****** ..**

3. spacer 1.1|780040|38|NC_015590|CRISPRCasFinder matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 6, identity: 0.842

gggggcgaagggccggtctatccgaacatgtgaatgtc	CRISPR spacer
ggcggcgaaggcccggtctatccgaacatgtgacgtcc	Protospacer
** ******** *********************   .*

4. spacer 1.1|780040|38|NC_015590|CRISPRCasFinder matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 6, identity: 0.842

gggggcgaagggccggtctatccgaacatgtgaatgtc	CRISPR spacer
ggcggcgaaggcccggtctatccgaacatgtgagttcg	Protospacer
** ******** *********************.* . 

5. spacer 1.1|780040|38|NC_015590|CRISPRCasFinder matches to NZ_CP050082 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b4, complete sequence) position: , mismatch: 6, identity: 0.842

gggggcgaagggccggtctatccgaacatgtgaatgtc	CRISPR spacer
ggcggcgaagggccggtctatccgaatatgtaaccgac	Protospacer
** ***********************.****.* .* *

6. spacer 1.1|780040|38|NC_015590|CRISPRCasFinder matches to NZ_CP024308 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3a, complete sequence) position: , mismatch: 8, identity: 0.789

gggggcgaagggccggtctatccgaacatgtgaatgtc	CRISPR spacer
gggggcgaaggcccggtctatccgaacatgtagcccga	Protospacer
*********** *******************.. .   

7. spacer 1.1|780040|38|NC_015590|CRISPRCasFinder matches to NZ_CP013632 (Rhizobium sp. N324 plasmid pRspN324b, complete sequence) position: , mismatch: 9, identity: 0.763

gggggcgaagggccggtctatccgaacatgtgaatgtc	CRISPR spacer
ggcggcgaggggccggtctatccgaacatgtagggcag	Protospacer
** *****.**********************...    

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 263051 : 303155 54 Sinorhizobium_phage(71.79%) portal,tail,integrase,capsid,terminase,head attL 262448:262462|attR 279786:279800
DBSCAN-SWA_2 797658 : 848945 71 Sinorhizobium_phage(60.0%) transposase,terminase,tail,head NA
DBSCAN-SWA_3 1316211 : 1402523 73 uncultured_Mediterranean_phage(26.47%) portal,tRNA,tail,integrase,protease,capsid,terminase,head attL 1371479:1371495|attR 1379388:1379404
DBSCAN-SWA_4 1422759 : 1429164 8 Klebsiella_phage(16.67%) NA NA
DBSCAN-SWA_5 1433603 : 1445580 12 Klebsiella_phage(20.0%) NA NA
DBSCAN-SWA_6 1810386 : 1892173 94 Sinorhizobium_phage(72.09%) portal,tRNA,transposase,tail,integrase,protease,capsid,holin,terminase,head attL 1823583:1823601|attR 1903550:1903568
DBSCAN-SWA_7 2315303 : 2327671 15 Paracoccus_phage(55.56%) portal,tail,protease,capsid,head NA
DBSCAN-SWA_8 2359949 : 2369584 6 Vibrio_phage(33.33%) NA NA
DBSCAN-SWA_9 2401350 : 2453164 48 Klosneuvirus(14.29%) holin,transposase,protease,tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NC_015591
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 296707 : 416728 96 Sinorhizobium_phage(10.0%) transposase,protease,integrase attL 293457:293473|attR 339008:339024
DBSCAN-SWA_2 771686 : 847383 57 Stx2-converting_phage(20.0%) transposase NA
DBSCAN-SWA_3 1041487 : 1106289 51 Stx2-converting_phage(18.18%) transposase NA
DBSCAN-SWA_4 1122766 : 1254474 93 Stx2-converting_phage(15.62%) integrase,protease,transposase attL 1183809:1183841|attR 1196760:1196775
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NC_015597
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 7215 : 176145 113 Mycobacterium_phage(15.38%) integrase,transposase attL 57530:57564|attR 126232:126266
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage