Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_014552 Mycoplasma fermentans JER, complete sequence 2 crisprs NA 0 2 2 0

Results visualization

1. NC_014552
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014552_1 256695-256808 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014552_2 752307-752391 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_014552_1 1.1|256736|32|NC_014552|CRISPRCasFinder 256736-256767 32 NC_005005 Staphylococcus epidermidis ATCC 12228 plasmid pSE-12228-04, complete sequence 16476-16507 8 0.75
NC_014552_1 1.1|256736|32|NC_014552|CRISPRCasFinder 256736-256767 32 KY290956 Aeromonas phage L9-6, complete genome 111563-111594 10 0.688
NC_014552_1 1.1|256736|32|NC_014552|CRISPRCasFinder 256736-256767 32 KY290951 Aeromonas phage 31.2, complete genome 110964-110995 10 0.688
NC_014552_1 1.1|256736|32|NC_014552|CRISPRCasFinder 256736-256767 32 NC_005135 Aeromonas phage 44RR2.8t, complete genome 111205-111236 10 0.688
NC_014552_1 1.1|256736|32|NC_014552|CRISPRCasFinder 256736-256767 32 AY962392 Aeromonas phage 31, complete genome 110967-110998 10 0.688
NC_014552_1 1.1|256736|32|NC_014552|CRISPRCasFinder 256736-256767 32 KY290958 Aeromonas phage SW69-9, complete genome 111099-111130 10 0.688
NC_014552_1 1.1|256736|32|NC_014552|CRISPRCasFinder 256736-256767 32 AY375531 Bacteriophage 44RR2.8t, complete genome 111205-111236 10 0.688
NC_014552_1 1.1|256736|32|NC_014552|CRISPRCasFinder 256736-256767 32 KY290948 Aeromonas phage 44RR2.8t.2, complete genome 111205-111236 10 0.688
NC_014552_1 1.1|256736|32|NC_014552|CRISPRCasFinder 256736-256767 32 KY290957 Aeromonas phage Riv-10, complete genome 112300-112331 10 0.688
NC_014552_2 2.1|752330|39|NC_014552|CRISPRCasFinder 752330-752368 39 NC_003383 Listeria innocua Clip11262 plasmid pLI100, complete sequence 15865-15903 12 0.692

1. spacer 1.1|256736|32|NC_014552|CRISPRCasFinder matches to NC_005005 (Staphylococcus epidermidis ATCC 12228 plasmid pSE-12228-04, complete sequence) position: , mismatch: 8, identity: 0.75

tggttaaaaatagcaaaaagcgaaaattctac	CRISPR spacer
tctatataaatatcaaaaagcgaaaataataa	Protospacer
*   ** ***** **************  ** 

2. spacer 1.1|256736|32|NC_014552|CRISPRCasFinder matches to KY290956 (Aeromonas phage L9-6, complete genome) position: , mismatch: 10, identity: 0.688

tggttaaaaatagcaaaaagcgaaaattctac	CRISPR spacer
tttgtaaaaatcgcaaaaagcgaatatgaccg	Protospacer
*   ******* ************ **  .  

3. spacer 1.1|256736|32|NC_014552|CRISPRCasFinder matches to KY290951 (Aeromonas phage 31.2, complete genome) position: , mismatch: 10, identity: 0.688

tggttaaaaatagcaaaaagcgaaaattctac	CRISPR spacer
tttgtaaaaatcgcaaaaagcgaatatgaccg	Protospacer
*   ******* ************ **  .  

4. spacer 1.1|256736|32|NC_014552|CRISPRCasFinder matches to NC_005135 (Aeromonas phage 44RR2.8t, complete genome) position: , mismatch: 10, identity: 0.688

tggttaaaaatagcaaaaagcgaaaattctac	CRISPR spacer
tttgtaaaaatcgcaaaaagcgaatatgaccg	Protospacer
*   ******* ************ **  .  

5. spacer 1.1|256736|32|NC_014552|CRISPRCasFinder matches to AY962392 (Aeromonas phage 31, complete genome) position: , mismatch: 10, identity: 0.688

tggttaaaaatagcaaaaagcgaaaattctac	CRISPR spacer
tttgtaaaaatcgcaaaaagcgaatatgaccg	Protospacer
*   ******* ************ **  .  

6. spacer 1.1|256736|32|NC_014552|CRISPRCasFinder matches to KY290958 (Aeromonas phage SW69-9, complete genome) position: , mismatch: 10, identity: 0.688

tggttaaaaatagcaaaaagcgaaaattctac	CRISPR spacer
tttgtaaaaatcgcaaaaagcgaatatgaccg	Protospacer
*   ******* ************ **  .  

7. spacer 1.1|256736|32|NC_014552|CRISPRCasFinder matches to AY375531 (Bacteriophage 44RR2.8t, complete genome) position: , mismatch: 10, identity: 0.688

tggttaaaaatagcaaaaagcgaaaattctac	CRISPR spacer
tttgtaaaaatcgcaaaaagcgaatatgaccg	Protospacer
*   ******* ************ **  .  

8. spacer 1.1|256736|32|NC_014552|CRISPRCasFinder matches to KY290948 (Aeromonas phage 44RR2.8t.2, complete genome) position: , mismatch: 10, identity: 0.688

tggttaaaaatagcaaaaagcgaaaattctac	CRISPR spacer
tttgtaaaaatcgcaaaaagcgaatatgaccg	Protospacer
*   ******* ************ **  .  

9. spacer 1.1|256736|32|NC_014552|CRISPRCasFinder matches to KY290957 (Aeromonas phage Riv-10, complete genome) position: , mismatch: 10, identity: 0.688

tggttaaaaatagcaaaaagcgaaaattctac	CRISPR spacer
tttgtaaaaatcgcaaaaagcgaatatgaccg	Protospacer
*   ******* ************ **  .  

10. spacer 2.1|752330|39|NC_014552|CRISPRCasFinder matches to NC_003383 (Listeria innocua Clip11262 plasmid pLI100, complete sequence) position: , mismatch: 12, identity: 0.692

gattttacctatttttatatacttttcgttaaaaaaata	CRISPR spacer
ttctttaccaatttttatatacttttctttatgcttaac	Protospacer
  .****** ***************** *** .   *  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 104992 : 113237 6 Acanthamoeba_polyphaga_mimivirus(16.67%) tRNA NA
DBSCAN-SWA_2 838561 : 847008 10 Mycoplasma_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage