Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_022350 Mycobacterium tuberculosis str. Haarlem, complete sequence 16 crisprs csa3,c2c9_V-U4,cas3,DinG,WYL,cas4,DEDDh,cas2,cas1,csm6,csm5gr7,csm4gr5,csm3gr7,csm2gr11,cas10,cas6 17 51 1 1

Results visualization

1. NC_022350
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_022350_1 335149-335260 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_022350_2 340883-341821 Orphan NA
15 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_022350_3 369624-370322 Orphan NA
10 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_022350_4 696486-696562 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_022350_5 930093-931040 Orphan NA
19 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_022350_6 1217111-1217976 Orphan NA
16 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_022350_7 1572806-1573878 Orphan NA
15 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_022350_8 2087538-2087792 Orphan NA
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_022350_9 2168545-2168764 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_022350_11 3115486-3115957 TypeIII II-B,III-A
6 spacers
cas2,cas1,csm6,csm5gr7,csm4gr5,csm3gr7,csm2gr11,cas10,cas6

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_022350_10 3113245-3114090 TypeIII II-B,III-A
11 spacers
cas2,cas1,csm6,csm5gr7,csm4gr5,csm3gr7,csm2gr11,cas10

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_022350_12 3117280-3119074 TypeIII II-B,III-A
24 spacers
cas2,cas1,csm6,csm5gr7,csm4gr5,csm3gr7,csm2gr11,cas10,cas6

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_022350_13 3735662-3736341 Orphan NA
9 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_022350_14 3929217-3930161 Orphan NA
12 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_022350_15 3945783-3946941 Orphan NA
14 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_022350_16 4107232-4107320 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_022350_2 2.14|341741|27|NC_022350|CRT 341741-341767 27 NC_022350.1 338987-339013 0 1.0
NC_022350_2 2.15|341786|18|NC_022350|CRT 341786-341803 18 NC_022350.1 339032-339049 0 1.0
NC_022350_6 6.8|1217539|16|NC_022350|CRISPRCasFinder 1217539-1217554 16 NC_022350.1 2087853-2087868 0 1.0
NC_022350_15 15.4|3946066|44|NC_022350|CRT 3946066-3946109 44 NC_022350.1 3945457-3945500 0 1.0
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 NC_022350.1 3945538-3945569 0 1.0
NC_022350_15 15.6|3946216|53|NC_022350|CRT 3946216-3946268 53 NC_022350.1 3945607-3945659 0 1.0
NC_022350_1 1.2|335222|17|NC_022350|PILER-CR 335222-335238 17 NC_022350.1 845556-845572 1 0.941
NC_022350_1 1.2|335222|17|NC_022350|PILER-CR 335222-335238 17 NC_022350.1 1194554-1194570 1 0.941
NC_022350_1 1.2|335222|17|NC_022350|PILER-CR 335222-335238 17 NC_022350.1 1218622-1218638 1 0.941
NC_022350_1 1.2|335222|17|NC_022350|PILER-CR 335222-335238 17 NC_022350.1 2425214-2425230 1 0.941
NC_022350_1 1.2|335222|17|NC_022350|PILER-CR 335222-335238 17 NC_022350.1 2799795-2799811 1 0.941
NC_022350_1 1.2|335222|17|NC_022350|PILER-CR 335222-335238 17 NC_022350.1 4033789-4033805 1 0.941
NC_022350_2 2.15|341786|18|NC_022350|CRT 341786-341803 18 NC_022350.1 677619-677636 1 0.944
NC_022350_2 2.15|341786|18|NC_022350|CRT 341786-341803 18 NC_022350.1 1222169-1222186 1 0.944
NC_022350_2 2.15|341786|18|NC_022350|CRT 341786-341803 18 NC_022350.1 2425420-2425437 1 0.944
NC_022350_2 2.15|341786|18|NC_022350|CRT 341786-341803 18 NC_022350.1 3733430-3733447 1 0.944
NC_022350_2 2.15|341786|18|NC_022350|CRT 341786-341803 18 NC_022350.1 3734795-3734812 1 0.944
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 NC_022350.1 628330-628351 1 0.955
NC_022350_8 8.2|2087619|18|NC_022350|CRT 2087619-2087636 18 NC_022350.1 404222-404239 1 0.944
NC_022350_8 8.2|2087619|18|NC_022350|CRT 2087619-2087636 18 NC_022350.1 611792-611809 1 0.944
NC_022350_8 8.4|2087709|18|NC_022350|CRT 2087709-2087726 18 NC_022350.1 3443911-3443928 1 0.944
NC_022350_3 3.5|369912|42|NC_022350|CRISPRCasFinder 369912-369953 42 NC_022350.1 377943-377984 2 0.952
NC_022350_3 3.6|369987|33|NC_022350|CRISPRCasFinder 369987-370019 33 NC_022350.1 376758-376790 2 0.939
NC_022350_5 5.17|930876|36|NC_022350|CRT 930876-930911 36 NC_022350.1 679548-679583 2 0.944
NC_022350_5 5.17|930876|36|NC_022350|CRT 930876-930911 36 NC_022350.1 1218919-1218954 2 0.944
NC_022350_5 5.17|930876|36|NC_022350|CRT 930876-930911 36 NC_022350.1 2425492-2425527 2 0.944
NC_022350_6 6.7|1217494|22|NC_022350|CRISPRCasFinder 1217494-1217515 22 NC_022350.1 2955797-2955818 2 0.909
NC_022350_6 6.11|1217677|22|NC_022350|CRISPRCasFinder 1217677-1217698 22 NC_022350.1 842536-842557 2 0.909
NC_022350_6 6.11|1217677|22|NC_022350|CRISPRCasFinder 1217677-1217698 22 NC_022350.1 1222814-1222835 2 0.909
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 NC_022350.1 37122-37143 2 0.909
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 NC_022350.1 132233-132254 2 0.909
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 NC_022350.1 2917569-2917590 2 0.909
NC_022350_15 15.7|3946306|59|NC_022350|CRT 3946306-3946364 59 NC_022350.1 3945697-3945755 2 0.966
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NC_022350.1 3938306-3938331 2 0.923
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NC_022350.1 3938651-3938676 2 0.923
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NC_022350.1 3938996-3939021 2 0.923
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NC_022350.1 3939341-3939366 2 0.923
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NC_022350.1 3939686-3939711 2 0.923
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NC_022350.1 3945529-3945554 2 0.923

1. spacer 2.14|341741|27|NC_022350|CRT matches to position: 338987-339013, mismatch: 0, identity: 1.0

ttgccgatgagcccgccggcgccgccg	CRISPR spacer
ttgccgatgagcccgccggcgccgccg	Protospacer
***************************

2. spacer 2.15|341786|18|NC_022350|CRT matches to position: 339032-339049, mismatch: 0, identity: 1.0

ttgacgccggccgcgccg	CRISPR spacer
ttgacgccggccgcgccg	Protospacer
******************

3. spacer 6.8|1217539|16|NC_022350|CRISPRCasFinder matches to position: 2087853-2087868, mismatch: 0, identity: 1.0

gtggctgtacggcgac	CRISPR spacer
gtggctgtacggcgac	Protospacer
****************

4. spacer 15.4|3946066|44|NC_022350|CRT matches to position: 3945457-3945500, mismatch: 0, identity: 1.0

accggcggcaaaggcggcctaaacaccgacggactcagcagcgc	CRISPR spacer
accggcggcaaaggcggcctaaacaccgacggactcagcagcgc	Protospacer
********************************************

5. spacer 15.5|3946147|32|NC_022350|CRT matches to position: 3945538-3945569, mismatch: 0, identity: 1.0

aaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
aaaggcggcaccggcggggccggcgacgactc	Protospacer
********************************

6. spacer 15.6|3946216|53|NC_022350|CRT matches to position: 3945607-3945659, mismatch: 0, identity: 1.0

aacgccggcgccggcggcctagccaacaccggcggcaccgcaggcaacgcggg	CRISPR spacer
aacgccggcgccggcggcctagccaacaccggcggcaccgcaggcaacgcggg	Protospacer
*****************************************************

7. spacer 1.2|335222|17|NC_022350|PILER-CR matches to position: 845556-845572, mismatch: 1, identity: 0.941

cgctggcgccgccgtca	CRISPR spacer
cgccggcgccgccgtca	Protospacer
***.*************

8. spacer 1.2|335222|17|NC_022350|PILER-CR matches to position: 1194554-1194570, mismatch: 1, identity: 0.941

cgctggcgccgccgtca	CRISPR spacer
cgccggcgccgccgtca	Protospacer
***.*************

9. spacer 1.2|335222|17|NC_022350|PILER-CR matches to position: 1218622-1218638, mismatch: 1, identity: 0.941

cgctggcgccgccgtca	CRISPR spacer
cgctggcgccgccgcca	Protospacer
**************.**

10. spacer 1.2|335222|17|NC_022350|PILER-CR matches to position: 2425214-2425230, mismatch: 1, identity: 0.941

cgctggcgccgccgtca	CRISPR spacer
cgccggcgccgccgtca	Protospacer
***.*************

11. spacer 1.2|335222|17|NC_022350|PILER-CR matches to position: 2799795-2799811, mismatch: 1, identity: 0.941

cgctggcgccgccgtca	CRISPR spacer
cgccggcgccgccgtca	Protospacer
***.*************

12. spacer 1.2|335222|17|NC_022350|PILER-CR matches to position: 4033789-4033805, mismatch: 1, identity: 0.941

cgctggcgccgccgtca	CRISPR spacer
cgccggcgccgccgtca	Protospacer
***.*************

13. spacer 2.15|341786|18|NC_022350|CRT matches to position: 677619-677636, mismatch: 1, identity: 0.944

ttgacgccggccgcgccg	CRISPR spacer
ttgccgccggccgcgccg	Protospacer
*** **************

14. spacer 2.15|341786|18|NC_022350|CRT matches to position: 1222169-1222186, mismatch: 1, identity: 0.944

ttgacgccggccgcgccg	CRISPR spacer
ttgccgccggccgcgccg	Protospacer
*** **************

15. spacer 2.15|341786|18|NC_022350|CRT matches to position: 2425420-2425437, mismatch: 1, identity: 0.944

ttgacgccggccgcgccg	CRISPR spacer
ttgccgccggccgcgccg	Protospacer
*** **************

16. spacer 2.15|341786|18|NC_022350|CRT matches to position: 3733430-3733447, mismatch: 1, identity: 0.944

ttgacgccggccgcgccg	CRISPR spacer
ttgccgccggccgcgccg	Protospacer
*** **************

17. spacer 2.15|341786|18|NC_022350|CRT matches to position: 3734795-3734812, mismatch: 1, identity: 0.944

ttgacgccggccgcgccg	CRISPR spacer
ttgccgccggccgcgccg	Protospacer
*** **************

18. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to position: 628330-628351, mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgccggcggcgtcggcggtgtc	Protospacer
**.*******************

19. spacer 8.2|2087619|18|NC_022350|CRT matches to position: 404222-404239, mismatch: 1, identity: 0.944

gatcagcccgacggcgtt	CRISPR spacer
gatcagcccgtcggcgtt	Protospacer
********** *******

20. spacer 8.2|2087619|18|NC_022350|CRT matches to position: 611792-611809, mismatch: 1, identity: 0.944

gatcagcccgacggcgtt	CRISPR spacer
gatcagcccgtcggcgtt	Protospacer
********** *******

21. spacer 8.4|2087709|18|NC_022350|CRT matches to position: 3443911-3443928, mismatch: 1, identity: 0.944

gatcagcgtcccgccggt	CRISPR spacer
gatcagcgtcccgctggt	Protospacer
**************.***

22. spacer 3.5|369912|42|NC_022350|CRISPRCasFinder matches to position: 377943-377984, mismatch: 2, identity: 0.952

ccggtgcccgagttgaagaacccgatgtttccgctgccggag	CRISPR spacer
ccggtgcccgagttgaacaacccgacgtttccgctgccggag	Protospacer
***************** *******.****************

23. spacer 3.6|369987|33|NC_022350|CRISPRCasFinder matches to position: 376758-376790, mismatch: 2, identity: 0.939

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
aggctgccgaacccgatctggccgctgccggtg	Protospacer
********** *************.********

24. spacer 5.17|930876|36|NC_022350|CRT matches to position: 679548-679583, mismatch: 2, identity: 0.944

gctgatcggcaacggcggtaacggcggggccggcgg	CRISPR spacer
gctgatgggcaacggcggcaacggcggggccggcgg	Protospacer
****** ***********.*****************

25. spacer 5.17|930876|36|NC_022350|CRT matches to position: 1218919-1218954, mismatch: 2, identity: 0.944

gctgatcggcaacggcggtaacggcggggccggcgg	CRISPR spacer
gctgatcggcaacggcggccacggcggggccggcgg	Protospacer
******************. ****************

26. spacer 5.17|930876|36|NC_022350|CRT matches to position: 2425492-2425527, mismatch: 2, identity: 0.944

gctgatcggcaacggcggtaacggcggggccggcgg	CRISPR spacer
gctgatcggcaacggcggcaacggcggtgccggcgg	Protospacer
******************.******** ********

27. spacer 6.7|1217494|22|NC_022350|CRISPRCasFinder matches to position: 2955797-2955818, mismatch: 2, identity: 0.909

tgtcggcggtgccggcggtgtc	CRISPR spacer
tggcgggggtgccggcggtgtc	Protospacer
** *** ***************

28. spacer 6.11|1217677|22|NC_022350|CRISPRCasFinder matches to position: 842536-842557, mismatch: 2, identity: 0.909

gctgtggggcggcggtggtgcc	CRISPR spacer
gctgtggggcgccggtggggcc	Protospacer
*********** ****** ***

29. spacer 6.11|1217677|22|NC_022350|CRISPRCasFinder matches to position: 1222814-1222835, mismatch: 2, identity: 0.909

gctgtggggcggcggtggtgcc	CRISPR spacer
gctgtggggcgtcggtggcgcc	Protospacer
*********** ******.***

30. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to position: 37122-37143, mismatch: 2, identity: 0.909

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcggccgcggtgtc	Protospacer
*********** * ********

31. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to position: 132233-132254, mismatch: 2, identity: 0.909

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcatgggcggtgtc	Protospacer
**********.* *********

32. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to position: 2917569-2917590, mismatch: 2, identity: 0.909

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcgccggcggcgtc	Protospacer
***********.******.***

33. spacer 15.7|3946306|59|NC_022350|CRT matches to position: 3945697-3945755, mismatch: 2, identity: 0.966

caaggagacagcggttccggattgggcggccagcccggctttgccggcggccccggcgg	CRISPR spacer
caaggagacagcggttccggattgggcggccagcccggctttgccggcggggccggcgg	Protospacer
**************************************************  *******

34. spacer 15.11|3946672|26|NC_022350|CRT matches to position: 3938306-3938331, mismatch: 2, identity: 0.923

accggcggcaaaggcggcatgggcgg	CRISPR spacer
accggcggcaaaggcggcaccggcgg	Protospacer
*******************. *****

35. spacer 15.11|3946672|26|NC_022350|CRT matches to position: 3938651-3938676, mismatch: 2, identity: 0.923

accggcggcaaaggcggcatgggcgg	CRISPR spacer
accggcggcaaaggcggcaccggcgg	Protospacer
*******************. *****

36. spacer 15.11|3946672|26|NC_022350|CRT matches to position: 3938996-3939021, mismatch: 2, identity: 0.923

accggcggcaaaggcggcatgggcgg	CRISPR spacer
accggcggcaaaggcggcaccggcgg	Protospacer
*******************. *****

37. spacer 15.11|3946672|26|NC_022350|CRT matches to position: 3939341-3939366, mismatch: 2, identity: 0.923

accggcggcaaaggcggcatgggcgg	CRISPR spacer
accggcggcaaaggcggcaccggcgg	Protospacer
*******************. *****

38. spacer 15.11|3946672|26|NC_022350|CRT matches to position: 3939686-3939711, mismatch: 2, identity: 0.923

accggcggcaaaggcggcatgggcgg	CRISPR spacer
accggcggcaaaggcggcaccggcgg	Protospacer
*******************. *****

39. spacer 15.11|3946672|26|NC_022350|CRT matches to position: 3945529-3945554, mismatch: 2, identity: 0.923

accggcggcaaaggcggcatgggcgg	CRISPR spacer
accggcggcaaaggcggcaccggcgg	Protospacer
*******************. *****

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 MN369739 Mycobacterium phage Kenuha5, complete genome 19928-19949 0 1.0
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 MK359343 Mycobacterium phage Pollywog, complete genome 21007-21028 0 1.0
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 MG925354 Mycobacterium phage Ogopogo, complete genome 20062-20083 0 1.0
NC_022350_6 6.7|1217494|22|NC_022350|CRISPRCasFinder 1217494-1217515 22 NZ_CP013855 Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence 136890-136911 1 0.955
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 416474-416495 1 0.955
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 390612-390633 1 0.955
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 278335-278356 1 0.955
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 393915-393936 1 0.955
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 454191-454212 1 0.955
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 278384-278405 1 0.955
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 46005-46026 1 0.955
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 303540-303561 1 0.955
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 278344-278365 1 0.955
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 396001-396022 1 0.955
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 1389176-1389197 1 0.955
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 395176-395197 1 0.955
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 NZ_CP022773 Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence 406649-406670 1 0.955
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 391952-391973 1 0.955
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 288051-288072 1 0.955
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 391041-391062 1 0.955
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 407896-407917 1 0.955
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 392179-392200 1 0.955
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 395194-395215 1 0.955
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 407896-407917 1 0.955
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 407895-407916 1 0.955
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 454218-454239 1 0.955
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 301210-301231 1 0.955
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 407896-407917 1 0.955
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 407896-407917 1 0.955
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 407896-407917 1 0.955
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 406631-406652 1 0.955
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 406589-406610 1 0.955
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 398795-398816 1 0.955
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 398407-398428 1 0.955
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 407896-407917 1 0.955
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 407891-407912 1 0.955
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 407896-407917 1 0.955
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 407896-407917 1 0.955
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 407896-407917 1 0.955
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 MT522000 Mycobacterium phage Soul22, complete genome 19553-19574 1 0.955
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 NC_042030 Mycobacterium phage Yoshi, complete sequence 19554-19575 1 0.955
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 NC_048729 Mycobacterium phage Renaud18, complete genome 20226-20247 1 0.955
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 NC_026585 Mycobacteriophage Estave1, complete genome 19919-19940 1 0.955
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 DQ398049 Mycobacterium phage Pipefish, complete genome 12255-12276 1 0.955
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 MH077585 Mycobacterium phage TChen, complete genome 20330-20351 1 0.955
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 NC_048788 Mycobacterium phage ThetaBob, complete genome 20144-20165 1 0.955
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 234037-234058 1 0.955
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 1717083-1717104 1 0.955
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 NC_014753 Oceanithermus profundus DSM 14977 plasmid pOCEPR01, complete sequence 39925-39946 1 0.955
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 NC_021056 Streptomyces sp. PAMC 26508 plasmid pSP01, complete sequence 29437-29458 1 0.955
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 NZ_LR134465 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence 402457-402478 1 0.955
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 1717218-1717239 1 0.955
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 1597522-1597543 1 0.955
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 1716747-1716768 1 0.955
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 687815-687836 1 0.955
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 1716693-1716714 1 0.955
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 1709586-1709607 1 0.955
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 CP047137 Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence 1648874-1648895 1 0.955
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 1702711-1702732 1 0.955
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 1684773-1684794 1 0.955
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 1684773-1684794 1 0.955
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 MN369761 Mycobacterium phage Malthus, complete genome 23155-23176 1 0.955
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 KJ944841 Mycobacterium phage Cheetobro, complete genome 23239-23260 1 0.955
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 AP018469 Mycobacterium phage Y10 DNA, complete genome, note: sample1 23231-23252 1 0.955
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 KY087992 Mycobacterium phage Mitti, complete genome 23155-23176 1 0.955
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 MF140402 Mycobacterium phage Chancellor, complete genome 23242-23263 1 0.955
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 AP018470 Mycobacterium phage Y2 DNA, complete genome 23231-23252 1 0.955
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 KT361920 Mycobacterium phage Slarp, complete genome 23242-23263 1 0.955
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 MH926058 Mycobacterium phage Reptar3000, complete genome 22972-22993 1 0.955
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 MT310882 Mycobacterium phage JF1, complete genome 23231-23252 1 0.955
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 AP018471 Mycobacterium phage Y10 DNA, complete genome, note: sample2 23231-23252 1 0.955
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 MF140435 Mycobacterium phage Wintermute, complete genome 23231-23252 1 0.955
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 NC_027365 Mycobacterium virus Fionnbarth, complete genome 23232-23253 1 0.955
NC_022350_7 7.4|1573006|22|NC_022350|CRISPRCasFinder 1573006-1573027 22 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 1975819-1975840 1 0.955
NC_022350_7 7.4|1573006|22|NC_022350|CRISPRCasFinder 1573006-1573027 22 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 1109892-1109913 1 0.955
NC_022350_7 7.4|1573006|22|NC_022350|CRISPRCasFinder 1573006-1573027 22 NZ_CP016457 Sphingobium sp. RAC03 plasmid pBSY17_2, complete sequence 87869-87890 1 0.955
NC_022350_7 7.15|1573825|22|NC_022350|CRISPRCasFinder 1573825-1573846 22 NZ_CP054617 Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence 362668-362689 1 0.955
NC_022350_7 7.15|1573825|22|NC_022350|CRISPRCasFinder 1573825-1573846 22 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 2289382-2289403 1 0.955
NC_022350_7 7.15|1573825|22|NC_022350|CRISPRCasFinder 1573825-1573846 22 NZ_CP020899 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence 81656-81677 1 0.955
NC_022350_7 7.15|1573825|22|NC_022350|CRISPRCasFinder 1573825-1573846 22 NC_013858 Azospirillum sp. B510 plasmid pAB510d, complete sequence 56160-56181 1 0.955
NC_022350_6 6.7|1217494|22|NC_022350|CRISPRCasFinder 1217494-1217515 22 NZ_CP049249 Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence 794580-794601 2 0.909
NC_022350_6 6.7|1217494|22|NC_022350|CRISPRCasFinder 1217494-1217515 22 NC_015314 Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence 75477-75498 2 0.909
NC_022350_6 6.7|1217494|22|NC_022350|CRISPRCasFinder 1217494-1217515 22 NZ_CP030772 Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence 713470-713491 2 0.909
NC_022350_6 6.7|1217494|22|NC_022350|CRISPRCasFinder 1217494-1217515 22 NC_021056 Streptomyces sp. PAMC 26508 plasmid pSP01, complete sequence 29437-29458 2 0.909
NC_022350_6 6.7|1217494|22|NC_022350|CRISPRCasFinder 1217494-1217515 22 NZ_CP045122 Rubrobacter sp. SCSIO 52915 plasmid unnamed1, complete sequence 56975-56996 2 0.909
NC_022350_6 6.7|1217494|22|NC_022350|CRISPRCasFinder 1217494-1217515 22 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 458462-458483 2 0.909
NC_022350_6 6.7|1217494|22|NC_022350|CRISPRCasFinder 1217494-1217515 22 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 1354617-1354638 2 0.909
NC_022350_6 6.7|1217494|22|NC_022350|CRISPRCasFinder 1217494-1217515 22 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 881389-881410 2 0.909
NC_022350_6 6.7|1217494|22|NC_022350|CRISPRCasFinder 1217494-1217515 22 NC_047977 Microbacterium phage Hendrix, complete genome 3065-3086 2 0.909
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 NZ_CP010410 Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence 228896-228917 2 0.909
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 NC_008271 Rhodococcus jostii RHA1 plasmid pRHL3, complete sequence 300498-300519 2 0.909
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 NZ_CP029830 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence 26788-26809 2 0.909
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 NZ_CP029357 Azospirillum sp. CFH 70021 plasmid unnamed2 317913-317934 2 0.909
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 NZ_CP032054 Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence 126254-126275 2 0.909
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 NZ_CP032054 Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence 924997-925018 2 0.909
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 NC_041989 Mycobacterium phage Shauna1, complete genome 19840-19861 2 0.909
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 MT889380 Mycobacterium phage Coco12, complete genome 20185-20206 2 0.909
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 KY702574 Mycobacterium phage Kingsley, complete genome 19643-19664 2 0.909
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 MT114167 Mycobacterium phage Phanphagia, complete genome 19840-19861 2 0.909
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 1322901-1322922 2 0.909
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 NZ_CP015530 Rhodococcus sp. WB1 plasmid pWB1, complete sequence 35802-35823 2 0.909
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 NZ_AP022319 Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence 1512534-1512555 2 0.909
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 NZ_CP016560 Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence 581887-581908 2 0.909
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 NZ_CP034156 Rhodococcus sp. NJ-530 plasmid unnamed4, complete sequence 323191-323212 2 0.909
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 MF541410 Streptomyces phage Ozzie, complete genome 44361-44382 2 0.909
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 MF541403 Streptomyces phage BeardedLady, complete genome 44355-44376 2 0.909
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 NC_028892 Streptomyces phage Caliburn, complete genome 44361-44382 2 0.909
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 MF541409 Streptomyces phage Oliynyk, complete genome 44470-44491 2 0.909
NC_022350_6 6.16|1217932|22|NC_022350|CRISPRCasFinder 1217932-1217953 22 KT124229 Streptomyces phage Hydra, complete genome 45163-45184 2 0.909
NC_022350_7 7.2|1572898|22|NC_022350|CRISPRCasFinder 1572898-1572919 22 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 881140-881161 2 0.909
NC_022350_7 7.2|1572898|22|NC_022350|CRISPRCasFinder 1572898-1572919 22 NZ_CP007795 Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence 225972-225993 2 0.909
NC_022350_7 7.2|1572898|22|NC_022350|CRISPRCasFinder 1572898-1572919 22 NZ_CP032341 Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence 451168-451189 2 0.909
NC_022350_7 7.2|1572898|22|NC_022350|CRISPRCasFinder 1572898-1572919 22 NZ_CP032347 Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence 234992-235013 2 0.909
NC_022350_7 7.2|1572898|22|NC_022350|CRISPRCasFinder 1572898-1572919 22 NZ_CP012916 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence 597449-597470 2 0.909
NC_022350_7 7.3|1572952|22|NC_022350|CRISPRCasFinder 1572952-1572973 22 NZ_CP025510 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvD, complete sequence 117076-117097 2 0.909
NC_022350_7 7.4|1573006|22|NC_022350|CRISPRCasFinder 1573006-1573027 22 NZ_CP021032 Rhizobium sp. NXC14 plasmid pRspNXC14b, complete sequence 448838-448859 2 0.909
NC_022350_7 7.4|1573006|22|NC_022350|CRISPRCasFinder 1573006-1573027 22 NC_007765 Rhizobium etli CFN 42 plasmid p42e, complete sequence 160471-160492 2 0.909
NC_022350_7 7.4|1573006|22|NC_022350|CRISPRCasFinder 1573006-1573027 22 NZ_CP021028 Rhizobium sp. TAL182 plasmid pRetTAL182d, complete sequence 175264-175285 2 0.909
NC_022350_7 7.4|1573006|22|NC_022350|CRISPRCasFinder 1573006-1573027 22 NZ_CP013634 Rhizobium sp. N324 plasmid pRspN324d, complete sequence 457593-457614 2 0.909
NC_022350_7 7.4|1573006|22|NC_022350|CRISPRCasFinder 1573006-1573027 22 NZ_CP013503 Rhizobium esperanzae strain N561 plasmid pRspN561c, complete sequence 166709-166730 2 0.909
NC_022350_7 7.4|1573006|22|NC_022350|CRISPRCasFinder 1573006-1573027 22 NZ_CP013509 Rhizobium sp. N1341 plasmid pRspN1341d, complete sequence 166709-166730 2 0.909
NC_022350_7 7.4|1573006|22|NC_022350|CRISPRCasFinder 1573006-1573027 22 NZ_CP013520 Rhizobium sp. N113 plasmid pRspN113c, complete sequence 166709-166730 2 0.909
NC_022350_7 7.4|1573006|22|NC_022350|CRISPRCasFinder 1573006-1573027 22 NZ_CP013493 Rhizobium sp. N6212 plasmid pRspN6212c, complete sequence 166709-166730 2 0.909
NC_022350_7 7.4|1573006|22|NC_022350|CRISPRCasFinder 1573006-1573027 22 NZ_CP013516 Rhizobium sp. N1314 plasmid pRspN1314e, complete sequence 164465-164486 2 0.909
NC_022350_7 7.4|1573006|22|NC_022350|CRISPRCasFinder 1573006-1573027 22 NZ_CP054616 Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence 97458-97479 2 0.909
NC_022350_7 7.4|1573006|22|NC_022350|CRISPRCasFinder 1573006-1573027 22 NZ_CP012698 Microbacterium sp. No. 7 plasmid A, complete sequence 53118-53139 2 0.909
NC_022350_7 7.4|1573006|22|NC_022350|CRISPRCasFinder 1573006-1573027 22 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 100830-100851 2 0.909
NC_022350_7 7.4|1573006|22|NC_022350|CRISPRCasFinder 1573006-1573027 22 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 307854-307875 2 0.909
NC_022350_7 7.4|1573006|22|NC_022350|CRISPRCasFinder 1573006-1573027 22 NZ_CP032325 Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence 23841-23862 2 0.909
NC_022350_7 7.4|1573006|22|NC_022350|CRISPRCasFinder 1573006-1573027 22 NZ_CP022369 Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence 279961-279982 2 0.909
NC_022350_7 7.4|1573006|22|NC_022350|CRISPRCasFinder 1573006-1573027 22 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 359201-359222 2 0.909
NC_022350_7 7.4|1573006|22|NC_022350|CRISPRCasFinder 1573006-1573027 22 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 606826-606847 2 0.909
NC_022350_7 7.4|1573006|22|NC_022350|CRISPRCasFinder 1573006-1573027 22 NC_013857 Azospirillum sp. B510 plasmid pAB510c, complete sequence 411558-411579 2 0.909
NC_022350_7 7.4|1573006|22|NC_022350|CRISPRCasFinder 1573006-1573027 22 NZ_CP054029 Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence 300111-300132 2 0.909
NC_022350_7 7.4|1573006|22|NC_022350|CRISPRCasFinder 1573006-1573027 22 NZ_CP032342 Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence 483830-483851 2 0.909
NC_022350_7 7.4|1573006|22|NC_022350|CRISPRCasFinder 1573006-1573027 22 NZ_CP024312 Rhizobium sp. NXC24 plasmid pRspNXC24a, complete sequence 68146-68167 2 0.909
NC_022350_7 7.4|1573006|22|NC_022350|CRISPRCasFinder 1573006-1573027 22 CP042595 Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence 175112-175133 2 0.909
NC_022350_7 7.4|1573006|22|NC_022350|CRISPRCasFinder 1573006-1573027 22 NZ_CP032349 Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence 314082-314103 2 0.909
NC_022350_7 7.5|1573060|25|NC_022350|CRISPRCasFinder 1573060-1573084 25 NZ_CP032342 Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence 402883-402907 2 0.92
NC_022350_7 7.5|1573060|25|NC_022350|CRISPRCasFinder 1573060-1573084 25 NZ_CP033321 Azospirillum brasilense strain Cd plasmid p3, complete sequence 416172-416196 2 0.92
NC_022350_7 7.5|1573060|25|NC_022350|CRISPRCasFinder 1573060-1573084 25 NZ_CP033315 Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence 472935-472959 2 0.92
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NC_023695 Mycobacterium phage Violet, complete genome 29125-29150 2 0.923
NC_022350_2 2.8|341396|27|NC_022350|CRT 341396-341422 27 NZ_CP042265 Litoreibacter sp. LN3S51 plasmid unnamed4, complete sequence 429317-429343 3 0.889
NC_022350_2 2.14|341741|27|NC_022350|CRT 341741-341767 27 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 2114285-2114311 3 0.889
NC_022350_2 2.14|341741|27|NC_022350|CRT 341741-341767 27 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 2182239-2182265 3 0.889
NC_022350_2 2.14|341741|27|NC_022350|CRT 341741-341767 27 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 1859368-1859394 3 0.889
NC_022350_5 5.16|930834|24|NC_022350|CRT 930834-930857 24 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4024254-4024277 3 0.875
NC_022350_5 5.16|930834|24|NC_022350|CRT 930834-930857 24 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4460576-4460599 3 0.875
NC_022350_5 5.16|930834|24|NC_022350|CRT 930834-930857 24 NZ_CP034768 Enterobacter sp. N18-03635 plasmid pFRI-6, complete sequence 122201-122224 3 0.875
NC_022350_5 5.16|930834|24|NC_022350|CRT 930834-930857 24 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 37773-37796 3 0.875
NC_022350_5 5.16|930834|24|NC_022350|CRT 930834-930857 24 NZ_AP019631 Enterobacter asburiae strain 17Nkhm-UP2 plasmid pEAS17Nkhm-UP2-1, complete sequence 116652-116675 3 0.875
NC_022350_5 5.16|930834|24|NC_022350|CRT 930834-930857 24 NZ_AP019631 Enterobacter asburiae strain 17Nkhm-UP2 plasmid pEAS17Nkhm-UP2-1, complete sequence 72348-72371 3 0.875
NC_022350_5 5.16|930834|24|NC_022350|CRT 930834-930857 24 KU716094 Mycobacterium phage Eidsmoe, complete genome 5649-5672 3 0.875
NC_022350_5 5.16|930834|24|NC_022350|CRT 930834-930857 24 MH371122 Mycobacterium phage Priya, complete genome 5650-5673 3 0.875
NC_022350_5 5.16|930834|24|NC_022350|CRT 930834-930857 24 MK016502 Mycobacterium phage Pat3, complete genome 22827-22850 3 0.875
NC_022350_5 5.16|930834|24|NC_022350|CRT 930834-930857 24 MK937593 Mycobacterium phage Flypotenuse, complete genome 23717-23740 3 0.875
NC_022350_5 5.16|930834|24|NC_022350|CRT 930834-930857 24 MG872835 Mycobacterium phage Conquerage, complete genome 5649-5672 3 0.875
NC_022350_5 5.16|930834|24|NC_022350|CRT 930834-930857 24 MH536820 Mycobacterium phage Glexan, complete genome 23717-23740 3 0.875
NC_022350_5 5.16|930834|24|NC_022350|CRT 930834-930857 24 NC_010510 Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence 91001-91024 3 0.875
NC_022350_5 5.16|930834|24|NC_022350|CRT 930834-930857 24 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 44795-44818 3 0.875
NC_022350_5 5.16|930834|24|NC_022350|CRT 930834-930857 24 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1701753-1701776 3 0.875
NC_022350_5 5.16|930834|24|NC_022350|CRT 930834-930857 24 MH271298 Microbacterium phage Floof, complete genome 37939-37962 3 0.875
NC_022350_6 6.4|1217314|25|NC_022350|CRISPRCasFinder 1217314-1217338 25 MN703413 Arthrobacter phage Powerpuff, complete genome 38834-38858 3 0.88
NC_022350_6 6.4|1217314|25|NC_022350|CRISPRCasFinder 1217314-1217338 25 MT024871 Arthrobacter phage YesChef, complete genome 37693-37717 3 0.88
NC_022350_6 6.7|1217494|22|NC_022350|CRISPRCasFinder 1217494-1217515 22 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 355111-355132 3 0.864
NC_022350_6 6.7|1217494|22|NC_022350|CRISPRCasFinder 1217494-1217515 22 NZ_CP040721 Rhodococcus pyridinivorans strain YF3 plasmid unnamed2, complete sequence 58695-58716 3 0.864
NC_022350_6 6.7|1217494|22|NC_022350|CRISPRCasFinder 1217494-1217515 22 NZ_CP040721 Rhodococcus pyridinivorans strain YF3 plasmid unnamed2, complete sequence 90623-90644 3 0.864
NC_022350_6 6.7|1217494|22|NC_022350|CRISPRCasFinder 1217494-1217515 22 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 1457966-1457987 3 0.864
NC_022350_6 6.7|1217494|22|NC_022350|CRISPRCasFinder 1217494-1217515 22 NZ_CP021082 Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence 422944-422965 3 0.864
NC_022350_6 6.7|1217494|22|NC_022350|CRISPRCasFinder 1217494-1217515 22 KT381864 Thiobacimonas phage vB_ThpS-P1, complete genome 3900-3921 3 0.864
NC_022350_6 6.11|1217677|22|NC_022350|CRISPRCasFinder 1217677-1217698 22 NZ_CP048287 Paenibacillus sp. 14171R-81 plasmid unnamed1, complete sequence 4076-4097 3 0.864
NC_022350_7 7.4|1573006|22|NC_022350|CRISPRCasFinder 1573006-1573027 22 NZ_KY349138 Mycolicibacterium sp. CBMA 213 plasmid pCBMA213_2, complete sequence 9264-9285 3 0.864
NC_022350_7 7.4|1573006|22|NC_022350|CRISPRCasFinder 1573006-1573027 22 NZ_CP021649 Acidovorax sp. T1 plasmid p1-T1, complete sequence 13233-13254 3 0.864
NC_022350_7 7.5|1573060|25|NC_022350|CRISPRCasFinder 1573060-1573084 25 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 937294-937318 3 0.88
NC_022350_7 7.5|1573060|25|NC_022350|CRISPRCasFinder 1573060-1573084 25 NZ_CP022999 Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence 1470762-1470786 3 0.88
NC_022350_7 7.5|1573060|25|NC_022350|CRISPRCasFinder 1573060-1573084 25 MN586053 Arthrobacter phage BeatusComedenti, complete genome 26689-26713 3 0.88
NC_022350_7 7.5|1573060|25|NC_022350|CRISPRCasFinder 1573060-1573084 25 NC_031254 Arthrobacter phage Kitkat, complete genome 26809-26833 3 0.88
NC_022350_7 7.5|1573060|25|NC_022350|CRISPRCasFinder 1573060-1573084 25 NC_031231 Arthrobacter phage KellEzio, complete genome 26691-26715 3 0.88
NC_022350_7 7.5|1573060|25|NC_022350|CRISPRCasFinder 1573060-1573084 25 NC_021289 Burkholderia insecticola plasmid p1, complete sequence 633177-633201 3 0.88
NC_022350_7 7.5|1573060|25|NC_022350|CRISPRCasFinder 1573060-1573084 25 NZ_CP030129 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed3, complete sequence 74124-74148 3 0.88
NC_022350_7 7.15|1573825|22|NC_022350|CRISPRCasFinder 1573825-1573846 22 NC_008270 Rhodococcus jostii RHA1 plasmid pRHL2, complete sequence 380879-380900 3 0.864
NC_022350_8 8.5|2087748|24|NC_022350|CRT 2087748-2087771 24 NZ_CP049158 Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence 1555522-1555545 3 0.875
NC_022350_8 8.5|2087748|24|NC_022350|CRT 2087748-2087771 24 NZ_CP049318 Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence 1560190-1560213 3 0.875
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP054029 Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence 338431-338456 3 0.885
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP022541 Antarctobacter heliothermus strain SMS3 plasmid pSMS3-1, complete sequence 184795-184820 3 0.885
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP014276 Martelella sp. AD-3 plasmid unnamed1, complete sequence 27959-27984 3 0.885
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 MN585973 Mycobacterium phage StAnnes, complete genome 24900-24925 3 0.885
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 MG944221 Mycobacterium phage Scowl, complete genome 29099-29124 3 0.885
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 KT309034 Mycobacterium phage Dante, complete genome 24873-24898 3 0.885
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NC_021538 Mycobacterium phage Job42, complete genome 26541-26566 3 0.885
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NC_026584 Mycobacterium phage Minerva, complete genome 38752-38777 3 0.885
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 KJ409696 Mycobacterium phage Lamina13, complete genome 28214-28239 3 0.885
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NC_028784 Mycobacterium phage Tasp14, complete genome 28838-28863 3 0.885
NC_022350_2 2.8|341396|27|NC_022350|CRT 341396-341422 27 MN617843 Mycobacterium phage Quesadilla, complete genome 44858-44884 4 0.852
NC_022350_2 2.14|341741|27|NC_022350|CRT 341741-341767 27 NC_014818 Asticcacaulis excentricus CB 48 plasmid pASTEX01, complete sequence 11591-11617 4 0.852
NC_022350_2 2.14|341741|27|NC_022350|CRT 341741-341767 27 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 1790451-1790477 4 0.852
NC_022350_2 2.14|341741|27|NC_022350|CRT 341741-341767 27 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 1791180-1791206 4 0.852
NC_022350_2 2.14|341741|27|NC_022350|CRT 341741-341767 27 NZ_AP022607 Mycobacterium branderi strain JCM 12687 plasmid pJCM12687 772490-772516 4 0.852
NC_022350_2 2.14|341741|27|NC_022350|CRT 341741-341767 27 MK392366 Streptomyces phage Janus, complete genome 18742-18768 4 0.852
NC_022350_2 2.14|341741|27|NC_022350|CRT 341741-341767 27 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 986915-986941 4 0.852
NC_022350_2 2.14|341741|27|NC_022350|CRT 341741-341767 27 NZ_CP017079 Novosphingobium resinovorum strain SA1 plasmid pSA4, complete sequence 64553-64579 4 0.852
NC_022350_2 2.14|341741|27|NC_022350|CRT 341741-341767 27 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 220201-220227 4 0.852
NC_022350_2 2.14|341741|27|NC_022350|CRT 341741-341767 27 NZ_CP005089 Sphingobium sp. TKS plasmid pTK5, complete sequence 41728-41754 4 0.852
NC_022350_3 3.1|369657|27|NC_022350|CRISPRCasFinder 369657-369683 27 NC_023591 Mycobacterium phage Adler, complete genome 61249-61275 4 0.852
NC_022350_3 3.1|369657|27|NC_022350|CRISPRCasFinder 369657-369683 27 KF981876 UNVERIFIED: Mycobacterium phage ADLER F1725, complete genome 61247-61273 4 0.852
NC_022350_3 3.7|370053|27|NC_022350|CRISPRCasFinder 370053-370079 27 NZ_CP022363 Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence 10066-10092 4 0.852
NC_022350_3 3.10|370263|27|NC_022350|CRISPRCasFinder 370263-370289 27 NZ_CP030864 Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence 460464-460490 4 0.852
NC_022350_3 3.10|370263|27|NC_022350|CRISPRCasFinder 370263-370289 27 NC_016652 Rhodococcus phage REQ2, complete genome 36035-36061 4 0.852
NC_022350_5 5.6|930393|27|NC_022350|CRT 930393-930419 27 NZ_CP010326 Pantoea sp. PSNIH1 plasmid pPSP-3a9, complete sequence 242875-242901 4 0.852
NC_022350_5 5.6|930393|27|NC_022350|CRT 930393-930419 27 NZ_CP021045 Phaeobacter gallaeciensis strain P129 plasmid pP129_e, complete sequence 30409-30435 4 0.852
NC_022350_5 5.6|930393|27|NC_022350|CRT 930393-930419 27 NZ_CP010678 Phaeobacter gallaeciensis strain P75 plasmid pP75_e, complete sequence 30478-30504 4 0.852
NC_022350_5 5.6|930393|27|NC_022350|CRT 930393-930419 27 NC_023142 Phaeobacter gallaeciensis DSM 26640 plasmid pGal_F69, complete sequence 30507-30533 4 0.852
NC_022350_5 5.6|930393|27|NC_022350|CRT 930393-930419 27 NZ_CP010789 Phaeobacter gallaeciensis strain P63 plasmid pP63_e, complete sequence 30472-30498 4 0.852
NC_022350_5 5.6|930393|27|NC_022350|CRT 930393-930419 27 NZ_CP010642 Phaeobacter gallaeciensis strain P73 plasmid pP73_f, complete sequence 30478-30504 4 0.852
NC_022350_5 5.6|930393|27|NC_022350|CRT 930393-930419 27 NZ_CP010593 Phaeobacter gallaeciensis strain P11 plasmid pP11_e, complete sequence 30504-30530 4 0.852
NC_022350_5 5.6|930393|27|NC_022350|CRT 930393-930419 27 AM419438 Archaeal BJ1 virus complete genome 36975-37001 4 0.852
NC_022350_5 5.6|930393|27|NC_022350|CRT 930393-930419 27 NC_008695 Archaeal BJ1 virus, complete genome 36975-37001 4 0.852
NC_022350_5 5.10|930549|27|NC_022350|CRT 930549-930575 27 KY945355 Mycobacterium phage Shandong1, complete genome 25634-25660 4 0.852
NC_022350_5 5.10|930549|27|NC_022350|CRT 930549-930575 27 NZ_CP015095 Pelagibaca abyssi strain JLT2014 plasmid pPABY4, complete sequence 106725-106751 4 0.852
NC_022350_5 5.10|930549|27|NC_022350|CRT 930549-930575 27 NC_041888 Mycobacterium phage Tortellini, complete genome 37216-37242 4 0.852
NC_022350_5 5.15|930786|30|NC_022350|CRT 930786-930815 30 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 1096460-1096489 4 0.867
NC_022350_5 5.16|930834|24|NC_022350|CRT 930834-930857 24 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 1898211-1898234 4 0.833
NC_022350_5 5.16|930834|24|NC_022350|CRT 930834-930857 24 NZ_CP025431 Paracoccus zhejiangensis strain J6 plasmid pPZ01, complete sequence 261506-261529 4 0.833
NC_022350_5 5.16|930834|24|NC_022350|CRT 930834-930857 24 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 673134-673157 4 0.833
NC_022350_5 5.16|930834|24|NC_022350|CRT 930834-930857 24 NZ_CP016822 Rhodococcus sp. p52 plasmid pDF03, complete sequence 60076-60099 4 0.833
NC_022350_5 5.16|930834|24|NC_022350|CRT 930834-930857 24 MN582086 Siphoviridae sp. ctdEk19, complete genome 33324-33347 4 0.833
NC_022350_5 5.16|930834|24|NC_022350|CRT 930834-930857 24 MF919502 Mycobacterium phage Demsculpinboyz, complete genome 21980-22003 4 0.833
NC_022350_5 5.16|930834|24|NC_022350|CRT 930834-930857 24 MT889380 Mycobacterium phage Coco12, complete genome 22623-22646 4 0.833
NC_022350_5 5.16|930834|24|NC_022350|CRT 930834-930857 24 NC_023698 Mycobacterium phage Avani, complete genome 21987-22010 4 0.833
NC_022350_5 5.16|930834|24|NC_022350|CRT 930834-930857 24 MT114167 Mycobacterium phage Phanphagia, complete genome 22278-22301 4 0.833
NC_022350_5 5.16|930834|24|NC_022350|CRT 930834-930857 24 NZ_CP050953 Rhodococcus sp. DMU1 plasmid unnamed 558871-558894 4 0.833
NC_022350_5 5.16|930834|24|NC_022350|CRT 930834-930857 24 NZ_CP015881 Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence 1500559-1500582 4 0.833
NC_022350_5 5.16|930834|24|NC_022350|CRT 930834-930857 24 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 295932-295955 4 0.833
NC_022350_5 5.16|930834|24|NC_022350|CRT 930834-930857 24 NC_015583 Novosphingobium sp. PP1Y plasmid Mpl, complete sequence 1116335-1116358 4 0.833
NC_022350_5 5.16|930834|24|NC_022350|CRT 930834-930857 24 MN096355 Mycobacterium phage Purky, complete genome 48975-48998 4 0.833
NC_022350_5 5.16|930834|24|NC_022350|CRT 930834-930857 24 MK279853 Gordonia phage Gray, complete genome 68404-68427 4 0.833
NC_022350_6 6.4|1217314|25|NC_022350|CRISPRCasFinder 1217314-1217338 25 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 9745-9769 4 0.84
NC_022350_6 6.4|1217314|25|NC_022350|CRISPRCasFinder 1217314-1217338 25 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 1906386-1906410 4 0.84
NC_022350_6 6.4|1217314|25|NC_022350|CRISPRCasFinder 1217314-1217338 25 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 794756-794780 4 0.84
NC_022350_6 6.4|1217314|25|NC_022350|CRISPRCasFinder 1217314-1217338 25 CP003956 Rhodococcus opacus PD630 plasmid 7, complete sequence 34847-34871 4 0.84
NC_022350_6 6.4|1217314|25|NC_022350|CRISPRCasFinder 1217314-1217338 25 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 1665271-1665295 4 0.84
NC_022350_6 6.4|1217314|25|NC_022350|CRISPRCasFinder 1217314-1217338 25 NC_012723 Burkholderia glumae BGR1 plasmid bglu_1p, complete sequence 15832-15856 4 0.84
NC_022350_6 6.4|1217314|25|NC_022350|CRISPRCasFinder 1217314-1217338 25 NZ_CP032828 Sphingomonas sp. YZ-8 plasmid unnamed1, complete sequence 348896-348920 4 0.84
NC_022350_6 6.4|1217314|25|NC_022350|CRISPRCasFinder 1217314-1217338 25 NZ_CP028348 Novosphingobium sp. THN1 plasmid pTHN, complete sequence 406425-406449 4 0.84
NC_022350_6 6.4|1217314|25|NC_022350|CRISPRCasFinder 1217314-1217338 25 CP054917 Streptomyces sp. NA02950 plasmid unnamed, complete sequence 26065-26089 4 0.84
NC_022350_6 6.4|1217314|25|NC_022350|CRISPRCasFinder 1217314-1217338 25 NZ_CP022369 Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence 450297-450321 4 0.84
NC_022350_6 6.4|1217314|25|NC_022350|CRISPRCasFinder 1217314-1217338 25 NC_022437 Pseudomonas fluorescens R124 plasmid pMP-R124, complete sequence 16147-16171 4 0.84
NC_022350_6 6.4|1217314|25|NC_022350|CRISPRCasFinder 1217314-1217338 25 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 1382131-1382155 4 0.84
NC_022350_6 6.4|1217314|25|NC_022350|CRISPRCasFinder 1217314-1217338 25 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 1418915-1418939 4 0.84
NC_022350_6 6.4|1217314|25|NC_022350|CRISPRCasFinder 1217314-1217338 25 NZ_CP051294 Mesorhizobium sp. NZP2077 plasmid pMSNZP2077A, complete sequence 118938-118962 4 0.84
NC_022350_6 6.4|1217314|25|NC_022350|CRISPRCasFinder 1217314-1217338 25 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 1711697-1711721 4 0.84
NC_022350_6 6.4|1217314|25|NC_022350|CRISPRCasFinder 1217314-1217338 25 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 722328-722352 4 0.84
NC_022350_6 6.4|1217314|25|NC_022350|CRISPRCasFinder 1217314-1217338 25 NZ_CP010858 Marinovum algicola DG 898 plasmid pMaD3 67000-67024 4 0.84
NC_022350_6 6.4|1217314|25|NC_022350|CRISPRCasFinder 1217314-1217338 25 NZ_CP033363 Mesorhizobium sp. NZP2077 plasmid pMSNZP2077NSa, complete sequence 118938-118962 4 0.84
NC_022350_6 6.4|1217314|25|NC_022350|CRISPRCasFinder 1217314-1217338 25 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 1149411-1149435 4 0.84
NC_022350_6 6.4|1217314|25|NC_022350|CRISPRCasFinder 1217314-1217338 25 NZ_CP032349 Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence 438623-438647 4 0.84
NC_022350_6 6.4|1217314|25|NC_022350|CRISPRCasFinder 1217314-1217338 25 NZ_CP014580 Burkholderia sp. OLGA172 plasmid pOLGA1, complete sequence 243636-243660 4 0.84
NC_022350_6 6.4|1217314|25|NC_022350|CRISPRCasFinder 1217314-1217338 25 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 1410063-1410087 4 0.84
NC_022350_7 7.1|1572838|28|NC_022350|CRISPRCasFinder 1572838-1572865 28 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 818773-818800 4 0.857
NC_022350_7 7.1|1572838|28|NC_022350|CRISPRCasFinder 1572838-1572865 28 NZ_CP032054 Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence 420542-420569 4 0.857
NC_022350_7 7.1|1572838|28|NC_022350|CRISPRCasFinder 1572838-1572865 28 NZ_CP016560 Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence 77799-77826 4 0.857
NC_022350_7 7.5|1573060|25|NC_022350|CRISPRCasFinder 1573060-1573084 25 NZ_CP021372 Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence 176640-176664 4 0.84
NC_022350_7 7.5|1573060|25|NC_022350|CRISPRCasFinder 1573060-1573084 25 LR134127 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7 29428-29452 4 0.84
NC_022350_7 7.5|1573060|25|NC_022350|CRISPRCasFinder 1573060-1573084 25 LR134127 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7 38191-38215 4 0.84
NC_022350_7 7.5|1573060|25|NC_022350|CRISPRCasFinder 1573060-1573084 25 MT553342 Microbacterium phage Kelcole, complete genome 51573-51597 4 0.84
NC_022350_7 7.5|1573060|25|NC_022350|CRISPRCasFinder 1573060-1573084 25 NC_048068 Microbacterium phage OneinaGillian, complete genome 50894-50918 4 0.84
NC_022350_7 7.5|1573060|25|NC_022350|CRISPRCasFinder 1573060-1573084 25 MT310894 Microbacterium phage Tempo, complete genome 51697-51721 4 0.84
NC_022350_7 7.5|1573060|25|NC_022350|CRISPRCasFinder 1573060-1573084 25 NZ_CP047175 Rathayibacter sp. VKM Ac-2760 plasmid unnamed2, complete sequence 42080-42104 4 0.84
NC_022350_7 7.5|1573060|25|NC_022350|CRISPRCasFinder 1573060-1573084 25 NZ_CP013631 Rhizobium sp. N324 plasmid pRspN324a, complete sequence 67777-67801 4 0.84
NC_022350_7 7.5|1573060|25|NC_022350|CRISPRCasFinder 1573060-1573084 25 MN034284 Leviviridae sp. isolate H2_Rhizo_Litter_49_scaffold_25938 sequence 624-648 4 0.84
NC_022350_7 7.14|1573768|25|NC_022350|CRISPRCasFinder 1573768-1573792 25 MN582064 Podoviridae sp. ctka020, complete genome 29274-29298 4 0.84
NC_022350_8 8.5|2087748|24|NC_022350|CRT 2087748-2087771 24 NZ_CP028348 Novosphingobium sp. THN1 plasmid pTHN, complete sequence 680430-680453 4 0.833
NC_022350_8 8.5|2087748|24|NC_022350|CRT 2087748-2087771 24 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 5913119-5913142 4 0.833
NC_022350_8 8.5|2087748|24|NC_022350|CRT 2087748-2087771 24 NZ_CP015007 Aminobacter aminovorans strain KCTC 2477 plasmid pAA02, complete sequence 143186-143209 4 0.833
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP013224 Salmonella enterica subsp. enterica serovar Anatum strain GT-38 plasmid PDM04, complete sequence 31668-31693 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_KX470734 Escherichia coli strain Ecoli14-55 plasmid pEC55-NDM4, complete sequence 13272-13297 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_KY296103 Enterobacter cloacae strain 13E169 plasmid pHN84NDM, complete sequence 2266-2291 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_KY978629 Cronobacter sakazakii strain 505108 plasmid p505108-NDM, complete sequence 13374-13399 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_MF072961 Citrobacter freundii strain P10159 plasmid pP10159-1, complete sequence 13272-13297 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_MF042356 Enterobacter cloacae strain 20ES plasmid pNDM_20ES, complete sequence 34140-34165 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_MF042359 Serratia marcescens strain 7209 plasmid pNDM_7209, complete sequence 21406-21431 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_KU726616 Salmonella enterica subsp. enterica serovar Stanley strain LS001 plasmid pHS36-NDM, complete sequence 24123-24148 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_KU314941 Klebsiella pneumoniae isolate KP04 plasmid pKP04NDM, complete sequence 13271-13296 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_KX094555 Escherichia coli strain ZHDC33 plasmid pZHDC33, complete sequence 47455-47480 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP009413 Salmonella enterica strain CFSAN007427 isolate N20272 plasmid pCFSAN007427_01, complete sequence 32263-32288 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_KR059864 Klebsiella pneumoniae strain KP-YQ13450 plasmid pYQ12450, complete sequence 2286-2311 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_KP987216 Citrobacter freundii strain 112298 plasmid p112298-NDM, complete sequence 12726-12751 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP022126 Klebsiella pneumoniae strain DHQP1605752_NV plasmid p1605752AC2, complete sequence 136378-136403 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP010373 Escherichia coli strain 6409 plasmid p6409-202.186kb, complete sequence 3544-3569 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP010373 Escherichia coli strain 6409 plasmid p6409-202.186kb, complete sequence 179432-179457 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP010373 Escherichia coli strain 6409 plasmid p6409-202.186kb, complete sequence 188444-188469 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP028588 Escherichia coli strain WCHEC4533 plasmid pNDM4_000533, complete sequence 33846-33871 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP041930 Klebsiella pneumoniae strain 18-2374 plasmid pSECR18-2374C, complete sequence 29605-29630 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP048296 Escherichia coli strain CVM N18EC0432 plasmid pN18EC0432-2, complete sequence 87780-87805 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP028560 Acinetobacter sp. WCHA45 plasmid pNDM1_010045, complete sequence 52815-52840 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NC_018994 Escherichia coli plasmid pNDM-1_Dok01, complete sequence 135270-135295 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP020854 Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence 68922-68947 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NC_019153 Klebsiella pneumoniae plasmid pNDM-KN, complete sequence 103553-103578 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NC_019162 Klebsiella pneumoniae strain CRE380 plasmid pNDM-HN380, complete sequence 13272-13297 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP032878 Escherichia coli strain WCHEC000837 plasmid pNDM4_000837, complete sequence 33327-33352 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP018817 Klebsiella pneumoniae strain AR_0049 plasmid unitig_1, complete sequence 42648-42673 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP013634 Rhizobium sp. N324 plasmid pRspN324d, complete sequence 495552-495577 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP020951 Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence 551870-551895 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 1292791-1292816 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 CP049311 Salmonella enterica subsp. enterica serovar Heidelberg strain CVM N53023 plasmid pN53023, complete sequence 310424-310449 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP041642 Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-NDM4, complete sequence 56767-56792 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP048828 Acinetobacter baumannii strain ABF9692 plasmid pABF9692, complete sequence 197048-197073 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP021206 Escherichia coli strain Z1002 plasmid p1002-NDM1, complete sequence 7496-7521 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP050416 Acinetobacter baumannii strain PM193665 plasmid pPM193665_1, complete sequence 53320-53345 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP032284 Acinetobacter sp. WCHA55 plasmid pNDM1_010055, complete sequence 50298-50323 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NC_020811 Klebsiella pneumoniae strain KPN5047 plasmid pKPN5047, complete sequence 13272-13297 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP030191 Salmonella enterica strain SA20104250 plasmid pSA20104250.1, complete sequence 10321-10346 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP050426 Acinetobacter baumannii strain PM194188 plasmid pPM194122_1, complete sequence 53320-53345 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NC_023914 Enterobacter cloacae strain CRE727 plasmid pNDM-HF727, complete sequence 13272-13297 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP044035 Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed1, complete sequence 12359-12384 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP029118 Escherichia coli strain AR435 plasmid unnamed5, complete sequence 105092-105117 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NC_019123 Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH1148_107, complete sequence 14493-14518 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP020068 Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence 248919-248944 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 MN178638 Kluyvera cryocrescens strain SCW13 plasmid pNDM1_SCW13, complete sequence 13049-13074 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP038280 Raoultella ornithinolytica strain WLK218 plasmid pWLK-NDM, complete sequence 29501-29526 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP028929 Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence 163996-164021 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 CP050158 Enterobacter cloacae plasmid Carbapenemase(NDM-1)_IncX3, complete sequence 23151-23176 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP016921 Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence 47983-48008 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 CP050161 Escherichia coli plasmid Carbapenemase(NDM-1)_IncX3, complete sequence 51656-51681 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 CP050156 Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence 226890-226915 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NC_021501 Klebsiella michiganensis E718 plasmid pKOX_NDM1, complete sequence 34134-34159 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP017672 Providencia rettgeri strain RB151 plasmid pRB151-NDM, complete sequence 49428-49453 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP023914 Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed3, complete sequence 80289-80314 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP029386 Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 plasmid pNDM6_040074, complete sequence 24220-24245 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP030264 Ensifer adhaerens strain Corn53 plasmid AB, complete sequence 65696-65721 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP022226 Escherichia coli strain WCHEC96200 plasmid pNDM4_WCHEC96200, complete sequence 33319-33344 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 MN823999 Klebsiella pneumoniae strain 362713 plasmid p362713-FIIK, complete sequence 168895-168920 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_AP018748 Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence 105230-105255 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP005085 Sphingobium sp. TKS plasmid pTK1, complete sequence 299551-299576 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NC_020552 Citrobacter freundii plasmid pYE315203, complete sequence 13275-13300 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP040598 Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15_NDM-1, complete sequence 87825-87850 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP014297 Klebsiella pneumoniae strain KP38731 plasmid unnamed13 sequence 47173-47198 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP016453 Sphingobium sp. RAC03 plasmid pBSY17_1, complete sequence 651243-651268 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP020056 Escherichia coli strain AR_0069 plasmid unitig_2, complete sequence 35229-35254 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP031884 Klebsiella pneumoniae strain WCHKP095845 plasmid pNDM1_095845, complete sequence 53720-53745 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP027409 Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_317 plasmid unnamed, complete sequence 111083-111108 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP027409 Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_317 plasmid unnamed, complete sequence 217269-217294 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP031297 Escherichia coli strain EC17GD31 plasmid pGD31-NDM, complete sequence 122282-122307 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP041229 Acinetobacter haemolyticus strain AN54 plasmid pAhaeAN54e, complete sequence 39040-39065 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_LT985293 Escherichia coli strain 4410-1 plasmid RCS79_p, complete sequence 17773-17798 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_LT985268 Escherichia coli strain 699 plasmid RCS58_p, complete sequence 20078-20103 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 MN604267 Salmonella enterica subsp. enterica serovar London strain SAL-19-0623 plasmid pSAL-19-0623_NDM, complete sequence 208327-208352 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_MK372385 Morganella morganii strain ABC140 plasmid pABC140-NDM-1, complete sequence 12840-12865 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_MK372381 Klebsiella pneumoniae strain ABC52 plasmid pABC52-NDM-1, complete sequence 13272-13297 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP053899 Proteus mirabilis strain YPM35 plasmid pJPM35-1, complete sequence 127861-127886 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 MN657249 Enterobacteriaceae bacterium strain 1086-16 plasmid pKP39-T3, complete sequence 116167-116192 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 MN657250 Enterobacteriaceae bacterium strain 1083-16 plasmid pKP39-T4, complete sequence 116203-116228 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_MH909333 Klebsiella pneumoniae strain 7-SP plasmid p7SP-NDM, complete sequence 13272-13297 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_MH909346 Klebsiella pneumoniae strain 20130907-4 plasmid p309074-NDM, complete sequence 13272-13297 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_MH909335 Klebsiella pneumoniae strain 11-SP plasmid p11SP-NDM, complete sequence 13271-13296 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_MH234505 Escherichia coli strain CRE3694 plasmid pNDM-HK3694, complete sequence 13272-13297 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_MH917282 Klebsiella pneumoniae strain A457 plasmid pA457-NDA, complete sequence 13269-13294 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_MH349095 Escherichia coli strain 948 plasmid pMTC948, complete sequence 2266-2291 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_MK372386 Klebsiella pneumoniae strain BC700 plasmid pBC700-NDM-1, complete sequence 13272-13297 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_MK372380 Enterobacter cloacae strain ABC40 plasmid pABC40-NDM-1, complete sequence 13272-13297 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_MK372382 Escherichia coli strain ABC54 plasmid pABC54-NDM-1, complete sequence 13272-13297 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 MN657241 Enterobacteriaceae bacterium strain 20-16 plasmid pCF104a-T3, complete sequence 137520-137545 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 MN657242 Enterobacteriaceae bacterium strain 128-16 plasmid pEC405a-T3, complete sequence 49557-49582 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 MN657243 Enterobacteriaceae bacterium strain 24-16 plasmid pEC744-T5, complete sequence 109132-109157 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 MN657244 Enterobacteriaceae bacterium strain 690-16 plasmid pEC6332-T3, complete sequence 76292-76317 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 MN657247 Enterobacteriaceae bacterium strain 460-16 plasmid pECl-T3, complete sequence 55946-55971 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_MG462728 Escherichia coli strain AMA1416 plasmid pAMA1416, complete sequence 107928-107953 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_MH457126 Vibrio alginolyticus strain Vb1394 plasmid pC1394, complete sequence 118250-118275 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_MH105052 Escherichia coli strain EC600 plasmid pSL131T_IncX3, complete sequence 11302-11327 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP044464 Acinetobacter schindleri strain HZE23-1 plasmid pHZE23-1-1, complete sequence 94334-94359 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_MF042350 Klebsiella pneumoniae strain 18ES plasmid pNDM_18ES, complete sequence 33810-33835 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_MF042354 Klebsiella pneumoniae strain 6TM plasmid pNDM_6TM, complete sequence 34092-34117 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_MF042353 Klebsiella pneumoniae strain 1TM plasmid pNDM_1TM, complete sequence 33557-33582 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_MF042351 Serratia marcescens strain 12TM plasmid pNDM_12TM, complete sequence 33543-33568 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_MF042358 Enterobacter cloacae strain 22ES plasmid pNDM_22ES, complete sequence 23756-23781 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_MF415608 Enterobacter cloacae strain hhy03 plasmid pNDM-BJ03, complete sequence 13272-13297 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_MF042352 Serratia marcescens strain 4TM plasmid pNDM_4TM, complete sequence 33557-33582 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_MF042357 Serratia marcescens strain 9580 plasmid pNDM_9580, complete sequence 28922-28947 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_MG252893 Raoultella ornithinolytica strain pRor-30818cz plasmid Ror-30818cz, complete sequence 46124-46149 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP041048 Citrobacter sp. CF971 plasmid pBM527-2, complete sequence 23671-23696 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_KX832927 Providencia rettgeri strain 16pre36 plasmid p16Pre36-NDM, complete sequence 78775-78800 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_KX786648 Enterobacter cloacae strain B557 plasmid pB557-NDM, complete sequence 116362-116387 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_KY399975 Enterobacter cloacae strain EClY2403 plasmid pNDM1_EClY2403, complete sequence 106588-106613 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_KY399974 Enterobacter cloacae strain EClY2402 plasmid pNDM1_EClY2402, complete sequence 106624-106649 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP053895 Proteus mirabilis strain JPM24 plasmid pJPM24, complete sequence 61495-61520 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_AP023051 Citrobacter portucalensis strain IOMTU157 plasmid pIOMTU157, complete sequence 125781-125806 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP034756 Enterobacter hormaechei subsp. hoffmannii strain Eh1 plasmid p2, complete sequence 86197-86222 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_KX636095 Klebsiella pneumoniae strain RJ119 plasmid pRJ119-NDM1, complete sequence 7182-7207 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_KU302802 Enterobacter cloacae strain SZECL1 plasmid pNDM1_SZ2 clone ST231, complete sequence 61266-61291 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_KU302801 Enterobacter cloacae strain SZECL1 plasmid pNDM1_SZ1 clone ST231, complete sequence 61266-61291 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_KJ588779 Klebsiella pneumoniae strain ATCC BAA-2146 plasmid pNDM-US-2, complete sequence 113434-113459 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_KR351290 Klebsiella pneumoniae subsp. pneumoniae strain K351 plasmid pK351, complete sequence 102254-102279 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_KJ802405 Providencia stuartii isolate GN576 plasmid pNDM-PstGN576, complete sequence 122601-122626 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_KJ812998 Enterobacter cloacae isolate GN574 plasmid pNDM-Ec1GN574, complete sequence 106279-106304 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_KP900016 Leclercia adecarboxylata strain P10164 plasmid pP10164-NDM, complete sequence 16155-16180 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_KP765744 Enterobacter cloacae strain ECN49 plasmid pNDM-ECN49, complete sequence 51111-51136 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_KP868647 Enterobacter cloacae strain WCHECl-14653 plasmid pNDM1_EC14653, complete sequence 106616-106641 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_KJ802404 Escherichia coli isolate GN568 plasmid pNDM-EcoGN568, complete sequence 122581-122606 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_KT965092 Acinetobacter towneri strain G165 plasmid pNDM-GJ01, complete sequence 19595-19620 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_KT965093 Acinetobacter towneri strain G295 plasmid pNDM-GJ02, complete sequence 10571-10596 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP053729 Escherichia coli strain CP61_Sichuan plasmid pCP61-IncFIB, complete sequence 70397-70422 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NC_023322 Acinetobacter bereziniae strain CHI-40-1 plasmid pNDM-40-1, complete sequence 12854-12879 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP029731 Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed3, complete sequence 103665-103690 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP053737 Escherichia coli strain CP8-3_Sichuan plasmid pCP8-3-IncFII, complete sequence 7088-7113 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_KC887916 Escherichia coli strain ARL10/167 isolate EC4 plasmid pEC4-NDM-6, complete sequence 106279-106304 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_KC887917 Enterobacter cloacae isolate ECL3 plasmid pECL3-NDM-1, complete sequence 16381-16406 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP020524 Escherichia coli strain 190 plasmid unnamed1, complete sequence 57698-57723 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 MT077883 Escherichia coli plasmid p23, complete sequence 17925-17950 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NC_009838 Escherichia coli APEC O1 plasmid pAPEC-O1-R, complete sequence 100659-100684 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP010370 Acinetobacter nosocomialis strain 6411 plasmid p6411-9.012kb, complete sequence 21772-21797 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP013221 Salmonella enterica subsp. enterica serovar Anatum strain GT-01 plasmid PDM02, complete sequence 80484-80509 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP024285 Escherichia albertii strain 2014C-4356 plasmid unnamed3, complete sequence 63442-63467 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 MN061454 Enterobacter cloacae strain EC-14-60 plasmid pECL-14-60-NDM-1, complete sequence 15892-15917 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP032278 Acinetobacter sp. WCHAc010034 plasmid pNDM1_010034, complete sequence 32490-32515 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP045561 Acinetobacter nosocomialis strain AC1530 plasmid pAC1530, complete sequence 76077-76102 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NC_019045 Escherichia coli strain N10-2337 plasmid pNDM102337, complete sequence 122942-122967 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NC_025130 Raoultella planticola strain RJA274 plasmid NDM-1, complete sequence 47557-47582 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NC_019158 Klebsiella pneumoniae plasmid pNDM10469, complete sequence 113657-113682 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 MN310375 Klebsiella quasipneumoniae strain QD1501 plasmid pQD1501-Ct1, complete sequence 107122-107147 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 MN310377 Klebsiella pneumoniae strain 12085 plasmid p12085-Ct1, complete sequence 64967-64992 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP012754 Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence 13112-13137 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP031736 Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence 68888-68913 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP037965 Klebsiella pneumoniae strain SCKP020135 plasmid pNDM1_020135, complete sequence 32643-32668 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NC_025184 Klebsiella pneumoniae strain RJF866 plasmid pRJF866, complete sequence 76626-76651 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP011518 Pandoraea oxalativorans strain DSM 23570 plasmid pPO70-1, complete sequence 469282-469307 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP021961 Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence 44666-44691 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP021962 Klebsiella pneumoniae strain AR_0139 plasmid tig00000008, complete sequence 109287-109312 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP022350 Klebsiella michiganensis strain K516 plasmid pK516_NDM1, complete sequence 44828-44853 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP046274 Enterobacter hormaechei strain E70 plasmid pE70-NDM1, complete sequence 34563-34588 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP039811 Klebsiella pneumoniae strain C2660 plasmid pC2660-4-NDM, complete sequence 25490-25515 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 CP049307 Salmonella enterica subsp. enterica serovar Heidelberg strain CVM N58631 plasmid p58631, complete sequence 190887-190912 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NC_011366 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG202, complete sequence 452131-452156 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NC_025000 Acinetobacter lwoffii strain Iz4b plasmid pNDM-Iz4b, complete sequence 14410-14435 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NC_024959 Acinetobacter calcoaceticus strain NDM-WS2 plasmid pNDM-WS2, complete sequence 13847-13872 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NC_009140 Salmonella enterica subsp. enterica serovar Newport str. SL254 plasmid pSN254, complete sequence 130143-130168 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP012168 Enterobacter hormaechei subsp. steigerwaltii strain 34998 plasmid p34998-239.973kb, complete sequence 148534-148559 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP021536 Escherichia coli strain AR_0119 plasmid unitig_2, complete sequence 31201-31226 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP010399 Acinetobacter baumannii strain 6200 plasmid p6200-47.274kb, complete sequence 4577-4602 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP035935 Acinetobacter cumulans strain WCHAc060092 plasmid pNDM1_060092, complete sequence 39093-39118 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP006661 Klebsiella pneumoniae strain ATCC BAA-2146 plasmid pNDM-US, complete sequence 127533-127558 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NC_010625 Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence 1809834-1809859 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NC_012690 Escherichia coli plasmid peH4H, complete sequence 95724-95749 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 CP050164 Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncA/C2, complete sequence 112308-112333 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 MK933278 Enterobacter hormaechei strain SCNJ07 plasmid pNDM-SCNJ07, complete sequence 76626-76651 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP022612 Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence 142738-142763 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP015882 Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence 865255-865280 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 CP048298 Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL_SAL-A00527 plasmid pN1566-1, complete sequence 86450-86475 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NC_019066 Escherichia coli plasmid pAPEC1990_61, complete sequence 114749-114774 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NC_019069 Escherichia coli plasmid pNDM10505, complete sequence 123719-123744 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 AMXH01000087 Acinetobacter pittii strain XM1570 plasmid pXM1, complete sequence, whole genome shotgun sequence 14410-14435 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_JQ739158 Acinetobacter lwoffii strain ABZ78 plasmid pABZ78, complete sequence 4498-4523 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP043383 Enterobacter hormaechei subsp. xiangfangensis strain WCHEX045001 plasmid pNDM1_045001, complete sequence 15206-15231 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NC_019985 Acinetobacter baumannii ZW85-1 plasmid pAbNDM-1, complete sequence 14410-14435 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP053365 Klebsiella pneumoniae strain BA2275 plasmid p1, complete sequence 79690-79715 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP018366 Klebsiella pneumoniae strain Kp_Goe_62629 plasmid pKp_Goe_629-2, complete sequence 72161-72186 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP023187 Klebsiella michiganensis strain K518 plasmid pK518_NDM1, complete sequence 83389-83414 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NC_021813 Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002069 plasmid pCFSAN002069_01, complete sequence 86573-86598 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP028786 Klebsiella pneumoniae strain SCKP020049 plasmid pNDM1_020049, complete sequence 16816-16841 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP021936 Escherichia coli strain AR_0055 plasmid unitig_2, complete sequence 63971-63996 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP006799 Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence 13112-13137 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP023948 Klebsiella pneumoniae strain FDAARGOS_446 plasmid unnamed1, complete sequence 191374-191399 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP041938 Klebsiella pneumoniae strain KP14003 plasmid pNDM-KP14003, complete sequence 29965-29990 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NC_022589 Providencia rettgeri strain 09ACRGNY2001 plasmid pPrY2001, complete sequence 69941-69966 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NC_012692 Escherichia coli plasmid pAR060302, complete sequence 120199-120224 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP015835 Escherichia coli strain MS6198 plasmid pMS6198A, complete sequence 112278-112303 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP021699 Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence 39160-39185 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP014478 Acinetobacter pittii strain AP_882 plasmid pNDM-AP_882, complete sequence 75133-75158 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NC_023908 Klebsiella pneumoniae strain KP1 plasmid pKP1-NDM-1, complete sequence 113391-113416 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_AP018830 Enterobacter hormaechei subsp. xiangfangensis strain M206 plasmid pM206-NDM1, complete sequence 44921-44946 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NC_019268 Acinetobacter lwoffii plasmid pNDM-BJ01, complete sequence 14410-14435 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NC_019281 Acinetobacter lwoffii plasmid pNDM-BJ02, complete sequence 14410-14435 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NC_025116 Acinetobacter sp. M131 plasmid pM131_NDM1, complete sequence 23011-23036 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP040884 Escherichia coli strain K71-77 plasmid pK71-77-1-NDM, complete sequence 92179-92204 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP026015 Klebsiella variicola strain 13450 plasmid p13450-3, complete sequence 53096-53121 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_AP018143 Escherichia coli strain M214 isolate M214 plasmid pM214_AC2, complete sequence 138569-138594 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP035001 Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence 625395-625420 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP048797 Providencia vermicola strain P8538 plasmid p8538-NDM-1, complete sequence 112268-112293 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 MN937240 Enterobacter cloacae strain BSI034 plasmid pBSI034-NDM1, complete sequence 32345-32370 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP037904 Escherichia coli strain LHM10-1 plasmid unnamed1, complete sequence 31973-31998 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 MN603981 Klebsiella aerogenes strain 1564 plasmid p1564, complete sequence 111617-111642 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 MN604268 Escherichia coli strain J53 plasmid pJ53_SAL-19-0623_NDM, complete sequence 25310-25335 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_LN833432 Acinetobacter baumannii isolate CHI-32 plasmid pNDM-32, complete sequence 52028-52053 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_MK123268 Serratia marcescens strain M17468 plasmid pSMA17468, complete sequence 114850-114875 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP053897 Providencia rettgeri strain YPR31 plasmid pYPR31, complete sequence 64737-64762 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP032132 Acinetobacter chinensis strain WCHAc010005 plasmid pNDM1_010005, complete sequence 26235-26260 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_MH995508 Enterobacter cloacae strain ECL17464 plasmid pECL17464, complete sequence 114851-114876 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_MH995506 Citrobacter freundii strain CFR17394 plasmid pCFR17394, complete sequence 114851-114876 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_MH917283 Klebsiella pneumoniae strain A575 plasmid pA575-NDM, complete sequence 48496-48521 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_MH909345 Klebsiella pneumoniae strain N201205880 plasmid p205880-NDM, complete sequence 27419-27444 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_MH105050 Salmonella enterica subsp. enterica serovar Lomita strain SL131 plasmid pSL131_IncA/C-IncX3, complete sequence 214658-214683 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_MH909343 Klebsiella pneumoniae strain 1012018 plasmid p12018-NDM, complete sequence 47650-47675 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_MH909347 Klebsiella pneumoniae strain 362713 plasmid p362713-NDM, complete sequence 45514-45539 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_MH263652 Providencia rettgeri strain QD51 plasmid pNDM-QD51, complete sequence 109517-109542 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_MH917281 Klebsiella pneumoniae strain 14504 plasmid p14504-NDM, complete sequence 30628-30653 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_MK101346 Citrobacter freundii strain CRE3 plasmid pCRE7-NDM, complete sequence 104044-104069 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_MK757441 Alcaligenes faecalis strain AN70 plasmid pAN70-1, complete sequence 49778-49803 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP020090 Enterobacter cloacae strain PIMB10EC27 plasmid pEC27-1, complete sequence 36147-36172 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 MN657245 Enterobacteriaceae bacterium strain 23-16 plasmid pEC6332-T6, complete sequence 20014-20039 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 MN657246 Enterobacteriaceae bacterium strain 23-17 plasmid pEC6332-T7, complete sequence 25006-25031 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_MF344560 Enterobacter hormaechei strain 128379 plasmid p128379-NDM, complete sequence 51238-51263 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_MG462729 Escherichia coli strain AMA1742 plasmid pAMA1742, complete sequence 106280-106305 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP035537 Klebsiella pneumoniae subsp. pneumoniae strain CCRI-22199 plasmid pKp199-2, complete sequence 103993-104018 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_MG845200 Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence 229930-229955 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_MG845201 Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence 229961-229986 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP034406 Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence 255319-255344 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 MH001451 Mycobacterium phage Nairb, complete genome 13342-13367 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 MK994522 Methanobacterium virus PhiF1, complete genome 30764-30789 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 MF155936 Mycobacterium phage ZenTime222, complete genome 13342-13367 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 MK494089 Mycobacterium phage Ibrahim, complete genome 13342-13367 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NC_024135 Mycobacterium phage Bernal13, complete genome 13342-13367 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 KM591905 Mycobacterium phage RonRayGun, complete genome 13342-13367 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 MN735432 Mycobacteriophage Whitty, complete genome 13342-13367 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 LT599585 Pseudomonas veronii 1YdBTEX2 genome assembly, plasmid: PVE_plasmid 39713-39738 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP024310 Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence 809205-809230 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP033582 Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence 422918-422943 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP021821 Sinorhizobium meliloti strain M162 plasmid accessoryA, complete sequence 339366-339391 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 1118329-1118354 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP041045 Paracoccus sp. AK26 plasmid pAK1, complete sequence 369099-369124 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP046705 Nostoc sp. ATCC 53789 plasmid pNsp_b, complete sequence 292867-292892 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 928968-928993 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP011481 Hoeflea sp. IMCC20628 plasmid, complete sequence 91925-91950 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP023072 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666a, complete sequence 181402-181427 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP032054 Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence 530728-530753 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP016560 Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence 187984-188009 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NC_009621 Sinorhizobium medicae WSM419 plasmid pSMED02, complete sequence 1018659-1018684 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 2133261-2133286 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 JN698993 Mycobacterium phage Firecracker, complete genome 29207-29232 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 MN694268 Marine virus AFVG_250M110, complete genome 12879-12904 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 MN694268 Marine virus AFVG_250M110, complete genome 12888-12913 4 0.846
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 MN694268 Marine virus AFVG_250M110, complete genome 12897-12922 4 0.846
NC_022350_2 2.8|341396|27|NC_022350|CRT 341396-341422 27 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 130702-130728 5 0.815
NC_022350_2 2.8|341396|27|NC_022350|CRT 341396-341422 27 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 310895-310921 5 0.815
NC_022350_2 2.8|341396|27|NC_022350|CRT 341396-341422 27 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 325311-325337 5 0.815
NC_022350_2 2.8|341396|27|NC_022350|CRT 341396-341422 27 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 317119-317145 5 0.815
NC_022350_2 2.8|341396|27|NC_022350|CRT 341396-341422 27 NZ_CP015737 Shinella sp. HZN7 plasmid pShin-01, complete sequence 559442-559468 5 0.815
NC_022350_2 2.8|341396|27|NC_022350|CRT 341396-341422 27 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 303961-303987 5 0.815
NC_022350_2 2.8|341396|27|NC_022350|CRT 341396-341422 27 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 317119-317145 5 0.815
NC_022350_2 2.8|341396|27|NC_022350|CRT 341396-341422 27 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 309528-309554 5 0.815
NC_022350_2 2.8|341396|27|NC_022350|CRT 341396-341422 27 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 309518-309544 5 0.815
NC_022350_2 2.8|341396|27|NC_022350|CRT 341396-341422 27 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 317131-317157 5 0.815
NC_022350_2 2.8|341396|27|NC_022350|CRT 341396-341422 27 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 317152-317178 5 0.815
NC_022350_2 2.8|341396|27|NC_022350|CRT 341396-341422 27 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 317118-317144 5 0.815
NC_022350_2 2.8|341396|27|NC_022350|CRT 341396-341422 27 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 310919-310945 5 0.815
NC_022350_2 2.8|341396|27|NC_022350|CRT 341396-341422 27 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 310918-310944 5 0.815
NC_022350_2 2.8|341396|27|NC_022350|CRT 341396-341422 27 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 310914-310940 5 0.815
NC_022350_2 2.8|341396|27|NC_022350|CRT 341396-341422 27 NZ_CP009296 Novosphingobium pentaromativorans US6-1 plasmid pLA2, complete sequence 38598-38624 5 0.815
NC_022350_2 2.8|341396|27|NC_022350|CRT 341396-341422 27 NC_025133 Sphingobium wenxiniae strain JZ-1 plasmid pPBA, complete sequence 32924-32950 5 0.815
NC_022350_2 2.8|341396|27|NC_022350|CRT 341396-341422 27 NZ_CP005192 Sphingobium sp. MI1205 plasmid pMI3, complete sequence 86430-86456 5 0.815
NC_022350_2 2.8|341396|27|NC_022350|CRT 341396-341422 27 AB244976 Uncultured bacterium plasmid pLB1 DNA, complete sequence 64054-64080 5 0.815
NC_022350_2 2.8|341396|27|NC_022350|CRT 341396-341422 27 NZ_CP012702 Sphingopyxis macrogoltabida strain EY-1 isolate activated sludge plasmid 2, complete sequence 53597-53623 5 0.815
NC_022350_2 2.8|341396|27|NC_022350|CRT 341396-341422 27 NZ_CP022749 Sphingobium hydrophobicum strain C1 plasmid p3, complete sequence 49355-49381 5 0.815
NC_022350_2 2.8|341396|27|NC_022350|CRT 341396-341422 27 MH744423 Mycobacterium phage Saguaro, complete genome 44496-44522 5 0.815
NC_022350_2 2.8|341396|27|NC_022350|CRT 341396-341422 27 NZ_CP023452 Rhizorhabdus dicambivorans strain Ndbn-20 plasmid p3, complete sequence 22697-22723 5 0.815
NC_022350_2 2.8|341396|27|NC_022350|CRT 341396-341422 27 NZ_CP033229 Sphingobium yanoikuyae strain SJTF8 plasmid pF3, complete sequence 51919-51945 5 0.815
NC_022350_2 2.8|341396|27|NC_022350|CRT 341396-341422 27 NZ_CP017244 Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence 1649697-1649723 5 0.815
NC_022350_2 2.14|341741|27|NC_022350|CRT 341741-341767 27 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 866713-866739 5 0.815
NC_022350_2 2.14|341741|27|NC_022350|CRT 341741-341767 27 NZ_CP024891 Rhodococcus ruber strain YYL plasmid pYYL1.2, complete sequence 65859-65885 5 0.815
NC_022350_2 2.14|341741|27|NC_022350|CRT 341741-341767 27 NZ_CP024892 Rhodococcus ruber strain YYL plasmid pYYL1.1, complete sequence 229187-229213 5 0.815
NC_022350_2 2.14|341741|27|NC_022350|CRT 341741-341767 27 NZ_CP010960 Sphingobium sp. YBL2 plasmid 6pYBL2-6, complete sequence 14964-14990 5 0.815
NC_022350_2 2.14|341741|27|NC_022350|CRT 341741-341767 27 NZ_CP015091 Pelagibaca abyssi strain JLT2014 plasmid pPABY1, complete sequence 74613-74639 5 0.815
NC_022350_2 2.14|341741|27|NC_022350|CRT 341741-341767 27 CP054927 Streptomyces fulvissimus strain NA06532 plasmid unnamed1, complete sequence 558673-558699 5 0.815
NC_022350_2 2.14|341741|27|NC_022350|CRT 341741-341767 27 NZ_LR134451 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence 402598-402624 5 0.815
NC_022350_2 2.14|341741|27|NC_022350|CRT 341741-341767 27 NC_008537 Arthrobacter sp. FB24 plasmid 1, complete sequence 72066-72092 5 0.815
NC_022350_2 2.14|341741|27|NC_022350|CRT 341741-341767 27 NZ_CP040819 Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence 487763-487789 5 0.815
NC_022350_2 2.14|341741|27|NC_022350|CRT 341741-341767 27 NZ_AP014706 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_2p, complete sequence 363598-363624 5 0.815
NC_022350_2 2.14|341741|27|NC_022350|CRT 341741-341767 27 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 879480-879506 5 0.815
NC_022350_2 2.14|341741|27|NC_022350|CRT 341741-341767 27 NZ_CP012399 Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence 264301-264327 5 0.815
NC_022350_2 2.14|341741|27|NC_022350|CRT 341741-341767 27 NZ_CP005085 Sphingobium sp. TKS plasmid pTK1, complete sequence 292057-292083 5 0.815
NC_022350_2 2.14|341741|27|NC_022350|CRT 341741-341767 27 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 516605-516631 5 0.815
NC_022350_2 2.14|341741|27|NC_022350|CRT 341741-341767 27 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 1328081-1328107 5 0.815
NC_022350_2 2.14|341741|27|NC_022350|CRT 341741-341767 27 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 1615787-1615813 5 0.815
NC_022350_2 2.14|341741|27|NC_022350|CRT 341741-341767 27 NZ_CP035000 Rhizobium acidisoli strain FH23 plasmid pRapFH23b, complete sequence 599147-599173 5 0.815
NC_022350_2 2.14|341741|27|NC_022350|CRT 341741-341767 27 NZ_CP047223 Sphingobium yanoikuyae strain YC-JY1 plasmid unnamed5, complete sequence 14316-14342 5 0.815
NC_022350_2 2.14|341741|27|NC_022350|CRT 341741-341767 27 NC_020205 Xanthomonas citri phage CP2 DNA, complete genome 30426-30452 5 0.815
NC_022350_3 3.1|369657|27|NC_022350|CRISPRCasFinder 369657-369683 27 LR794124 Vibrio phage vB_Vc_SrVc9 genome assembly, chromosome: 1 34861-34887 5 0.815
NC_022350_3 3.1|369657|27|NC_022350|CRISPRCasFinder 369657-369683 27 NC_012662 Vibrio phage VP93, complete genome 35301-35327 5 0.815
NC_022350_3 3.7|370053|27|NC_022350|CRISPRCasFinder 370053-370079 27 NZ_CP016084 Streptomyces sp. SAT1 plasmid unnamed4, complete sequence 2189-2215 5 0.815
NC_022350_3 3.7|370053|27|NC_022350|CRISPRCasFinder 370053-370079 27 MN693945 Marine virus AFVG_250M952, complete genome 34909-34935 5 0.815
NC_022350_3 3.10|370263|27|NC_022350|CRISPRCasFinder 370263-370289 27 NZ_CP020899 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence 369429-369455 5 0.815
NC_022350_3 3.10|370263|27|NC_022350|CRISPRCasFinder 370263-370289 27 NZ_CP013525 Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence 338832-338858 5 0.815
NC_022350_3 3.10|370263|27|NC_022350|CRISPRCasFinder 370263-370289 27 NZ_CP013554 Rhizobium phaseoli strain N931 plasmid pRphaN931b, complete sequence 363377-363403 5 0.815
NC_022350_3 3.10|370263|27|NC_022350|CRISPRCasFinder 370263-370289 27 NZ_CP015368 Methylobacterium phyllosphaerae strain CBMB27 plasmid CBMB27-p1, complete sequence 104717-104743 5 0.815
NC_022350_3 3.10|370263|27|NC_022350|CRISPRCasFinder 370263-370289 27 NZ_CP013588 Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence 338543-338569 5 0.815
NC_022350_3 3.10|370263|27|NC_022350|CRISPRCasFinder 370263-370289 27 NZ_CP013560 Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence 340811-340837 5 0.815
NC_022350_3 3.10|370263|27|NC_022350|CRISPRCasFinder 370263-370289 27 NZ_CP013577 Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence 342690-342716 5 0.815
NC_022350_3 3.10|370263|27|NC_022350|CRISPRCasFinder 370263-370289 27 NZ_CP013549 Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence 343060-343086 5 0.815
NC_022350_3 3.10|370263|27|NC_022350|CRISPRCasFinder 370263-370289 27 NZ_CP013529 Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence 355714-355740 5 0.815
NC_022350_3 3.10|370263|27|NC_022350|CRISPRCasFinder 370263-370289 27 NZ_CP013534 Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence 343060-343086 5 0.815
NC_022350_3 3.10|370263|27|NC_022350|CRISPRCasFinder 370263-370289 27 NZ_CP013539 Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence 348335-348361 5 0.815
NC_022350_3 3.10|370263|27|NC_022350|CRISPRCasFinder 370263-370289 27 NZ_CP013545 Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence 343052-343078 5 0.815
NC_022350_3 3.10|370263|27|NC_022350|CRISPRCasFinder 370263-370289 27 NZ_CP020444 Paracoccus yeei strain FDAARGOS_252 plasmid unnamed4, complete sequence 69464-69490 5 0.815
NC_022350_3 3.10|370263|27|NC_022350|CRISPRCasFinder 370263-370289 27 NZ_CP013565 Rhizobium phaseoli strain N831 plasmid pRphaN831b, complete sequence 363377-363403 5 0.815
NC_022350_3 3.10|370263|27|NC_022350|CRISPRCasFinder 370263-370289 27 NZ_CP013582 Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence 355714-355740 5 0.815
NC_022350_3 3.10|370263|27|NC_022350|CRISPRCasFinder 370263-370289 27 NZ_CP013571 Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence 342690-342716 5 0.815
NC_022350_3 3.10|370263|27|NC_022350|CRISPRCasFinder 370263-370289 27 NZ_CP044078 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed1, complete sequence 10340-10366 5 0.815
NC_022350_3 3.10|370263|27|NC_022350|CRISPRCasFinder 370263-370289 27 NZ_CP031081 Paracoccus yeei strain CCUG 32053 plasmid pYEE3, complete sequence 19365-19391 5 0.815
NC_022350_3 3.10|370263|27|NC_022350|CRISPRCasFinder 370263-370289 27 MN586031 Gordonia phage Gambino, complete genome 3053-3079 5 0.815
NC_022350_3 3.10|370263|27|NC_022350|CRISPRCasFinder 370263-370289 27 KU998236 Gordonia phage Blueberry, complete genome 3053-3079 5 0.815
NC_022350_3 3.10|370263|27|NC_022350|CRISPRCasFinder 370263-370289 27 MN062704 Gordonia phage JuJu, complete genome 3063-3089 5 0.815
NC_022350_3 3.10|370263|27|NC_022350|CRISPRCasFinder 370263-370289 27 MK501729 Gordonia phage Walrus, complete genome 3053-3079 5 0.815
NC_022350_3 3.10|370263|27|NC_022350|CRISPRCasFinder 370263-370289 27 NC_031226 Gordonia phage BaxterFox, complete genome 2982-3008 5 0.815
NC_022350_3 3.10|370263|27|NC_022350|CRISPRCasFinder 370263-370289 27 MK967393 Rhodococcus phage Whack, complete genome 3063-3089 5 0.815
NC_022350_3 3.10|370263|27|NC_022350|CRISPRCasFinder 370263-370289 27 MT723935 Gordonia phage Azula, complete genome 3053-3079 5 0.815
NC_022350_3 3.10|370263|27|NC_022350|CRISPRCasFinder 370263-370289 27 KU963249 Gordonia phage Yeezy, complete genome 2982-3008 5 0.815
NC_022350_3 3.10|370263|27|NC_022350|CRISPRCasFinder 370263-370289 27 MH153808 Gordonia phage Petra, complete genome 3053-3079 5 0.815
NC_022350_3 3.10|370263|27|NC_022350|CRISPRCasFinder 370263-370289 27 MT639650 Gordonia phage Ohgeesy, complete genome 2982-3008 5 0.815
NC_022350_3 3.10|370263|27|NC_022350|CRISPRCasFinder 370263-370289 27 MH536818 Gordonia phage Frokostdame, complete genome 3055-3081 5 0.815
NC_022350_3 3.10|370263|27|NC_022350|CRISPRCasFinder 370263-370289 27 KX557275 Gordonia phage CarolAnn, complete genome 3052-3078 5 0.815
NC_022350_5 5.6|930393|27|NC_022350|CRT 930393-930419 27 CP009871 Pantoea sp. PSNIH2 plasmid pPSP-cd6, complete sequence 29372-29398 5 0.815
NC_022350_5 5.6|930393|27|NC_022350|CRT 930393-930419 27 NZ_CP030354 Novosphingobium sp. P6W plasmid pP6W1, complete sequence 406756-406782 5 0.815
NC_022350_5 5.6|930393|27|NC_022350|CRT 930393-930419 27 NZ_CP045223 Achromobacter xylosoxidans strain DN002 plasmid unnamed 110954-110980 5 0.815
NC_022350_5 5.6|930393|27|NC_022350|CRT 930393-930419 27 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 274700-274726 5 0.815
NC_022350_5 5.6|930393|27|NC_022350|CRT 930393-930419 27 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 1370465-1370491 5 0.815
NC_022350_5 5.6|930393|27|NC_022350|CRT 930393-930419 27 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 761910-761936 5 0.815
NC_022350_5 5.6|930393|27|NC_022350|CRT 930393-930419 27 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1027970-1027996 5 0.815
NC_022350_5 5.10|930549|27|NC_022350|CRT 930549-930575 27 NZ_CP022264 Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plA, complete sequence 1800-1826 5 0.815
NC_022350_5 5.10|930549|27|NC_022350|CRT 930549-930575 27 NZ_CP022264 Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plA, complete sequence 136919-136945 5 0.815
NC_022350_5 5.10|930549|27|NC_022350|CRT 930549-930575 27 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 658056-658082 5 0.815
NC_022350_5 5.10|930549|27|NC_022350|CRT 930549-930575 27 NZ_CP015881 Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence 1514868-1514894 5 0.815
NC_022350_5 5.10|930549|27|NC_022350|CRT 930549-930575 27 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 5852040-5852066 5 0.815
NC_022350_5 5.10|930549|27|NC_022350|CRT 930549-930575 27 NZ_CP049908 Hymenobacter sp. HDW8 plasmid p_unnamed1, complete sequence 235006-235032 5 0.815
NC_022350_5 5.10|930549|27|NC_022350|CRT 930549-930575 27 NZ_CP049700 Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2a, complete sequence 263243-263269 5 0.815
NC_022350_5 5.10|930549|27|NC_022350|CRT 930549-930575 27 MH576962 Streptomyces phage Satis, complete genome 95306-95332 5 0.815
NC_022350_5 5.10|930549|27|NC_022350|CRT 930549-930575 27 MK620894 Streptomyces phage Kradal, complete genome 95310-95336 5 0.815
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 1068923-1068952 5 0.833
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP024314 Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence 1739900-1739929 5 0.833
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP013631 Rhizobium sp. N324 plasmid pRspN324a, complete sequence 233389-233418 5 0.833
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP031193 Humibacter sp. BT305 plasmid unnamed1 44938-44967 5 0.833
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP050092 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence 137673-137702 5 0.833
NC_022350_5 5.15|930786|30|NC_022350|CRT 930786-930815 30 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 984252-984281 5 0.833
NC_022350_5 5.15|930786|30|NC_022350|CRT 930786-930815 30 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 1598936-1598965 5 0.833
NC_022350_5 5.15|930786|30|NC_022350|CRT 930786-930815 30 NZ_CP013631 Rhizobium sp. N324 plasmid pRspN324a, complete sequence 233398-233427 5 0.833
NC_022350_5 5.15|930786|30|NC_022350|CRT 930786-930815 30 NZ_CP046705 Nostoc sp. ATCC 53789 plasmid pNsp_b, complete sequence 292905-292934 5 0.833
NC_022350_5 5.15|930786|30|NC_022350|CRT 930786-930815 30 AY950802 Haloarcula phage SH1, complete genome 16104-16133 5 0.833
NC_022350_5 5.16|930834|24|NC_022350|CRT 930834-930857 24 NC_006911 Streptomyces sp. F11 plasmid pFP11, complete sequence 11649-11672 5 0.792
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 MG925349 Mycobacterium phage Mendokysei, complete genome 21052-21085 5 0.853
NC_022350_6 6.4|1217314|25|NC_022350|CRISPRCasFinder 1217314-1217338 25 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 3841167-3841191 5 0.8
NC_022350_6 6.4|1217314|25|NC_022350|CRISPRCasFinder 1217314-1217338 25 NC_015178 Acidiphilium multivorum AIU301 plasmid pACMV1, complete sequence 157500-157524 5 0.8
NC_022350_6 6.4|1217314|25|NC_022350|CRISPRCasFinder 1217314-1217338 25 NZ_CP035002 Rhizobium acidisoli strain FH23 plasmid pRapFH23d, complete sequence 179155-179179 5 0.8
NC_022350_6 6.4|1217314|25|NC_022350|CRISPRCasFinder 1217314-1217338 25 NC_009469 Acidiphilium cryptum JF-5 plasmid pACRY03, complete sequence 67026-67050 5 0.8
NC_022350_7 7.1|1572838|28|NC_022350|CRISPRCasFinder 1572838-1572865 28 NZ_LN907828 Erwinia gerundensis isolate E_g_EM595 plasmid pEM01, complete sequence 94483-94510 5 0.821
NC_022350_7 7.1|1572838|28|NC_022350|CRISPRCasFinder 1572838-1572865 28 KU728633 Mycobacterium phage Bipper, complete genome 41992-42019 5 0.821
NC_022350_7 7.1|1572838|28|NC_022350|CRISPRCasFinder 1572838-1572865 28 MK977701 Mycobacterium phage Cracklewink, complete genome 41985-42012 5 0.821
NC_022350_7 7.1|1572838|28|NC_022350|CRISPRCasFinder 1572838-1572865 28 NZ_CP016354 Prauserella marina strain DSM 45268 plasmid pPmarDSM45268, complete sequence 100320-100347 5 0.821
NC_022350_7 7.5|1573060|25|NC_022350|CRISPRCasFinder 1573060-1573084 25 NZ_CP025013 Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence 614111-614135 5 0.8
NC_022350_7 7.5|1573060|25|NC_022350|CRISPRCasFinder 1573060-1573084 25 NZ_CP020331 Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence 92705-92729 5 0.8
NC_022350_7 7.10|1573453|31|NC_022350|CRISPRCasFinder 1573453-1573483 31 NC_018746 Pseudomonas putida ND6 plasmid pND6-2, complete sequence 45440-45470 5 0.839
NC_022350_7 7.10|1573453|31|NC_022350|CRISPRCasFinder 1573453-1573483 31 MN961671 Pseudomonas aeruginosa strain 201330 plasmid p201330-IMP, complete sequence 123562-123592 5 0.839
NC_022350_7 7.10|1573453|31|NC_022350|CRISPRCasFinder 1573453-1573483 31 MN961672 Pseudomonas aeruginosa strain PA15W plasmid pPA15W-NR, complete sequence 72551-72581 5 0.839
NC_022350_7 7.13|1573702|34|NC_022350|CRISPRCasFinder 1573702-1573735 34 NC_006362 Nocardia farcinica IFM 10152 plasmid pNF1, complete sequence 89410-89443 5 0.853
NC_022350_13 13.7|3736150|31|NC_022350|CRT 3736150-3736180 31 NC_010850 Rhodococcus sp. NS1 plasmid pNSL1, complete sequence 92901-92931 5 0.839
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 NZ_LR134451 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence 56815-56846 5 0.844
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP025613 Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed1, complete sequence 246478-246503 5 0.808
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 CP047389 Agrobacterium sp. CGMCC 11546 plasmid pA 17058-17083 5 0.808
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP010957 Sphingobium sp. YBL2 plasmid 3pYBL2-3, complete sequence 302850-302875 5 0.808
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NC_007713 Sodalis glossinidius str. 'morsitans' plasmid pSG1, complete sequence 40332-40357 5 0.808
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NC_014840 Pantoea sp. At-9b plasmid pPAT9B03, complete sequence 185222-185247 5 0.808
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP032313 Pannonibacter phragmitetus BB plasmid p.BB_1, complete sequence 273411-273436 5 0.808
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 1105172-1105197 5 0.808
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_LN854558 Sodalis glossinidius str. 'morsitans' isolate B4 plasmid pSG1, complete sequence 47773-47798 5 0.808
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_LT960615 Hartmannibacter diazotrophicus strain E19T plasmid HDIAp1, complete sequence 107625-107650 5 0.808
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 1814495-1814520 5 0.808
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NC_013859 Azospirillum sp. B510 plasmid pAB510e, complete sequence 534058-534083 5 0.808
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NC_007182 Sodalis glossinidius pSG1 plasmid from Glossina austeni 10951-10976 5 0.808
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NC_007183 Sodalis glossinidius pSG1 plasmid from Glossina palpalis palpalis 10951-10976 5 0.808
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 132825-132850 5 0.808
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_AP022338 Mameliella alba strain KU6B plasmid pKUB257, complete sequence 78756-78781 5 0.808
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP041045 Paracoccus sp. AK26 plasmid pAK1, complete sequence 382698-382723 5 0.808
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NC_042098 Erwinia phage vB_EamM_Desertfox, complete genome 125763-125788 5 0.808
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 MG655267 Erwinia phage vB_EamM_Bosolaphorus, complete genome 125662-125687 5 0.808
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 MG655269 Erwinia phage vB_EamM_MadMel, complete genome 125987-126012 5 0.808
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 KF806589 Erwinia phage Ea35-70, complete genome 124060-124085 5 0.808
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 KU886223 Erwinia phage vB_EamM_Simmy50, complete genome 124357-124382 5 0.808
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP032324 Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence 261363-261388 5 0.808
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP009975 Pseudomonas putida S12 plasmid pTTS12, complete sequence 508038-508063 5 0.808
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP045381 Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence 258385-258410 5 0.808
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP007797 Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence 413351-413376 5 0.808
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP023549 Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence 97021-97046 5 0.808
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP010860 Marinovum algicola DG 898 plasmid pMaD5, complete sequence 5769-5794 5 0.808
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP012917 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence 595763-595788 5 0.808
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 AY129335 Mycobacterium virus Corndog, complete genome 30054-30079 5 0.808
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NC_004685 Mycobacterium phage Corndog, complete genome 30054-30079 5 0.808
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 MG099943 Mycobacterium phage Familton, complete genome 28996-29021 5 0.808
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 MN585964 Mycobacterium phage Blessica, complete genome 29303-29328 5 0.808
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 KJ829260 Mycobacterium phage YungJamal, complete genome 29902-29927 5 0.808
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NC_022057 Mycobacterium phage Catdawg, complete genome 28992-29017 5 0.808
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 MN428052 Mycobacterium phage Smooch, complete genome 30725-30750 5 0.808
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NC_048047 Caulobacter phage CcrBL9, complete genome 102705-102730 5 0.808
NC_022350_2 2.8|341396|27|NC_022350|CRT 341396-341422 27 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 427724-427750 6 0.778
NC_022350_2 2.8|341396|27|NC_022350|CRT 341396-341422 27 NZ_CP042263 Litoreibacter sp. LN3S51 plasmid unnamed2, complete sequence 303859-303885 6 0.778
NC_022350_2 2.8|341396|27|NC_022350|CRT 341396-341422 27 NZ_CP024423 Paracoccus yeei strain TT13 plasmid pTT13-1, complete sequence 124562-124588 6 0.778
NC_022350_2 2.8|341396|27|NC_022350|CRT 341396-341422 27 NZ_CP014964 Geobacter anodireducens strain SD-1 plasmid pSD, complete sequence 92231-92257 6 0.778
NC_022350_2 2.8|341396|27|NC_022350|CRT 341396-341422 27 NZ_CP022369 Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence 100002-100028 6 0.778
NC_022350_2 2.8|341396|27|NC_022350|CRT 341396-341422 27 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 540179-540205 6 0.778
NC_022350_2 2.9|341441|30|NC_022350|CRT 341441-341470 30 NZ_CP010863 Marinovum algicola DG 898 plasmid pMaD8, complete sequence 55738-55767 6 0.8
NC_022350_2 2.14|341741|27|NC_022350|CRT 341741-341767 27 NZ_CP050082 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b4, complete sequence 215822-215848 6 0.778
NC_022350_2 2.14|341741|27|NC_022350|CRT 341741-341767 27 NZ_CP015090 Pelagibaca abyssi strain JLT2014 plasmid pPABY2, complete sequence 43752-43778 6 0.778
NC_022350_2 2.14|341741|27|NC_022350|CRT 341741-341767 27 NZ_CP049732 Rhizobium leguminosarum strain A1 plasmid pRL11, complete sequence 173549-173575 6 0.778
NC_022350_2 2.14|341741|27|NC_022350|CRT 341741-341767 27 NZ_CP022317 Brachybacterium avium strain VR2415 plasmid unnamed1 27528-27554 6 0.778
NC_022350_2 2.14|341741|27|NC_022350|CRT 341741-341767 27 NC_013857 Azospirillum sp. B510 plasmid pAB510c, complete sequence 197224-197250 6 0.778
NC_022350_2 2.14|341741|27|NC_022350|CRT 341741-341767 27 NZ_CP023549 Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence 455136-455162 6 0.778
NC_022350_2 2.14|341741|27|NC_022350|CRT 341741-341767 27 NZ_AP014579 Burkholderia sp. RPE67 plasmid p1, complete sequence 54670-54696 6 0.778
NC_022350_2 2.14|341741|27|NC_022350|CRT 341741-341767 27 NZ_AP022319 Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence 1356084-1356110 6 0.778
NC_022350_2 2.14|341741|27|NC_022350|CRT 341741-341767 27 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 1344720-1344746 6 0.778
NC_022350_2 2.14|341741|27|NC_022350|CRT 341741-341767 27 NZ_CP046573 Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence 866924-866950 6 0.778
NC_022350_2 2.14|341741|27|NC_022350|CRT 341741-341767 27 NZ_CP025550 Mycobacterium paragordonae strain 49061 plasmid unnamed4, complete sequence 12975-13001 6 0.778
NC_022350_2 2.14|341741|27|NC_022350|CRT 341741-341767 27 NZ_CP016619 Microvirga ossetica strain V5/3m plasmid unnamed2, complete sequence 949509-949535 6 0.778
NC_022350_3 3.1|369657|27|NC_022350|CRISPRCasFinder 369657-369683 27 NZ_CP045917 Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence 207335-207361 6 0.778
NC_022350_3 3.6|369987|33|NC_022350|CRISPRCasFinder 369987-370019 33 NZ_CP010410 Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence 435770-435802 6 0.818
NC_022350_3 3.7|370053|27|NC_022350|CRISPRCasFinder 370053-370079 27 NZ_CP022542 Antarctobacter heliothermus strain SMS3 plasmid pSMS3-2, complete sequence 32942-32968 6 0.778
NC_022350_3 3.9|370203|27|NC_022350|CRISPRCasFinder 370203-370229 27 NC_009959 Dinoroseobacter shibae DFL 12 = DSM 16493 plasmid pDSHI05, complete sequence 50750-50776 6 0.778
NC_022350_3 3.10|370263|27|NC_022350|CRISPRCasFinder 370263-370289 27 NZ_CP009112 Rhodococcus opacus strain 1CP plasmid pR1CP1, complete sequence 179708-179734 6 0.778
NC_022350_3 3.10|370263|27|NC_022350|CRISPRCasFinder 370263-370289 27 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4846911-4846937 6 0.778
NC_022350_3 3.10|370263|27|NC_022350|CRISPRCasFinder 370263-370289 27 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 78863-78889 6 0.778
NC_022350_3 3.10|370263|27|NC_022350|CRISPRCasFinder 370263-370289 27 MK494099 Mycobacterium phage Typha, complete genome 33831-33857 6 0.778
NC_022350_4 4.1|696509|31|NC_022350|CRISPRCasFinder 696509-696539 31 GQ141189 Bifidobacterium phage Bbif-1, complete sequence 38062-38092 6 0.806
NC_022350_5 5.6|930393|27|NC_022350|CRT 930393-930419 27 NZ_LN907829 Erwinia gerundensis isolate E_g_EM595 plasmid pEM02, complete sequence 65197-65223 6 0.778
NC_022350_5 5.6|930393|27|NC_022350|CRT 930393-930419 27 NZ_CP041653 Streptomyces sp. RLB1-9 plasmid pRLB1-9.1, complete sequence 99569-99595 6 0.778
NC_022350_5 5.6|930393|27|NC_022350|CRT 930393-930419 27 NZ_CP010826 Thermus aquaticus Y51MC23 plasmid pTA78, complete sequence 43689-43715 6 0.778
NC_022350_5 5.6|930393|27|NC_022350|CRT 930393-930419 27 NZ_CP054620 Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence 122394-122420 6 0.778
NC_022350_5 5.10|930549|27|NC_022350|CRT 930549-930575 27 NZ_AP021845 Azospira sp. I09 plasmid pAZI09, complete sequence 147990-148016 6 0.778
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP040820 Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence 508-537 6 0.8
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP040820 Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence 280809-280838 6 0.8
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 561652-561681 6 0.8
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP050083 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence 554428-554457 6 0.8
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP049733 Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence 542116-542145 6 0.8
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 610786-610815 6 0.8
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP053207 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence 571170-571199 6 0.8
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP015881 Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence 1563589-1563618 6 0.8
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP030127 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence 421135-421164 6 0.8
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 1217050-1217079 6 0.8
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 1265979-1266008 6 0.8
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 1135414-1135443 6 0.8
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP037868 Hydrogenophaga pseudoflava strain DSM 1084 plasmid pDSM1084, complete sequence 5790-5819 6 0.8
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 1195134-1195163 6 0.8
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 1134511-1134540 6 0.8
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP023549 Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence 762260-762289 6 0.8
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 1168711-1168740 6 0.8
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 1168700-1168729 6 0.8
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 1135406-1135435 6 0.8
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 1134762-1134791 6 0.8
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 1135397-1135426 6 0.8
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 1217165-1217194 6 0.8
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 1217149-1217178 6 0.8
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 1217142-1217171 6 0.8
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NC_019408 Caulobacter phage CcrRogue, complete genome 180466-180495 6 0.8
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 174181-174210 6 0.8
NC_022350_5 5.15|930786|30|NC_022350|CRT 930786-930815 30 NZ_CP017941 Phyllobacterium zundukense strain Tri-48 plasmid unnamed1, complete sequence 270228-270257 6 0.8
NC_022350_5 5.15|930786|30|NC_022350|CRT 930786-930815 30 MK937608 Microbacterium phage Cressida, complete genome 54022-54051 6 0.8
NC_022350_5 5.15|930786|30|NC_022350|CRT 930786-930815 30 NZ_CP050083 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence 554437-554466 6 0.8
NC_022350_5 5.15|930786|30|NC_022350|CRT 930786-930815 30 NZ_CP049733 Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence 542125-542154 6 0.8
NC_022350_5 5.15|930786|30|NC_022350|CRT 930786-930815 30 NZ_CP017592 Pantoea stewartii subsp. stewartii DC283 plasmid ppDSJ01, complete sequence 7337-7366 6 0.8
NC_022350_5 5.15|930786|30|NC_022350|CRT 930786-930815 30 NZ_CP008898 Enterobacter hormaechei subsp. hoffmannii ECNIH3 plasmid pENT-576, complete sequence 43955-43984 6 0.8
NC_022350_5 5.15|930786|30|NC_022350|CRT 930786-930815 30 NZ_CP023489 Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_02, complete sequence 73653-73682 6 0.8
NC_022350_5 5.15|930786|30|NC_022350|CRT 930786-930815 30 NZ_CP043515 Enterobacter kobei strain EB_P8_L5_01.19 plasmid unnamed4, complete sequence 36331-36360 6 0.8
NC_022350_5 5.15|930786|30|NC_022350|CRT 930786-930815 30 NZ_CP053207 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence 571179-571208 6 0.8
NC_022350_5 5.15|930786|30|NC_022350|CRT 930786-930815 30 NZ_LT984809 Cupriavidus taiwanensis isolate Cupriavidus taiwanensis STM 8555 plasmid I, complete sequence 317155-317184 6 0.8
NC_022350_5 5.15|930786|30|NC_022350|CRT 930786-930815 30 NZ_CP026371 Klebsiella quasipneumoniae strain A708 plasmid pA708-3, complete sequence 116386-116415 6 0.8
NC_022350_5 5.15|930786|30|NC_022350|CRT 930786-930815 30 NZ_CP050069 Klebsiella aerogenes strain 035 plasmid p035_A-VIM-1, complete sequence 79588-79617 6 0.8
NC_022350_5 5.15|930786|30|NC_022350|CRT 930786-930815 30 NZ_CP039425 Citricoccus sp. SGAir0253 plasmid unnamed1, complete sequence 132572-132601 6 0.8
NC_022350_5 5.15|930786|30|NC_022350|CRT 930786-930815 30 NZ_CP009856 UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH5 plasmid pENT-784, complete sequence 26128-26157 6 0.8
NC_022350_5 5.15|930786|30|NC_022350|CRT 930786-930815 30 NZ_CP039430 Citricoccus sp. SGAir0453 plasmid unnamed1, complete sequence 132570-132599 6 0.8
NC_022350_5 5.15|930786|30|NC_022350|CRT 930786-930815 30 NZ_CP040937 Hymenobacter sp. DG01 plasmid unnamed, complete sequence 32030-32059 6 0.8
NC_022350_5 5.15|930786|30|NC_022350|CRT 930786-930815 30 NZ_CP024310 Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence 14031-14060 6 0.8
NC_022350_5 5.15|930786|30|NC_022350|CRT 930786-930815 30 NZ_CP023064 Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence 17715-17744 6 0.8
NC_022350_5 5.15|930786|30|NC_022350|CRT 930786-930815 30 NZ_CP006588 Hymenobacter sp. APR13 plasmid pHA, complete sequence 19031-19060 6 0.8
NC_022350_5 5.15|930786|30|NC_022350|CRT 930786-930815 30 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1930897-1930926 6 0.8
NC_022350_5 5.15|930786|30|NC_022350|CRT 930786-930815 30 NZ_AP022333 Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence 190353-190382 6 0.8
NC_022350_5 5.15|930786|30|NC_022350|CRT 930786-930815 30 MH029534 Myoviridae environmental samples clone NHS-Seq2, complete sequence 34123-34152 6 0.8
NC_022350_5 5.17|930876|36|NC_022350|CRT 930876-930911 36 MT723940 Mycobacterium phage Ellie, complete genome 24126-24161 6 0.833
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 3466597-3466630 6 0.824
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2210883-2210916 6 0.824
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NC_019957 Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence 283764-283797 6 0.824
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_AP022319 Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence 445248-445281 6 0.824
NC_022350_7 7.1|1572838|28|NC_022350|CRISPRCasFinder 1572838-1572865 28 NZ_AP022571 Mycolicibacterium poriferae strain JCM 12603 plasmid pJCM12603, complete sequence 39276-39303 6 0.786
NC_022350_7 7.1|1572838|28|NC_022350|CRISPRCasFinder 1572838-1572865 28 NC_008703 Mycobacterium sp. KMS plasmid pMKMS01, complete sequence 76834-76861 6 0.786
NC_022350_7 7.1|1572838|28|NC_022350|CRISPRCasFinder 1572838-1572865 28 NZ_LR594663 Variovorax sp. RA8 plasmid 2 131793-131820 6 0.786
NC_022350_7 7.10|1573453|31|NC_022350|CRISPRCasFinder 1573453-1573483 31 NZ_LR594669 Variovorax sp. SRS16 plasmid 4 27764-27794 6 0.806
NC_022350_7 7.10|1573453|31|NC_022350|CRISPRCasFinder 1573453-1573483 31 NZ_LR594673 Variovorax sp. PBL-E5 plasmid 3 438646-438676 6 0.806
NC_022350_7 7.13|1573702|34|NC_022350|CRISPRCasFinder 1573702-1573735 34 NZ_CP044425 Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence 28989-29022 6 0.824
NC_022350_13 13.7|3736150|31|NC_022350|CRT 3736150-3736180 31 NC_009478 Clavibacter michiganensis subsp. michiganensis NCPPB 382 plasmid pCM1, complete sequence 8328-8358 6 0.806
NC_022350_14 14.12|3930108|30|NC_022350|CRT 3930108-3930137 30 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 5232057-5232086 6 0.8
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 NC_013857 Azospirillum sp. B510 plasmid pAB510c, complete sequence 258107-258138 6 0.812
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NC_008271 Rhodococcus jostii RHA1 plasmid pRHL3, complete sequence 99581-99606 6 0.769
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 262599-262624 6 0.769
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP013528 Rhizobium phaseoli strain R723 plasmid pRphaR723a, complete sequence 328914-328939 6 0.769
NC_022350_15 15.11|3946672|26|NC_022350|CRT 3946672-3946697 26 NZ_CP013581 Rhizobium phaseoli strain N261 plasmid pRphaN261a, complete sequence 328917-328942 6 0.769
NC_022350_2 2.8|341396|27|NC_022350|CRT 341396-341422 27 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 1822872-1822898 7 0.741
NC_022350_2 2.14|341741|27|NC_022350|CRT 341741-341767 27 MT740732 Ralstonia phage Darius, complete genome 41821-41847 7 0.741
NC_022350_2 2.14|341741|27|NC_022350|CRT 341741-341767 27 MT740740 Ralstonia phage Gervaise, complete genome 7565-7591 7 0.741
NC_022350_2 2.14|341741|27|NC_022350|CRT 341741-341767 27 MH638294 Ralstonia phage GP4, complete genome 1907-1933 7 0.741
NC_022350_3 3.4|369852|27|NC_022350|CRISPRCasFinder 369852-369878 27 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 48081-48107 7 0.741
NC_022350_4 4.1|696509|31|NC_022350|CRISPRCasFinder 696509-696539 31 MK977708 Mycobacterium phage Fulbright, complete genome 10281-10311 7 0.774
NC_022350_4 4.1|696509|31|NC_022350|CRISPRCasFinder 696509-696539 31 MG099948 Mycobacterium phage Philonius, complete genome 10281-10311 7 0.774
NC_022350_4 4.1|696509|31|NC_022350|CRISPRCasFinder 696509-696539 31 MH926055 Mycobacterium phage Chewbacca, complete genome 10281-10311 7 0.774
NC_022350_4 4.1|696509|31|NC_022350|CRISPRCasFinder 696509-696539 31 MT723932 Mycobacterium phage Schnauzer, complete genome 10281-10311 7 0.774
NC_022350_4 4.1|696509|31|NC_022350|CRISPRCasFinder 696509-696539 31 KU935726 Mycobacterium phage Xerxes, complete genome 10281-10311 7 0.774
NC_022350_4 4.1|696509|31|NC_022350|CRISPRCasFinder 696509-696539 31 KU935730 Mycobacterium phage Pipsqueaks, complete genome 10281-10311 7 0.774
NC_022350_4 4.1|696509|31|NC_022350|CRISPRCasFinder 696509-696539 31 MH316570 Mycobacterium phage Silvafighter, complete genome 10281-10311 7 0.774
NC_022350_4 4.1|696509|31|NC_022350|CRISPRCasFinder 696509-696539 31 MK524518 Mycobacterium phage Smurph, complete genome 10281-10311 7 0.774
NC_022350_4 4.1|696509|31|NC_022350|CRISPRCasFinder 696509-696539 31 MK524515 Mycobacterium phage Parmesanjohn, complete genome 10281-10311 7 0.774
NC_022350_4 4.1|696509|31|NC_022350|CRISPRCasFinder 696509-696539 31 MH697585 Mycobacterium phage Gex, complete genome 10280-10310 7 0.774
NC_022350_4 4.1|696509|31|NC_022350|CRISPRCasFinder 696509-696539 31 KM588359 Mycobacterium phage Carcharodon, complete genome 10281-10311 7 0.774
NC_022350_4 4.1|696509|31|NC_022350|CRISPRCasFinder 696509-696539 31 MH697576 Mycobacterium phage Aggie, complete genome 10282-10312 7 0.774
NC_022350_4 4.1|696509|31|NC_022350|CRISPRCasFinder 696509-696539 31 MH697593 Mycobacterium phage Tapioca, complete genome 10281-10311 7 0.774
NC_022350_4 4.1|696509|31|NC_022350|CRISPRCasFinder 696509-696539 31 MG099936 Mycobacterium phage Andies, complete genome 10281-10311 7 0.774
NC_022350_4 4.1|696509|31|NC_022350|CRISPRCasFinder 696509-696539 31 NC_031243 Mycobacterium phage Xeno, complete genome 10281-10311 7 0.774
NC_022350_4 4.1|696509|31|NC_022350|CRISPRCasFinder 696509-696539 31 JN256079 Mycobacterium phage Charlie, complete genome 10281-10311 7 0.774
NC_022350_5 5.6|930393|27|NC_022350|CRT 930393-930419 27 NZ_CP010614 Phaeobacter inhibens strain P92 plasmid pP92_d, complete sequence 8847-8873 7 0.741
NC_022350_5 5.6|930393|27|NC_022350|CRT 930393-930419 27 NZ_CP010626 Phaeobacter inhibens strain P51 plasmid pP51_c, complete sequence 8847-8873 7 0.741
NC_022350_5 5.6|930393|27|NC_022350|CRT 930393-930419 27 NZ_CP010671 Phaeobacter inhibens strain P57 plasmid pP57_c, complete sequence 8847-8873 7 0.741
NC_022350_5 5.6|930393|27|NC_022350|CRT 930393-930419 27 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 191833-191859 7 0.741
NC_022350_5 5.6|930393|27|NC_022350|CRT 930393-930419 27 NZ_CP010598 Phaeobacter inhibens strain P10 plasmid pP10_c, complete sequence 8865-8891 7 0.741
NC_022350_5 5.6|930393|27|NC_022350|CRT 930393-930419 27 NC_018288 Phaeobacter inhibens DSM 17395 plasmid pPGA1_65, complete sequence 57481-57507 7 0.741
NC_022350_5 5.6|930393|27|NC_022350|CRT 930393-930419 27 NZ_CP031955 Phaeobacter inhibens strain 2.10 plasmid unnamed3, complete sequence 62982-63008 7 0.741
NC_022350_5 5.6|930393|27|NC_022350|CRT 930393-930419 27 NZ_CP016368 Phaeobacter porticola strain P97 plasmid pP97_d, complete sequence 8876-8902 7 0.741
NC_022350_5 5.6|930393|27|NC_022350|CRT 930393-930419 27 NC_018422 Phaeobacter inhibens 2.10 plasmid pPGA2_71, complete sequence 62746-62772 7 0.741
NC_022350_5 5.6|930393|27|NC_022350|CRT 930393-930419 27 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 195710-195736 7 0.741
NC_022350_5 5.6|930393|27|NC_022350|CRT 930393-930419 27 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 195702-195728 7 0.741
NC_022350_5 5.6|930393|27|NC_022350|CRT 930393-930419 27 NZ_CP010605 Phaeobacter inhibens strain P83 plasmid pP83_f, complete sequence 8848-8874 7 0.741
NC_022350_5 5.6|930393|27|NC_022350|CRT 930393-930419 27 NZ_CP010744 Phaeobacter inhibens strain P59 plasmid pP59_c, complete sequence 8847-8873 7 0.741
NC_022350_5 5.6|930393|27|NC_022350|CRT 930393-930419 27 NZ_CP010622 Phaeobacter inhibens strain P30 isolate M4-3.1A plasmid pP30_e, complete sequence 8847-8873 7 0.741
NC_022350_5 5.6|930393|27|NC_022350|CRT 930393-930419 27 NZ_CP010732 Phaeobacter inhibens strain P88 plasmid pP88_g, complete sequence 8836-8862 7 0.741
NC_022350_5 5.6|930393|27|NC_022350|CRT 930393-930419 27 NZ_CP010655 Phaeobacter inhibens strain P54 plasmid pP54_e, complete sequence 8835-8861 7 0.741
NC_022350_5 5.6|930393|27|NC_022350|CRT 930393-930419 27 NZ_CP010711 Phaeobacter inhibens strain P66 plasmid pP66_f, complete sequence 8848-8874 7 0.741
NC_022350_5 5.6|930393|27|NC_022350|CRT 930393-930419 27 NZ_CP010702 Phaeobacter inhibens strain P24 plasmid pP24_f, complete sequence 8847-8873 7 0.741
NC_022350_5 5.6|930393|27|NC_022350|CRT 930393-930419 27 NZ_CP010748 Phaeobacter inhibens strain P48 isolate M21-2.3 plasmid pP48_c, complete sequence 8847-8873 7 0.741
NC_022350_5 5.6|930393|27|NC_022350|CRT 930393-930419 27 NZ_CP010739 Phaeobacter inhibens strain P72 plasmid pP72_d, complete sequence 8824-8850 7 0.741
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NC_012811 Methylorubrum extorquens AM1 megaplasmid, complete sequence 943873-943902 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 392100-392129 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 1838430-1838459 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 616186-616215 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 397449-397478 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 1703655-1703684 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP022363 Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence 212329-212358 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 679499-679528 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 1744018-1744047 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 1760732-1760761 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 178925-178954 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 75369-75398 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 153012-153041 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NC_013856 Azospirillum sp. B510 plasmid pAB510b, complete sequence 589998-590027 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP010410 Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence 81538-81567 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 845884-845913 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 258296-258325 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 1723933-1723962 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 1859622-1859651 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 1841724-1841753 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 1841724-1841753 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 137321-137350 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 258496-258525 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 257917-257946 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 234345-234374 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 461507-461536 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 254201-254230 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 236985-237014 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 298368-298397 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 258487-258516 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 461579-461608 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 390422-390451 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 1964821-1964850 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 461516-461545 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 237930-237959 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 849014-849043 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 1227007-1227036 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 238244-238273 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP022773 Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence 245279-245308 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 235437-235466 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 126762-126791 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 234570-234599 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 251053-251082 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 258309-258338 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 231309-231338 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 235690-235719 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 238261-238290 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 251053-251082 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 252665-252694 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 236955-236984 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 251052-251081 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 298440-298469 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 230351-230380 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 252665-252694 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 236955-236984 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 461938-461967 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 251053-251082 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 252665-252694 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 CP047137 Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence 438995-439024 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 230352-230381 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 252665-252694 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 236955-236984 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 236955-236984 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 236955-236984 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 251053-251082 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 251053-251082 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 230352-230381 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 245262-245291 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 245236-245265 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 241864-241893 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 240004-240033 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 235466-235495 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 251053-251082 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 230352-230381 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 252665-252694 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 280525-280554 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 251050-251079 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 230352-230381 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 230352-230381 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 251053-251082 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 236955-236984 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 251053-251082 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 251053-251082 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 HM560026 Uncultured bacterium plasmid pTRACA45, complete sequence 1764-1793 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NC_010867 Neisseria lactamica plasmid pNL3.1, complete sequence 3216-3245 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP020471 Rhodobacter blasticus strain 28/5 plasmid pRsa, complete sequence 121720-121749 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 535160-535189 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP032349 Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence 326858-326887 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP035710 Sphaerotilus natans subsp. sulfidivorans strain D-507 plasmid pSna507_unt10, complete sequence 121664-121693 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 KT997827 Uncultured Mediterranean phage uvDeep-CGR0-KM15-C219, complete genome 28429-28458 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 AP021850 Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome 235977-236006 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NC_020062 Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence 1424992-1425021 7 0.767
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 KT997829 Uncultured Mediterranean phage uvDeep-CGR0-KM22-C158, complete genome 24686-24715 7 0.767
NC_022350_5 5.15|930786|30|NC_022350|CRT 930786-930815 30 NZ_CP013634 Rhizobium sp. N324 plasmid pRspN324d, complete sequence 278785-278814 7 0.767
NC_022350_5 5.15|930786|30|NC_022350|CRT 930786-930815 30 NZ_CP035001 Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence 113824-113853 7 0.767
NC_022350_5 5.15|930786|30|NC_022350|CRT 930786-930815 30 NZ_CP040820 Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence 158849-158878 7 0.767
NC_022350_5 5.15|930786|30|NC_022350|CRT 930786-930815 30 NC_007765 Rhizobium etli CFN 42 plasmid p42e, complete sequence 384914-384943 7 0.767
NC_022350_5 5.15|930786|30|NC_022350|CRT 930786-930815 30 NZ_CP006989 Rhizobium sp. IE4771 plasmid pRetIE4771c, complete sequence 317121-317150 7 0.767
NC_022350_5 5.15|930786|30|NC_022350|CRT 930786-930815 30 NZ_CP020909 Rhizobium etli strain NXC12 plasmid pRetNXC12c, complete sequence 385410-385439 7 0.767
NC_022350_5 5.15|930786|30|NC_022350|CRT 930786-930815 30 NZ_CP024423 Paracoccus yeei strain TT13 plasmid pTT13-1, complete sequence 260932-260961 7 0.767
NC_022350_5 5.15|930786|30|NC_022350|CRT 930786-930815 30 NZ_CP020951 Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence 329309-329338 7 0.767
NC_022350_5 5.15|930786|30|NC_022350|CRT 930786-930815 30 NC_021908 Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1d, complete sequence 391416-391445 7 0.767
NC_022350_5 5.15|930786|30|NC_022350|CRT 930786-930815 30 NZ_CP020441 Paracoccus yeei strain FDAARGOS_252 plasmid unnamed1, complete sequence 243975-244004 7 0.767
NC_022350_5 5.15|930786|30|NC_022350|CRT 930786-930815 30 CP007642 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803a, complete sequence 301676-301705 7 0.767
NC_022350_5 5.15|930786|30|NC_022350|CRT 930786-930815 30 NZ_CP044080 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence 201076-201105 7 0.767
NC_022350_5 5.15|930786|30|NC_022350|CRT 930786-930815 30 NZ_CP019484 Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence 635292-635321 7 0.767
NC_022350_5 5.15|930786|30|NC_022350|CRT 930786-930815 30 NZ_CP019487 Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence 422833-422862 7 0.767
NC_022350_5 5.15|930786|30|NC_022350|CRT 930786-930815 30 LN997843 Streptomyces reticuli genome assembly TUE45, plasmid : II 494408-494437 7 0.767
NC_022350_5 5.15|930786|30|NC_022350|CRT 930786-930815 30 MN582086 Siphoviridae sp. ctdEk19, complete genome 33318-33347 7 0.767
NC_022350_5 5.15|930786|30|NC_022350|CRT 930786-930815 30 NC_017323 Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence 864583-864612 7 0.767
NC_022350_5 5.15|930786|30|NC_022350|CRT 930786-930815 30 NZ_CP022700 Acetobacter tropicalis strain BDGP1 plasmid pAtBDGP1A, complete sequence 61493-61522 7 0.767
NC_022350_5 5.15|930786|30|NC_022350|CRT 930786-930815 30 NZ_CP009146 Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence 1238691-1238720 7 0.767
NC_022350_5 5.15|930786|30|NC_022350|CRT 930786-930815 30 NZ_CP021831 Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence 1484042-1484071 7 0.767
NC_022350_5 5.15|930786|30|NC_022350|CRT 930786-930815 30 NZ_CP021218 Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence 1466967-1466996 7 0.767
NC_022350_5 5.15|930786|30|NC_022350|CRT 930786-930815 30 NZ_CP031082 Paracoccus yeei strain CCUG 32053 plasmid pYEE4, complete sequence 119508-119537 7 0.767
NC_022350_5 5.17|930876|36|NC_022350|CRT 930876-930911 36 NC_022087 Mycobacterium phage AnnaL29, complete genome 5558-5593 7 0.806
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2210628-2210661 7 0.794
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2209827-2209860 7 0.794
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP025548 Mycobacterium paragordonae strain 49061 plasmid unnamed2, complete sequence 24930-24963 7 0.794
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 2133215-2133248 7 0.794
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 MT889380 Mycobacterium phage Coco12, complete genome 22836-22869 7 0.794
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 MT114167 Mycobacterium phage Phanphagia, complete genome 22491-22524 7 0.794
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP020331 Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence 531146-531179 7 0.794
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP039644 Azospirillum sp. TSA2s plasmid p2, complete sequence 117310-117343 7 0.794
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 254574-254607 7 0.794
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP039641 Azospirillum sp. TSH100 plasmid p2, complete sequence 30914-30947 7 0.794
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 MH697583 Mycobacterium phage EricMillard, complete genome 32257-32290 7 0.794
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 MH727551 Mycobacterium phage Kalah2, complete genome 32307-32340 7 0.794
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 MH077579 Mycobacterium phage Halley, complete genome 31970-32003 7 0.794
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 MH669017 Mycobacterium phage Zelink, complete genome 33051-33084 7 0.794
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 MN062701 Mycobacterium phage Dallas, complete genome 31496-31529 7 0.794
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 MK524527 Mycobacterium phage ThreeRngTarjay, complete genome 32107-32140 7 0.794
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 MK524529 Mycobacterium phage Phoebus, complete genome 32257-32290 7 0.794
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 MF919512 Mycobacterium phage Klein, complete genome 31531-31564 7 0.794
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 KF114875 Mycobacterium phage Redno2, complete genome 31720-31753 7 0.794
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 MK967379 Mycobacterium phage HokkenD, complete genome 31519-31552 7 0.794
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP025513 Neorhizobium sp. SOG26 plasmid unnamed2, complete sequence 307986-308019 7 0.794
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_LR134450 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 8, complete sequence 178492-178525 7 0.794
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NC_005241 Cupriavidus necator H16 megaplasmid pHG1, complete sequence 275379-275412 7 0.794
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_AP022319 Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence 445383-445416 7 0.794
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP039289 Cupriavidus necator H16 plasmid pHG1, complete sequence 275378-275411 7 0.794
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 MN813686 Mycobacterium phage BirdsNest, complete genome 30327-30360 7 0.794
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NC_042035 Mycobacterium phage Zemanar, complete sequence 31516-31549 7 0.794
NC_022350_6 6.9|1217578|37|NC_022350|CRISPRCasFinder 1217578-1217614 37 NZ_CP013855 Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence 136890-136926 7 0.811
NC_022350_7 7.1|1572838|28|NC_022350|CRISPRCasFinder 1572838-1572865 28 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 259627-259654 7 0.75
NC_022350_7 7.10|1573453|31|NC_022350|CRISPRCasFinder 1573453-1573483 31 NZ_CP041045 Paracoccus sp. AK26 plasmid pAK1, complete sequence 281800-281830 7 0.774
NC_022350_7 7.10|1573453|31|NC_022350|CRISPRCasFinder 1573453-1573483 31 CP017041 Propionibacterium sp. oral taxon 193 strain F0672 plasmid unnamed1, complete sequence 68407-68437 7 0.774
NC_022350_8 8.3|2087658|30|NC_022350|CRT 2087658-2087687 30 NZ_CP015065 Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence 52187-52216 7 0.767
NC_022350_8 8.3|2087658|30|NC_022350|CRT 2087658-2087687 30 NZ_CP015063 Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence 75140-75169 7 0.767
NC_022350_8 8.3|2087658|30|NC_022350|CRT 2087658-2087687 30 NC_014918 Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence 376489-376518 7 0.767
NC_022350_13 13.7|3736150|31|NC_022350|CRT 3736150-3736180 31 NZ_CP010990 Pseudonocardia sp. EC080625-04 plasmid pFRP1-1, complete sequence 147567-147597 7 0.774
NC_022350_13 13.7|3736150|31|NC_022350|CRT 3736150-3736180 31 NZ_CP012186 Pseudonocardia sp. EC080619-01 plasmid pBCI1-1, complete sequence 36995-37025 7 0.774
NC_022350_13 13.7|3736150|31|NC_022350|CRT 3736150-3736180 31 NZ_CP042263 Litoreibacter sp. LN3S51 plasmid unnamed2, complete sequence 372247-372277 7 0.774
NC_022350_14 14.12|3930108|30|NC_022350|CRT 3930108-3930137 30 NZ_CP054028 Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence 1166919-1166948 7 0.767
NC_022350_15 15.3|3945994|35|NC_022350|CRT 3945994-3946028 35 NZ_CP025547 Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence 261174-261208 7 0.8
NC_022350_15 15.3|3945994|35|NC_022350|CRT 3945994-3946028 35 NZ_CP005085 Sphingobium sp. TKS plasmid pTK1, complete sequence 306649-306683 7 0.8
NC_022350_15 15.3|3945994|35|NC_022350|CRT 3945994-3946028 35 NC_003078 Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence 1085516-1085550 7 0.8
NC_022350_15 15.3|3945994|35|NC_022350|CRT 3945994-3946028 35 NZ_CP021799 Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence 1151738-1151772 7 0.8
NC_022350_15 15.3|3945994|35|NC_022350|CRT 3945994-3946028 35 NZ_CP021806 Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence 373508-373542 7 0.8
NC_022350_15 15.3|3945994|35|NC_022350|CRT 3945994-3946028 35 NC_020560 Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence 1085521-1085555 7 0.8
NC_022350_15 15.3|3945994|35|NC_022350|CRT 3945994-3946028 35 NC_018701 Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence 634105-634139 7 0.8
NC_022350_15 15.3|3945994|35|NC_022350|CRT 3945994-3946028 35 NZ_CP021802 Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence 1302033-1302067 7 0.8
NC_022350_15 15.3|3945994|35|NC_022350|CRT 3945994-3946028 35 NZ_CP021831 Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence 895529-895563 7 0.8
NC_022350_15 15.3|3945994|35|NC_022350|CRT 3945994-3946028 35 NZ_CP021810 Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence 1422896-1422930 7 0.8
NC_022350_15 15.3|3945994|35|NC_022350|CRT 3945994-3946028 35 NZ_CP021218 Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence 794837-794871 7 0.8
NC_022350_15 15.3|3945994|35|NC_022350|CRT 3945994-3946028 35 NZ_CP030264 Ensifer adhaerens strain Corn53 plasmid AB, complete sequence 382780-382814 7 0.8
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 NZ_CP050092 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence 506990-507021 7 0.781
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 CP006582 Mesorhizobium huakuii 7653R plasmid pMHa, complete sequence 64257-64288 7 0.781
NC_022350_15 15.10|3946600|35|NC_022350|CRT 3946600-3946634 35 NZ_CP025547 Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence 261174-261208 7 0.8
NC_022350_15 15.10|3946600|35|NC_022350|CRT 3946600-3946634 35 NZ_CP005085 Sphingobium sp. TKS plasmid pTK1, complete sequence 306649-306683 7 0.8
NC_022350_15 15.10|3946600|35|NC_022350|CRT 3946600-3946634 35 NC_003078 Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence 1085516-1085550 7 0.8
NC_022350_15 15.10|3946600|35|NC_022350|CRT 3946600-3946634 35 NZ_CP021799 Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence 1151738-1151772 7 0.8
NC_022350_15 15.10|3946600|35|NC_022350|CRT 3946600-3946634 35 NZ_CP021806 Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence 373508-373542 7 0.8
NC_022350_15 15.10|3946600|35|NC_022350|CRT 3946600-3946634 35 NC_020560 Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence 1085521-1085555 7 0.8
NC_022350_15 15.10|3946600|35|NC_022350|CRT 3946600-3946634 35 NC_018701 Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence 634105-634139 7 0.8
NC_022350_15 15.10|3946600|35|NC_022350|CRT 3946600-3946634 35 NZ_CP021802 Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence 1302033-1302067 7 0.8
NC_022350_15 15.10|3946600|35|NC_022350|CRT 3946600-3946634 35 NZ_CP021831 Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence 895529-895563 7 0.8
NC_022350_15 15.10|3946600|35|NC_022350|CRT 3946600-3946634 35 NZ_CP021810 Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence 1422896-1422930 7 0.8
NC_022350_15 15.10|3946600|35|NC_022350|CRT 3946600-3946634 35 NZ_CP021218 Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence 794837-794871 7 0.8
NC_022350_15 15.10|3946600|35|NC_022350|CRT 3946600-3946634 35 NZ_CP030264 Ensifer adhaerens strain Corn53 plasmid AB, complete sequence 382780-382814 7 0.8
NC_022350_2 2.9|341441|30|NC_022350|CRT 341441-341470 30 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 1313897-1313926 8 0.733
NC_022350_2 2.13|341690|33|NC_022350|CRT 341690-341722 33 NC_007805 Pseudomonas phage F10, complete genome 2723-2755 8 0.758
NC_022350_2 2.13|341690|33|NC_022350|CRT 341690-341722 33 KJ959591 Pseudomonas phage PAN70, partial genome 2666-2698 8 0.758
NC_022350_2 2.13|341690|33|NC_022350|CRT 341690-341722 33 NC_031091 Pseudomonas phage MD8, complete genome 2707-2739 8 0.758
NC_022350_2 2.13|341690|33|NC_022350|CRT 341690-341722 33 DQ163912 Bacteriophage F10, complete genome 2723-2755 8 0.758
NC_022350_3 3.6|369987|33|NC_022350|CRISPRCasFinder 369987-370019 33 NZ_CP017105 Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence 1386736-1386768 8 0.758
NC_022350_3 3.6|369987|33|NC_022350|CRISPRCasFinder 369987-370019 33 NC_016624 Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence 35126-35158 8 0.758
NC_022350_3 3.6|369987|33|NC_022350|CRISPRCasFinder 369987-370019 33 NZ_CP039965 Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence 1241611-1241643 8 0.758
NC_022350_3 3.6|369987|33|NC_022350|CRISPRCasFinder 369987-370019 33 CP007644 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence 275839-275871 8 0.758
NC_022350_3 3.6|369987|33|NC_022350|CRISPRCasFinder 369987-370019 33 NZ_CP029834 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence 310597-310629 8 0.758
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2714450-2714479 8 0.733
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 837910-837939 8 0.733
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 424702-424731 8 0.733
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 975216-975245 8 0.733
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 1013021-1013050 8 0.733
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_KY126370 Enterobacter cloacae subsp. cloacae strain MN201516 plasmid pOP-I, complete sequence 93253-93282 8 0.733
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP054625 Cupriavidus gilardii strain FDAARGOS_639 plasmid unnamed1, complete sequence 22400-22429 8 0.733
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 1889334-1889363 8 0.733
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_LT960615 Hartmannibacter diazotrophicus strain E19T plasmid HDIAp1, complete sequence 21202-21231 8 0.733
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP046347 Citrobacter portucalensis strain FDAARGOS_738 plasmid unnamed1, complete sequence 30108-30137 8 0.733
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP044100 Citrobacter werkmanii strain FDAARGOS_616 plasmid unnamed1, complete sequence 32856-32885 8 0.733
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP032156 Mycobacterium sp. ELW1 plasmid pELW1-1, complete sequence 111116-111145 8 0.733
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 KY555144 Caulobacter phage Ccr5, complete genome 178242-178271 8 0.733
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_KP873172 Pseudomonas aeruginosa PAO1 plasmid pAMBL1, complete sequence 21059-21088 8 0.733
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP045203 Citrobacter sp. NMI7904_11 plasmid pCTEL-2, complete sequence 159096-159125 8 0.733
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NC_021492 Enterobacter sp. R4-368 plasmid pENT01, complete sequence 50097-50126 8 0.733
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP022156 Escherichia coli strain ABWA45 plasmid pABWA45_2, complete sequence 15249-15278 8 0.733
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP024682 Citrobacter freundii strain UMH14 plasmid pUMH14_2, complete sequence 41943-41972 8 0.733
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 242723-242752 8 0.733
NC_022350_5 5.15|930786|30|NC_022350|CRT 930786-930815 30 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 28649-28678 8 0.733
NC_022350_5 5.15|930786|30|NC_022350|CRT 930786-930815 30 NZ_CP020899 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence 310870-310899 8 0.733
NC_022350_5 5.15|930786|30|NC_022350|CRT 930786-930815 30 NZ_CP022369 Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence 462801-462830 8 0.733
NC_022350_5 5.15|930786|30|NC_022350|CRT 930786-930815 30 NZ_CP013525 Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence 292109-292138 8 0.733
NC_022350_5 5.15|930786|30|NC_022350|CRT 930786-930815 30 NZ_CP013588 Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence 287383-287412 8 0.733
NC_022350_5 5.15|930786|30|NC_022350|CRT 930786-930815 30 NZ_CP013577 Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence 292305-292334 8 0.733
NC_022350_5 5.15|930786|30|NC_022350|CRT 930786-930815 30 NZ_CP013549 Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence 292675-292704 8 0.733
NC_022350_5 5.15|930786|30|NC_022350|CRT 930786-930815 30 NZ_CP013529 Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence 306458-306487 8 0.733
NC_022350_5 5.15|930786|30|NC_022350|CRT 930786-930815 30 NZ_CP013534 Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence 292675-292704 8 0.733
NC_022350_5 5.15|930786|30|NC_022350|CRT 930786-930815 30 NZ_CP013539 Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence 295900-295929 8 0.733
NC_022350_5 5.15|930786|30|NC_022350|CRT 930786-930815 30 NZ_CP013545 Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence 292670-292699 8 0.733
NC_022350_5 5.15|930786|30|NC_022350|CRT 930786-930815 30 NZ_CP013582 Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence 306458-306487 8 0.733
NC_022350_5 5.15|930786|30|NC_022350|CRT 930786-930815 30 NZ_CP013571 Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence 292305-292334 8 0.733
NC_022350_5 5.15|930786|30|NC_022350|CRT 930786-930815 30 NC_010998 Rhizobium etli CIAT 652 plasmid pA, complete sequence 298287-298316 8 0.733
NC_022350_5 5.15|930786|30|NC_022350|CRT 930786-930815 30 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1682210-1682239 8 0.733
NC_022350_5 5.15|930786|30|NC_022350|CRT 930786-930815 30 NZ_CP017076 Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence 294530-294559 8 0.733
NC_022350_5 5.15|930786|30|NC_022350|CRT 930786-930815 30 NZ_LR134452 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence 375826-375855 8 0.733
NC_022350_5 5.15|930786|30|NC_022350|CRT 930786-930815 30 NZ_AP014706 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_2p, complete sequence 112972-113001 8 0.733
NC_022350_5 5.17|930876|36|NC_022350|CRT 930876-930911 36 MG770216 Mycobacterium phage Rem711, complete genome 26292-26327 8 0.778
NC_022350_5 5.17|930876|36|NC_022350|CRT 930876-930911 36 KY087993 Mycobacterium phage Hammy, complete genome 24359-24394 8 0.778
NC_022350_5 5.17|930876|36|NC_022350|CRT 930876-930911 36 MF140406 Mycobacterium phage DarthP, complete genome 24368-24403 8 0.778
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 3466471-3466504 8 0.765
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 350662-350695 8 0.765
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 350530-350563 8 0.765
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 3051061-3051094 8 0.765
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 36586-36619 8 0.765
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NC_047958 Burkholderia phage vB_BmuP_KL4, complete genome 28566-28599 8 0.765
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 117037-117070 8 0.765
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 928385-928418 8 0.765
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 131278-131311 8 0.765
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 117079-117112 8 0.765
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 117037-117070 8 0.765
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 670302-670335 8 0.765
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 1123064-1123097 8 0.765
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP032054 Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence 530145-530178 8 0.765
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP016560 Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence 187401-187434 8 0.765
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 MN234223 Mycobacterium phage Philly, complete genome 30948-30981 8 0.765
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 KJ194581 Mycobacterium phage Audrey, complete genome 31094-31127 8 0.765
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 MH051265 Mycobacterium phage Yahalom, complete genome 31107-31140 8 0.765
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 MH316565 Mycobacterium phage Mortcellus, complete genome 31732-31765 8 0.765
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 MT310871 Mycobacterium phage Jackstina, complete genome 31017-31050 8 0.765
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 EU816589 Mycobacterium phage Phaedrus, complete genome 31013-31046 8 0.765
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 MT952851 Mycobacterium phage Gervas, complete genome 31075-31108 8 0.765
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 MG920059 Mycobacterium phage Baloo, complete genome 31097-31130 8 0.765
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NC_023686 Mycobacterium phage Gadjet, complete genome 31104-31137 8 0.765
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NC_041965 Mycobacterium phage Athena, complete genome 31845-31878 8 0.765
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 DQ398049 Mycobacterium phage Pipefish, complete genome 32489-32522 8 0.765
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 MT310892 Mycobacterium phage Compostia, complete genome 31524-31557 8 0.765
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 JN699018 Mycobacterium phage Kamiyu, complete genome 31063-31096 8 0.765
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 687345-687378 8 0.765
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP010410 Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence 118498-118531 8 0.765
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP033582 Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence 539300-539333 8 0.765
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 MK814754 Mycobacterium phage Sumter, complete genome 28141-28174 8 0.765
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 MK814754 Mycobacterium phage Sumter, complete genome 28639-28672 8 0.765
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 MN369739 Mycobacterium phage Kenuha5, complete genome 22588-22621 8 0.765
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 MK967397 Mycobacterium phage Mahavrat, complete genome 24814-24847 8 0.765
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 MT522000 Mycobacterium phage Soul22, complete genome 22192-22225 8 0.765
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 KY348865 Mycobacterium phage Bubbles123, complete genome 25540-25573 8 0.765
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 MN428047 Mycobacterium phage Doomphist, complete genome 24962-24995 8 0.765
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 MF919502 Mycobacterium phage Demsculpinboyz, complete genome 22190-22223 8 0.765
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 AY129336 Mycobacteriophage Che9d, complete genome 22205-22238 8 0.765
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 MT771340 Mycobacterium phage Jorgensen, complete genome 28476-28509 8 0.765
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 MK359343 Mycobacterium phage Pollywog, complete genome 23655-23688 8 0.765
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NC_042030 Mycobacterium phage Yoshi, complete sequence 22193-22226 8 0.765
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NC_048729 Mycobacterium phage Renaud18, complete genome 22865-22898 8 0.765
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NC_026585 Mycobacteriophage Estave1, complete genome 22558-22591 8 0.765
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 MK305886 Mycobacterium phage Poenanya, complete genome 24962-24995 8 0.765
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 JN859129 Mycobacterium virus DotProduct, complete genome 24829-24862 8 0.765
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 MG925354 Mycobacterium phage Ogopogo, complete genome 22785-22818 8 0.765
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 JN698995 Mycobacterium phage Dori, complete genome 28163-28196 8 0.765
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NC_023698 Mycobacterium phage Avani, complete genome 22197-22230 8 0.765
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NC_011054 Mycobacterium phage Boomer, complete genome 24637-24670 8 0.765
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 MN234184 Mycobacterium phage IdentityCrisis, complete genome 19984-20017 8 0.765
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 MH077585 Mycobacterium phage TChen, complete genome 22970-23003 8 0.765
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NC_048788 Mycobacterium phage ThetaBob, complete genome 22783-22816 8 0.765
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP039965 Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence 125963-125996 8 0.765
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP015733 Arthrobacter sp. U41 plasmid unnamed1, complete sequence 138036-138069 8 0.765
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 MN096355 Mycobacterium phage Purky, complete genome 13505-13538 8 0.765
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 MN234183 Mycobacterium phage Antsirabe, complete genome 23060-23093 8 0.765
NC_022350_6 6.9|1217578|37|NC_022350|CRISPRCasFinder 1217578-1217614 37 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 683728-683764 8 0.784
NC_022350_7 7.10|1573453|31|NC_022350|CRISPRCasFinder 1573453-1573483 31 NZ_CP017076 Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence 349053-349083 8 0.742
NC_022350_7 7.10|1573453|31|NC_022350|CRISPRCasFinder 1573453-1573483 31 NZ_CP039899 Agrobacterium tumefaciens strain CFBP5877 plasmid pAtCFBP5877a, complete sequence 336247-336277 8 0.742
NC_022350_7 7.10|1573453|31|NC_022350|CRISPRCasFinder 1573453-1573483 31 NZ_CP039913 Agrobacterium tumefaciens strain CFBP6625 plasmid pAtCFBP6625b, complete sequence 262996-263026 8 0.742
NC_022350_7 7.10|1573453|31|NC_022350|CRISPRCasFinder 1573453-1573483 31 NZ_CP039890 Agrobacterium tumefaciens strain CFBP5499 plasmid pAtCFBP5499a, complete sequence 336247-336277 8 0.742
NC_022350_7 7.10|1573453|31|NC_022350|CRISPRCasFinder 1573453-1573483 31 NZ_CP018001 Rhizobium sp. Y9 plasmid pY9, complete sequence 264529-264559 8 0.742
NC_022350_7 7.10|1573453|31|NC_022350|CRISPRCasFinder 1573453-1573483 31 NC_022536 Rhizobium sp. IRBG74 plasmid IRBL74_p, complete sequence 458177-458207 8 0.742
NC_022350_7 7.10|1573453|31|NC_022350|CRISPRCasFinder 1573453-1573483 31 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 311056-311086 8 0.742
NC_022350_7 7.10|1573453|31|NC_022350|CRISPRCasFinder 1573453-1573483 31 NZ_CP018075 Streptomyces venezuelae strain NRRL B-65442 plasmid, complete sequence 88587-88617 8 0.742
NC_022350_7 7.10|1573453|31|NC_022350|CRISPRCasFinder 1573453-1573483 31 CP036360 Agrobacterium sp. 33MFTa1.1 plasmid p_JBx_073812, complete sequence 284157-284187 8 0.742
NC_022350_7 7.10|1573453|31|NC_022350|CRISPRCasFinder 1573453-1573483 31 NZ_CP021914 Sagittula sp. P11 plasmid unnamed1, complete sequence 300067-300097 8 0.742
NC_022350_7 7.10|1573453|31|NC_022350|CRISPRCasFinder 1573453-1573483 31 NZ_AP022319 Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence 1510497-1510527 8 0.742
NC_022350_8 8.3|2087658|30|NC_022350|CRT 2087658-2087687 30 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 9194-9223 8 0.733
NC_022350_8 8.3|2087658|30|NC_022350|CRT 2087658-2087687 30 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 983284-983313 8 0.733
NC_022350_12 12.25|3117982|29|NC_022350|PILER-CR 3117982-3118010 29 MK599315 Pseudomonas phage PA1C, complete genome 299172-299200 8 0.724
NC_022350_13 13.7|3736150|31|NC_022350|CRT 3736150-3736180 31 CP033373 Lactobacillus fermentum strain DR9 plasmid unnamed2, complete sequence 12237-12267 8 0.742
NC_022350_13 13.7|3736150|31|NC_022350|CRT 3736150-3736180 31 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 1260343-1260373 8 0.742
NC_022350_13 13.7|3736150|31|NC_022350|CRT 3736150-3736180 31 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 1009358-1009388 8 0.742
NC_022350_13 13.7|3736150|31|NC_022350|CRT 3736150-3736180 31 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 1260501-1260531 8 0.742
NC_022350_13 13.7|3736150|31|NC_022350|CRT 3736150-3736180 31 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 1009351-1009381 8 0.742
NC_022350_13 13.7|3736150|31|NC_022350|CRT 3736150-3736180 31 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 756669-756699 8 0.742
NC_022350_13 13.7|3736150|31|NC_022350|CRT 3736150-3736180 31 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 1137767-1137797 8 0.742
NC_022350_13 13.7|3736150|31|NC_022350|CRT 3736150-3736180 31 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 1009365-1009395 8 0.742
NC_022350_13 13.7|3736150|31|NC_022350|CRT 3736150-3736180 31 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 1260057-1260087 8 0.742
NC_022350_13 13.7|3736150|31|NC_022350|CRT 3736150-3736180 31 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 1260001-1260031 8 0.742
NC_022350_13 13.7|3736150|31|NC_022350|CRT 3736150-3736180 31 NZ_CP054621 Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence 981946-981976 8 0.742
NC_022350_13 13.7|3736150|31|NC_022350|CRT 3736150-3736180 31 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 938267-938297 8 0.742
NC_022350_13 13.7|3736150|31|NC_022350|CRT 3736150-3736180 31 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 748414-748444 8 0.742
NC_022350_13 13.7|3736150|31|NC_022350|CRT 3736150-3736180 31 CP047137 Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence 896022-896052 8 0.742
NC_022350_13 13.7|3736150|31|NC_022350|CRT 3736150-3736180 31 NZ_CP027299 Streptomyces sp. SGAir0924 plasmid unnamed_5 215713-215743 8 0.742
NC_022350_13 13.7|3736150|31|NC_022350|CRT 3736150-3736180 31 NC_014213 Meiothermus silvanus DSM 9946 plasmid pMESIL01, complete sequence 111748-111778 8 0.742
NC_022350_14 14.9|3929877|39|NC_022350|CRT 3929877-3929915 39 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 770469-770507 8 0.795
NC_022350_14 14.12|3930108|30|NC_022350|CRT 3930108-3930137 30 NZ_CP048385 Citrobacter freundii strain 62 plasmid p6_C, complete sequence 53917-53946 8 0.733
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 NZ_LR134468 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 26, complete sequence 39373-39404 8 0.75
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 NZ_CP053714 Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed7, complete sequence 10207-10238 8 0.75
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 NZ_CP054615 Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence 288012-288043 8 0.75
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 1651410-1651441 8 0.75
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 NZ_CP026489 Streptomyces sp. 604F plasmid unnamed, complete sequence 15179-15210 8 0.75
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 NZ_KY349138 Mycolicibacterium sp. CBMA 213 plasmid pCBMA213_2, complete sequence 122115-122146 8 0.75
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 NZ_CP050098 Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b4, complete sequence 350558-350589 8 0.75
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 NZ_CP033508 Mesorhizobium jarvisii strain ATCC 700743 plasmid pMJ700743a, complete sequence 6416-6447 8 0.75
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 NZ_CP033369 Mesorhizobium loti strain SU343 plasmid pMLSU343a, complete sequence 6416-6447 8 0.75
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 NZ_CP022363 Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence 604747-604778 8 0.75
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 NZ_CP053440 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eF, complete sequence 356076-356107 8 0.75
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 NC_008269 Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence 477588-477619 8 0.75
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 NZ_CP054022 Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence 1112548-1112579 8 0.75
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 NZ_CP032341 Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence 250921-250952 8 0.75
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 NZ_CP032053 Streptomyces clavuligerus strain F1D-5 plasmid pSCL2, complete sequence 2483-2514 8 0.75
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 NZ_CP054032 Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence 947778-947809 8 0.75
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 NZ_CP012916 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence 797689-797720 8 0.75
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 MN234185 Mycobacterium phage Lemuria, complete genome 22699-22730 8 0.75
NC_022350_3 3.6|369987|33|NC_022350|CRISPRCasFinder 369987-370019 33 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 91175-91207 9 0.727
NC_022350_3 3.6|369987|33|NC_022350|CRISPRCasFinder 369987-370019 33 NZ_CP016287 Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence 668963-668995 9 0.727
NC_022350_3 3.6|369987|33|NC_022350|CRISPRCasFinder 369987-370019 33 NZ_CP022565 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence 789706-789738 9 0.727
NC_022350_3 3.6|369987|33|NC_022350|CRISPRCasFinder 369987-370019 33 NZ_CP048281 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence 625853-625885 9 0.727
NC_022350_4 4.1|696509|31|NC_022350|CRISPRCasFinder 696509-696539 31 NZ_CP014964 Geobacter anodireducens strain SD-1 plasmid pSD, complete sequence 13698-13728 9 0.71
NC_022350_4 4.1|696509|31|NC_022350|CRISPRCasFinder 696509-696539 31 NC_015974 Sphingobium sp. SYK-6 plasmid pSLPG, complete sequence 20960-20990 9 0.71
NC_022350_4 4.1|696509|31|NC_022350|CRISPRCasFinder 696509-696539 31 NZ_CP005085 Sphingobium sp. TKS plasmid pTK1, complete sequence 15390-15420 9 0.71
NC_022350_5 5.13|930690|30|NC_022350|CRT 930690-930719 30 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 5046041-5046070 9 0.7
NC_022350_5 5.15|930786|30|NC_022350|CRT 930786-930815 30 NC_005241 Cupriavidus necator H16 megaplasmid pHG1, complete sequence 65937-65966 9 0.7
NC_022350_5 5.15|930786|30|NC_022350|CRT 930786-930815 30 NZ_CP039289 Cupriavidus necator H16 plasmid pHG1, complete sequence 65937-65966 9 0.7
NC_022350_5 5.17|930876|36|NC_022350|CRT 930876-930911 36 MF140398 Mycobacterium phage Amohnition, complete genome 24446-24481 9 0.75
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 350101-350134 9 0.735
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2210928-2210961 9 0.735
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP005085 Sphingobium sp. TKS plasmid pTK1, complete sequence 231456-231489 9 0.735
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP005085 Sphingobium sp. TKS plasmid pTK1, complete sequence 306612-306645 9 0.735
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NC_019957 Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence 283233-283266 9 0.735
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 EF602154 Burkholderia phage BcepNY3, complete genome 21505-21538 9 0.735
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 AY369265 Burkholderia cenocepacia phage Bcep1, complete genome 23287-23320 9 0.735
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NC_005263 Burkholderia phage Bcep1, complete genome 23287-23320 9 0.735
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP050083 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence 307143-307176 9 0.735
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP049733 Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence 298112-298145 9 0.735
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 723127-723160 9 0.735
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP053906 Hymenobacter sp. BRD67 plasmid unnamed2, complete sequence 19270-19303 9 0.735
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 KC170279 Uncultured bacterium plasmid pMBUI8, complete sequence 15929-15962 9 0.735
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NC_019849 Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence 652970-653003 9 0.735
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP015867 Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence 490801-490834 9 0.735
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NC_017326 Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence 637964-637997 9 0.735
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NC_017323 Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence 235008-235041 9 0.735
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP009146 Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence 646029-646062 9 0.735
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NC_018701 Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence 635838-635871 9 0.735
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 684904-684937 9 0.735
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP021802 Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence 1303766-1303799 9 0.735
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP021831 Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence 897262-897295 9 0.735
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 233325-233358 9 0.735
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP021814 Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence 560015-560048 9 0.735
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP021810 Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence 1424629-1424662 9 0.735
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP021218 Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence 796570-796603 9 0.735
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP026527 Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence 659643-659676 9 0.735
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NC_003078 Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence 1083784-1083817 9 0.735
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP019586 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence 1052610-1052643 9 0.735
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP021799 Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence 1150006-1150039 9 0.735
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP021828 Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence 654523-654556 9 0.735
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP021823 Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence 771404-771437 9 0.735
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP021795 Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence 290861-290894 9 0.735
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP021806 Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence 371773-371806 9 0.735
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP019484 Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence 1224363-1224396 9 0.735
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP019487 Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence 997046-997079 9 0.735
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NC_020560 Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence 1083789-1083822 9 0.735
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 MH001451 Mycobacterium phage Nairb, complete genome 21242-21275 9 0.735
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 MF155936 Mycobacterium phage ZenTime222, complete genome 21242-21275 9 0.735
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 MH588544 Caulobacter phage CcrBL10, complete genome 39042-39075 9 0.735
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 MK494089 Mycobacterium phage Ibrahim, complete genome 21242-21275 9 0.735
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NC_024135 Mycobacterium phage Bernal13, complete genome 21242-21275 9 0.735
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 KM591905 Mycobacterium phage RonRayGun, complete genome 21242-21275 9 0.735
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 MN735432 Mycobacteriophage Whitty, complete genome 21242-21275 9 0.735
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_KX443399 Rhodococcus hoagii strain PAM1354 plasmid pVAPA1354, complete sequence 82507-82540 9 0.735
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_KX443400 Rhodococcus hoagii strain PAM1557 plasmid pVAPN1557, complete sequence 82532-82565 9 0.735
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_KX443398 Rhodococcus hoagii strain PAM1204 plasmid pVAPN1204, complete sequence 82528-82561 9 0.735
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 CP054922 Streptomyces sp. NA03103 plasmid unnamed2, complete sequence 90688-90721 9 0.735
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_KP851975 Rhodococcus hoagii strain PAM2012 plasmid pVAPN2012, complete sequence 82645-82678 9 0.735
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NC_015314 Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence 55533-55566 9 0.735
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 318448-318481 9 0.735
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_KF439868 Rhodococcus hoagii strain PAM1571 plasmid pVAPN1571, complete sequence 81659-81692 9 0.735
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_LR134452 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence 84861-84894 9 0.735
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP021025 Rhizobium sp. TAL182 plasmid pRetTAL182a, complete sequence 135548-135581 9 0.735
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 498515-498548 9 0.735
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP007795 Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence 927230-927263 9 0.735
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP013600 Rhizobium sp. N741 plasmid pRspN741e, complete sequence 241368-241401 9 0.735
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NC_019789 Deinococcus peraridilitoris DSM 19664 plasmid pDEIPE01, complete sequence 455289-455322 9 0.735
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP013504 Rhizobium esperanzae strain N561 plasmid pRspN561d, complete sequence 241368-241401 9 0.735
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP013510 Rhizobium sp. N1341 plasmid pRspN1341e, complete sequence 239809-239842 9 0.735
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP013521 Rhizobium sp. N113 plasmid pRspN113d, complete sequence 244056-244089 9 0.735
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP013494 Rhizobium sp. N6212 plasmid pRspN6212d, complete sequence 238174-238207 9 0.735
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP013512 Rhizobium sp. N1314 plasmid pRspN1314a, complete sequence 131481-131514 9 0.735
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP013594 Rhizobium sp. N871 plasmid pRspN871d, complete sequence 241368-241401 9 0.735
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP012916 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence 747004-747037 9 0.735
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 KC736071 Mycobacterium phage WIVsmall, complete genome 29683-29716 9 0.735
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 171949-171982 9 0.735
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_LR134446 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 4, complete sequence 52095-52128 9 0.735
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP041653 Streptomyces sp. RLB1-9 plasmid pRLB1-9.1, complete sequence 129601-129634 9 0.735
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP032341 Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence 301604-301637 9 0.735
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP032347 Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence 779027-779060 9 0.735
NC_022350_6 6.9|1217578|37|NC_022350|CRISPRCasFinder 1217578-1217614 37 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 686592-686628 9 0.757
NC_022350_7 7.10|1573453|31|NC_022350|CRISPRCasFinder 1573453-1573483 31 NZ_CP039697 Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence 345043-345073 9 0.71
NC_022350_7 7.10|1573453|31|NC_022350|CRISPRCasFinder 1573453-1573483 31 NZ_CP049244 Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence 245050-245080 9 0.71
NC_022350_7 7.10|1573453|31|NC_022350|CRISPRCasFinder 1573453-1573483 31 NC_022049 Paracoccus aminophilus JCM 7686 plasmid pAMI4, complete sequence 194387-194417 9 0.71
NC_022350_7 7.10|1573453|31|NC_022350|CRISPRCasFinder 1573453-1573483 31 MN234199 Mycobacterium phage Ekdilam, complete genome 24235-24265 9 0.71
NC_022350_7 7.10|1573453|31|NC_022350|CRISPRCasFinder 1573453-1573483 31 NZ_CP023000 Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence 1145162-1145192 9 0.71
NC_022350_7 7.10|1573453|31|NC_022350|CRISPRCasFinder 1573453-1573483 31 NZ_CP015737 Shinella sp. HZN7 plasmid pShin-01, complete sequence 453136-453166 9 0.71
NC_022350_7 7.10|1573453|31|NC_022350|CRISPRCasFinder 1573453-1573483 31 NZ_CP013740 Streptomyces globisporus C-1027 plasmid pSGL1, complete sequence 2806-2836 9 0.71
NC_022350_7 7.10|1573453|31|NC_022350|CRISPRCasFinder 1573453-1573483 31 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 1908459-1908489 9 0.71
NC_022350_13 13.5|3736009|34|NC_022350|CRT 3736009-3736042 34 NZ_CP021805 Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence 922290-922323 9 0.735
NC_022350_13 13.5|3736009|34|NC_022350|CRT 3736009-3736042 34 MG812496 Gordonia phage SallySpecial, complete genome 7675-7708 9 0.735
NC_022350_13 13.9|3736282|37|NC_022350|CRT 3736282-3736318 37 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 975062-975098 9 0.757
NC_022350_14 14.9|3929877|39|NC_022350|CRT 3929877-3929915 39 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 414874-414912 9 0.769
NC_022350_14 14.9|3929877|39|NC_022350|CRT 3929877-3929915 39 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 1604227-1604265 9 0.769
NC_022350_14 14.9|3929877|39|NC_022350|CRT 3929877-3929915 39 NZ_CP034351 Streptomyces sp. W1SF4 plasmid p1, complete sequence 68975-69013 9 0.769
NC_022350_14 14.12|3930108|30|NC_022350|CRT 3930108-3930137 30 NC_012725 Burkholderia glumae BGR1 plasmid bglu_4p, complete sequence 105939-105968 9 0.7
NC_022350_15 15.3|3945994|35|NC_022350|CRT 3945994-3946028 35 NZ_CP033582 Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence 182019-182053 9 0.743
NC_022350_15 15.3|3945994|35|NC_022350|CRT 3945994-3946028 35 NZ_CP046906 Streptomyces sp. QHH-9511 plasmid unnamed, complete sequence 61961-61995 9 0.743
NC_022350_15 15.3|3945994|35|NC_022350|CRT 3945994-3946028 35 NC_028791 Mycobacterium phage MOOREtheMARYer, complete genome 22782-22816 9 0.743
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 NZ_CP054617 Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence 232975-233006 9 0.719
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 580621-580652 9 0.719
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 569017-569048 9 0.719
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 NZ_LR594668 Variovorax sp. SRS16 plasmid 3 37759-37790 9 0.719
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 466176-466207 9 0.719
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 535557-535588 9 0.719
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 466176-466207 9 0.719
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 472220-472251 9 0.719
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 472210-472241 9 0.719
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 315511-315542 9 0.719
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 466188-466219 9 0.719
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 466208-466239 9 0.719
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 466162-466193 9 0.719
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 580664-580695 9 0.719
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 580664-580695 9 0.719
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 NZ_AP022611 Mycolicibacterium madagascariense strain JCM 13574 plasmid pJCM13574 1233-1264 9 0.719
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 NZ_AP022611 Mycolicibacterium madagascariense strain JCM 13574 plasmid pJCM13574 207744-207775 9 0.719
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 580655-580686 9 0.719
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 NZ_LR134465 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence 251423-251454 9 0.719
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 NZ_CP030864 Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence 66790-66821 9 0.719
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 NZ_CP023524 Burkholderia gladioli pv. gladioli strain FDAARGOS_389 plasmid unnamed, complete sequence 61961-61992 9 0.719
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 NZ_CP040761 Paracoccus sp. 2251 plasmid unnamed5, complete sequence 196202-196233 9 0.719
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 NZ_CP030763 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed3, complete sequence 682094-682125 9 0.719
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 NZ_CP017564 Paraburkholderia sprentiae WSM5005 plasmid pl3WSM5005, complete sequence 52981-53012 9 0.719
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 NZ_CP033429 Burkholderia gladioli strain Burkholderia gladioli Co14 plasmid p1, complete sequence 47823-47854 9 0.719
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 NZ_CP023068 Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence 550227-550258 9 0.719
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 NZ_CP050088 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence 362074-362105 9 0.719
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 MN234219 Mycobacterium phage Mercurio, complete genome 23309-23340 9 0.719
NC_022350_15 15.10|3946600|35|NC_022350|CRT 3946600-3946634 35 NZ_CP033582 Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence 182019-182053 9 0.743
NC_022350_15 15.10|3946600|35|NC_022350|CRT 3946600-3946634 35 NZ_CP046906 Streptomyces sp. QHH-9511 plasmid unnamed, complete sequence 61961-61995 9 0.743
NC_022350_15 15.10|3946600|35|NC_022350|CRT 3946600-3946634 35 NC_028791 Mycobacterium phage MOOREtheMARYer, complete genome 22782-22816 9 0.743
NC_022350_2 2.11|341549|36|NC_022350|CRT 341549-341584 36 AP021851 Deinococcus grandis ATCC 43672 plasmid: pDEGR-2 DNA, complete genome 181838-181873 10 0.722
NC_022350_2 2.11|341549|36|NC_022350|CRT 341549-341584 36 NC_020159 Halovirus HSTV-2, complete genome 33906-33941 10 0.722
NC_022350_2 2.13|341690|33|NC_022350|CRT 341690-341722 33 NZ_KM017071 Sphingomonas sp. JE1 plasmid pJE1, complete sequence 25408-25440 10 0.697
NC_022350_3 3.6|369987|33|NC_022350|CRISPRCasFinder 369987-370019 33 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 91179-91211 10 0.697
NC_022350_3 3.6|369987|33|NC_022350|CRISPRCasFinder 369987-370019 33 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 90245-90277 10 0.697
NC_022350_3 3.6|369987|33|NC_022350|CRISPRCasFinder 369987-370019 33 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 99166-99198 10 0.697
NC_022350_5 5.2|930186|39|NC_022350|CRT 930186-930224 39 NZ_CP044080 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence 107058-107096 10 0.744
NC_022350_5 5.5|930339|36|NC_022350|CRT 930339-930374 36 KX683875 Mycobacterium phage Baehexic, complete genome 12172-12207 10 0.722
NC_022350_5 5.5|930339|36|NC_022350|CRT 930339-930374 36 KM197169 Mycobacterium phage Piro94, complete genome 12169-12204 10 0.722
NC_022350_5 5.5|930339|36|NC_022350|CRT 930339-930374 36 MF668269 Mycobacterium phage Drake55, complete genome 12168-12203 10 0.722
NC_022350_5 5.5|930339|36|NC_022350|CRT 930339-930374 36 MK284522 Mycobacterium phage Malec, complete genome 11941-11976 10 0.722
NC_022350_5 5.5|930339|36|NC_022350|CRT 930339-930374 36 KM677210 Mycobacterium phage Larenn, complete genome 11936-11971 10 0.722
NC_022350_5 5.17|930876|36|NC_022350|CRT 930876-930911 36 MN369764 Mycobacterium phage Rahalelujah, complete genome 24340-24375 10 0.722
NC_022350_5 5.17|930876|36|NC_022350|CRT 930876-930911 36 NZ_CP025548 Mycobacterium paragordonae strain 49061 plasmid unnamed2, complete sequence 25147-25182 10 0.722
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2210946-2210979 10 0.706
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 1732364-1732397 10 0.706
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP034352 Streptomyces sp. W1SF4 plasmid p2, complete sequence 21676-21709 10 0.706
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 CP000620 Burkholderia vietnamiensis G4 plasmid pBVIE04, complete sequence 96060-96093 10 0.706
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP020810 Mycobacterium dioxanotrophicus strain PH-06 plasmid unnamed1, complete sequence 93944-93977 10 0.706
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NC_016588 Azospirillum lipoferum 4B plasmid AZO_p6, complete sequence 98684-98717 10 0.706
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 MK524490 Mycobacterium phage Donny, complete genome 33811-33844 10 0.706
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 MK494095 Mycobacterium phage Daegal, complete genome 5959-5992 10 0.706
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 JN699007 Mycobacterium phage Acadian, complete genome 33806-33839 10 0.706
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 MT889381 Mycobacterium phage Suigeneris, complete genome 33811-33844 10 0.706
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP015373 Pandoraea pnomenusa strain MCB032 plasmid unnamed 2, complete sequence 47518-47551 10 0.706
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 AP018709 Uncultured bacterium plasmid pSN1104-59 DNA, complete sequence 27460-27493 10 0.706
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP013744 Streptomyces sp. CdTB01 plasmid unnamed, complete sequence 194712-194745 10 0.706
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NC_016623 Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence 362178-362211 10 0.706
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NC_008766 Acidovorax sp. JS42 plasmid pAOVO02, complete sequence 10252-10285 10 0.706
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP030127 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence 677361-677394 10 0.706
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP019238 Rhodoferax koreense strain DCY-110 plasmid unnamed2 8446-8479 10 0.706
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP019238 Rhodoferax koreense strain DCY-110 plasmid unnamed2 65893-65926 10 0.706
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP054616 Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence 640930-640963 10 0.706
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NC_021077 Comamonas sp. 7D-2 plasmid pBHB, complete sequence 104485-104518 10 0.706
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NC_024998 Acidovorax avenae subsp. avenae plasmid pAAA83 DNA, complete sequence, strain: 83 31366-31399 10 0.706
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NC_008385 Burkholderia ambifaria AMMD plasmid unnamed1, complete sequence 29995-30028 10 0.706
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP018471 Xanthomonas vesicatoria strain LM159 plasmid pLM159.2, complete sequence 16577-16610 10 0.706
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_KJ588780 Achromobacter xylosoxidans strain A22732 plasmid pA22732-IMP, complete sequence 15929-15962 10 0.706
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_MN366359 Bacterium plasmid pALTS31, complete sequence 15929-15962 10 0.706
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP027024 Streptomyces sp. WAC00288 plasmid p2, complete sequence 100724-100757 10 0.706
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NC_001735 Enterobacter aerogenes plasmid R751, complete sequence 31148-31181 10 0.706
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 AGRM01000006 Salmonella enterica subsp. houtenae str. ATCC BAA-1581 plasmid pSEHO0A1, complete sequence, whole genome shotgun sequence 12357-12390 10 0.706
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 AJ863570 Uncultured bacterium IncP-1beta multiresistance plasmid pB8 25168-25201 10 0.706
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP034651 Xanthomonas vasicola strain NCPPB 1060 plasmid pXVH45, complete sequence 17683-17716 10 0.706
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 1350942-1350975 10 0.706
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 136497-136530 10 0.706
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NC_021492 Enterobacter sp. R4-368 plasmid pENT01, complete sequence 46815-46848 10 0.706
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 JX469828 Uncultured bacterium plasmid pRSB223, complete sequence 25131-25164 10 0.706
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 JX469829 Uncultured bacterium plasmid pB1, complete sequence 16215-16248 10 0.706
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 JX469831 Uncultured bacterium plasmid pKSP212, complete sequence 15929-15962 10 0.706
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 JN106172 Uncultured bacterium plasmid pAKD29, complete sequence 15931-15964 10 0.706
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 JN106173 Uncultured bacterium plasmid pAKD31, complete sequence 15929-15962 10 0.706
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 JN106174 Uncultured bacterium plasmid pAKD33, complete sequence 15932-15965 10 0.706
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 JN106164 Uncultured bacterium plasmid pAKD1, complete sequence 15939-15972 10 0.706
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 JN106165 Uncultured bacterium plasmid pAKD14, complete sequence 15929-15962 10 0.706
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 JN106166 Uncultured bacterium plasmid pAKD15, complete sequence 15929-15962 10 0.706
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 JN106168 Uncultured bacterium plasmid pAKD17, complete sequence 15929-15962 10 0.706
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 JN106169 Uncultured bacterium plasmid pAKD18, complete sequence 15929-15962 10 0.706
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 MN386974 Pseudomonas aeruginosa strain 1943 plasmid pPaeBURNS1, complete sequence 16066-16099 10 0.706
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NC_001381 Mycobacterium fortuitum plasmid pAL5000, complete sequence 2682-2715 10 0.706
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 MG879028 Uncultured bacterium plasmid pEG1-1, complete sequence 31441-31474 10 0.706
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP021650 Acidovorax sp. T1 plasmid p2-T1, complete sequence 40579-40612 10 0.706
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 JX486125 Uncultured bacterium plasmid pRWC72a, complete sequence 15940-15973 10 0.706
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP038640 Cupriavidus oxalaticus strain X32 plasmid unnamed5, complete sequence 50284-50317 10 0.706
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 AJ639924 Uncultured bacterium plasmid pB3 complete genome 17431-17464 10 0.706
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 KU356987 Variovorax paradoxus plasmid pBS64, complete sequence 15928-15961 10 0.706
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 KU356988 Variovorax paradoxus plasmid pHB44, complete sequence 15930-15963 10 0.706
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 CP042595 Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence 155712-155745 10 0.706
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP009797 Burkholderia ambifaria AMMD plasmid pBII_1, complete sequence 16433-16466 10 0.706
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NC_013176 Pseudomonas putida plasmid pW2, complete sequence 10533-10566 10 0.706
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NC_019320 Variovorax sp. DB1 plasmid pDB1, complete sequence 49358-49391 10 0.706
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP017455 Dickeya solani strain PPO 9019 plasmid unnamed, complete sequence 23524-23557 10 0.706
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NC_007337 Cupriavidus pinatubonensis JMP134 plasmid 1, complete sequence 71777-71810 10 0.706
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_MN366358 Bacterium plasmid pALTS29, complete sequence 15940-15973 10 0.706
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 MN234219 Mycobacterium phage Mercurio, complete genome 23308-23341 10 0.706
NC_022350_6 6.9|1217578|37|NC_022350|CRISPRCasFinder 1217578-1217614 37 NZ_CP012182 Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence 331923-331959 10 0.73
NC_022350_6 6.9|1217578|37|NC_022350|CRISPRCasFinder 1217578-1217614 37 NZ_CP012185 Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence 716620-716656 10 0.73
NC_022350_7 7.10|1573453|31|NC_022350|CRISPRCasFinder 1573453-1573483 31 NC_017273 Thermus thermophilus SG0.5JP17-16 plasmid pTHTHE1601, complete sequence 425898-425928 10 0.677
NC_022350_7 7.10|1573453|31|NC_022350|CRISPRCasFinder 1573453-1573483 31 NZ_CP030864 Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence 344090-344120 10 0.677
NC_022350_7 7.10|1573453|31|NC_022350|CRISPRCasFinder 1573453-1573483 31 NC_008269 Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence 68383-68413 10 0.677
NC_022350_7 7.10|1573453|31|NC_022350|CRISPRCasFinder 1573453-1573483 31 NC_017590 Thermus thermophilus JL-18 plasmid pTTJL1802, complete sequence 16322-16352 10 0.677
NC_022350_7 7.10|1573453|31|NC_022350|CRISPRCasFinder 1573453-1573483 31 NZ_AP014581 Burkholderia sp. RPE67 plasmid p3, complete sequence 131907-131937 10 0.677
NC_022350_7 7.13|1573702|34|NC_022350|CRISPRCasFinder 1573702-1573735 34 NZ_CP054621 Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence 1081518-1081551 10 0.706
NC_022350_10 10.8|3113802|35|NC_022350|PILER-CR,CRISPRCasFinder,CRT 3113802-3113836 35 NZ_AP022607 Mycobacterium branderi strain JCM 12687 plasmid pJCM12687 414652-414686 10 0.714
NC_022350_12 12.21|3118782|34|NC_022350|CRISPRCasFinder,CRT 3118782-3118815 34 NZ_AP022335 Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49c, complete sequence 171698-171731 10 0.706
NC_022350_12 12.36|3118786|34|NC_022350|PILER-CR 3118786-3118819 34 NZ_AP022335 Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49c, complete sequence 171698-171731 10 0.706
NC_022350_13 13.5|3736009|34|NC_022350|CRT 3736009-3736042 34 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 470079-470112 10 0.706
NC_022350_13 13.5|3736009|34|NC_022350|CRT 3736009-3736042 34 NZ_CP024986 Streptomyces lavendulae subsp. lavendulae strain CCM 3239 plasmid pSA3239, complete sequence 68774-68807 10 0.706
NC_022350_13 13.5|3736009|34|NC_022350|CRT 3736009-3736042 34 NC_024970 Streptomyces aureofaciens strain CCM3239 plasmid pSA3239, complete sequence 172270-172303 10 0.706
NC_022350_13 13.5|3736009|34|NC_022350|CRT 3736009-3736042 34 NZ_KJ396772 Streptomyces lavendulae subsp. lavendulae strain CCM3239 plasmid pSA3239, complete sequence 172270-172303 10 0.706
NC_022350_15 15.3|3945994|35|NC_022350|CRT 3945994-3946028 35 MN908687 Gordonia phage Skog, complete genome 113878-113912 10 0.714
NC_022350_15 15.3|3945994|35|NC_022350|CRT 3945994-3946028 35 NC_019917 Burkholderia phage BcepMigl, complete genome 36779-36813 10 0.714
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 90162-90193 10 0.688
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 NZ_CP013855 Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence 197505-197536 10 0.688
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 NZ_CP027239 Dietzia sp. oral taxon 368 strain W5195 plasmid unnamed1, complete sequence 138828-138859 10 0.688
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 NZ_CP032324 Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence 17911-17942 10 0.688
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 NC_008381 Rhizobium leguminosarum bv. viciae 3841 plasmid pRL10, complete sequence 438073-438104 10 0.688
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 NZ_CP010990 Pseudonocardia sp. EC080625-04 plasmid pFRP1-1, complete sequence 164795-164826 10 0.688
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 NZ_CP007795 Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence 697939-697970 10 0.688
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 NZ_CP054026 Rhizobium sp. JKLM12A2 plasmid pPR12A205, complete sequence 263759-263790 10 0.688
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 NZ_CP054036 Rhizobium sp. JKLM13E plasmid pPR13E05, complete sequence 105092-105123 10 0.688
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 MK279887 Mycobacterium phage Timmi, complete genome 30988-31019 10 0.688
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 KX683293 Mycobacterium phage Daffy, complete genome 30997-31028 10 0.688
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 JN006063 Mycobacterium phage Serendipity, complete genome 31296-31327 10 0.688
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 MH576970 Mycobacterium phage DonSanchon, complete genome 30970-31001 10 0.688
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 MK279881 Mycobacterium phage Solosis, complete genome 30987-31018 10 0.688
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 JN638753 Mycobacterium phage Morgushi, complete genome 30980-31011 10 0.688
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 JF704103 Mycobacterium phage Vortex, complete sequence 30983-31014 10 0.688
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 MK112536 Mycobacterium phage Cannibal, complete genome 31255-31286 10 0.688
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 JN699010 Mycobacterium phage TallGrassMM, complete genome 30902-30933 10 0.688
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 MT952849 Mycobacterium phage Windsor, complete genome 30973-31004 10 0.688
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 NC_028803 Mycobacterium phage OSmaximus, complete genome 31312-31343 10 0.688
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 MH450122 Mycobacterium phage KingTut, complete genome 26651-26682 10 0.688
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 MK112544 Mycobacterium phage Keitherie, complete genome 31327-31358 10 0.688
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 MT310867 Mycobacterium phage Chaelin, complete genome 30969-31000 10 0.688
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 MH590594 Mycobacterium phage PinheadLarry, complete genome 30991-31022 10 0.688
NC_022350_15 15.10|3946600|35|NC_022350|CRT 3946600-3946634 35 MN908687 Gordonia phage Skog, complete genome 113878-113912 10 0.714
NC_022350_15 15.10|3946600|35|NC_022350|CRT 3946600-3946634 35 NC_019917 Burkholderia phage BcepMigl, complete genome 36779-36813 10 0.714
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 350092-350125 11 0.676
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP041045 Paracoccus sp. AK26 plasmid pAK1, complete sequence 239254-239287 11 0.676
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 MH051334 Escherichia phage vB_EcoS-Ro145c2YLVW, complete genome 23136-23169 11 0.676
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 MG852086 Escherichia phage vB_EcoS-Ro145clw, complete genome 41310-41343 11 0.676
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP025547 Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence 261086-261119 11 0.676
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP022363 Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence 584732-584765 11 0.676
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP020372 Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs485, complete sequence 70292-70325 11 0.676
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP054616 Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence 507461-507494 11 0.676
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 ASHF01000034 Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence 155836-155869 11 0.676
NC_022350_6 6.5|1217362|40|NC_022350|CRISPRCasFinder 1217362-1217401 40 NZ_CP025547 Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence 261884-261923 11 0.725
NC_022350_13 13.5|3736009|34|NC_022350|CRT 3736009-3736042 34 NZ_CP029831 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence 326578-326611 11 0.676
NC_022350_13 13.9|3736282|37|NC_022350|CRT 3736282-3736318 37 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 232224-232260 11 0.703
NC_022350_15 15.3|3945994|35|NC_022350|CRT 3945994-3946028 35 MT498048 Mycobacterium phage Raymond7, complete genome 21147-21181 11 0.686
NC_022350_15 15.3|3945994|35|NC_022350|CRT 3945994-3946028 35 KF986246 Mycobacterium phage MichelleMyBell, complete genome 20761-20795 11 0.686
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 NZ_CP015737 Shinella sp. HZN7 plasmid pShin-01, complete sequence 193164-193195 11 0.656
NC_022350_15 15.5|3946147|32|NC_022350|CRT 3946147-3946178 32 NZ_CP022194 Yangia pacifica strain YSBP01 plasmid unnamed4, complete sequence 105351-105382 11 0.656
NC_022350_15 15.10|3946600|35|NC_022350|CRT 3946600-3946634 35 MT498048 Mycobacterium phage Raymond7, complete genome 21147-21181 11 0.686
NC_022350_15 15.10|3946600|35|NC_022350|CRT 3946600-3946634 35 KF986246 Mycobacterium phage MichelleMyBell, complete genome 20761-20795 11 0.686
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_AP022333 Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence 190139-190172 12 0.647
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_CP026703 Serratia marcescens strain AR_0027 plasmid unitig_1_pilon, complete sequence 14966-14999 12 0.647
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_LR594669 Variovorax sp. SRS16 plasmid 4 302491-302524 14 0.588
NC_022350_6 6.3|1217257|34|NC_022350|CRISPRCasFinder 1217257-1217290 34 NZ_LR594673 Variovorax sp. PBL-E5 plasmid 3 282346-282379 15 0.559
NC_022350_2 2.14|341741|27|NC_022350|CRT 341741-341767 27 MK433264 Gordonia phage Tiamoceli, complete genome 33129-33155 16 0.407
NC_022350_2 2.14|341741|27|NC_022350|CRT 341741-341767 27 KR053200 Gordonia phage GTE6, complete genome 32793-32819 16 0.407

1. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to MN369739 (Mycobacterium phage Kenuha5, complete genome) position: , mismatch: 0, identity: 1.0

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcgtcggcggtgtc	Protospacer
**********************

2. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to MK359343 (Mycobacterium phage Pollywog, complete genome) position: , mismatch: 0, identity: 1.0

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcgtcggcggtgtc	Protospacer
**********************

3. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to MG925354 (Mycobacterium phage Ogopogo, complete genome) position: , mismatch: 0, identity: 1.0

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcgtcggcggtgtc	Protospacer
**********************

4. spacer 6.7|1217494|22|NC_022350|CRISPRCasFinder matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 1, identity: 0.955

tgtcggcggtgccggcggtgtc	CRISPR spacer
tgtcggcggtgccggcggtgcc	Protospacer
********************.*

5. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

6. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

7. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

8. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

9. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

10. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

11. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

12. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

13. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

14. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

15. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

16. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

17. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

18. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

19. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

20. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

21. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

22. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

23. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

24. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

25. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

26. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

27. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

28. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

29. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

30. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

31. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

32. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

33. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

34. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

35. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

36. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

37. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

38. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

39. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

40. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to MT522000 (Mycobacterium phage Soul22, complete genome) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcgtcggcggcgtc	Protospacer
******************.***

41. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to NC_042030 (Mycobacterium phage Yoshi, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcgtcggcggcgtc	Protospacer
******************.***

42. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to NC_048729 (Mycobacterium phage Renaud18, complete genome) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcgtcggcggcgtc	Protospacer
******************.***

43. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to NC_026585 (Mycobacteriophage Estave1, complete genome) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcgtcggcggcgtc	Protospacer
******************.***

44. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to DQ398049 (Mycobacterium phage Pipefish, complete genome) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cggcggcggcgtcggcggtgtc	Protospacer
** *******************

45. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to MH077585 (Mycobacterium phage TChen, complete genome) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcgtcggcggcgtc	Protospacer
******************.***

46. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to NC_048788 (Mycobacterium phage ThetaBob, complete genome) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcgtcggcggcgtc	Protospacer
******************.***

47. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

48. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

49. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to NC_014753 (Oceanithermus profundus DSM 14977 plasmid pOCEPR01, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcgtcggcggcgtc	Protospacer
******************.***

50. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to NC_021056 (Streptomyces sp. PAMC 26508 plasmid pSP01, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggtgtcggcggtgtc	Protospacer
*********.************

51. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to NZ_LR134465 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcgtcgccggtgtc	Protospacer
************** *******

52. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

53. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

54. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

55. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

56. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

57. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

58. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

59. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

60. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

61. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

62. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to MN369761 (Mycobacterium phage Malthus, complete genome) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcgtcggcggcgtc	Protospacer
******************.***

63. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to KJ944841 (Mycobacterium phage Cheetobro, complete genome) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcgtcggcggcgtc	Protospacer
******************.***

64. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to AP018469 (Mycobacterium phage Y10 DNA, complete genome, note: sample1) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcgtcggcggcgtc	Protospacer
******************.***

65. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to KY087992 (Mycobacterium phage Mitti, complete genome) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcgtcggcggcgtc	Protospacer
******************.***

66. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to MF140402 (Mycobacterium phage Chancellor, complete genome) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcgtcggcggcgtc	Protospacer
******************.***

67. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to AP018470 (Mycobacterium phage Y2 DNA, complete genome) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcgtcggcggcgtc	Protospacer
******************.***

68. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to KT361920 (Mycobacterium phage Slarp, complete genome) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcgtcggcggcgtc	Protospacer
******************.***

69. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to MH926058 (Mycobacterium phage Reptar3000, complete genome) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcgtcggcggcgtc	Protospacer
******************.***

70. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to MT310882 (Mycobacterium phage JF1, complete genome) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcgtcggcggcgtc	Protospacer
******************.***

71. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to AP018471 (Mycobacterium phage Y10 DNA, complete genome, note: sample2) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcgtcggcggcgtc	Protospacer
******************.***

72. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to MF140435 (Mycobacterium phage Wintermute, complete genome) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcgtcggcggcgtc	Protospacer
******************.***

73. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to NC_027365 (Mycobacterium virus Fionnbarth, complete genome) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcgtcggcggcgtc	Protospacer
******************.***

74. spacer 7.4|1573006|22|NC_022350|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 1, identity: 0.955

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggccggcggcc	Protospacer
********************* 

75. spacer 7.4|1573006|22|NC_022350|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggccggcggcc	Protospacer
********************* 

76. spacer 7.4|1573006|22|NC_022350|CRISPRCasFinder matches to NZ_CP016457 (Sphingobium sp. RAC03 plasmid pBSY17_2, complete sequence) position: , mismatch: 1, identity: 0.955

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcgggccggcggca	Protospacer
**********.***********

77. spacer 7.15|1573825|22|NC_022350|CRISPRCasFinder matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.955

caatccggcggcgccgccggca	CRISPR spacer
caattcggcggcgccgccggca	Protospacer
****.*****************

78. spacer 7.15|1573825|22|NC_022350|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

caatccggcggcgccgccggca	CRISPR spacer
caattcggcggcgccgccggca	Protospacer
****.*****************

79. spacer 7.15|1573825|22|NC_022350|CRISPRCasFinder matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 1, identity: 0.955

caatccggcggcgccgccggca	CRISPR spacer
caattcggcggcgccgccggca	Protospacer
****.*****************

80. spacer 7.15|1573825|22|NC_022350|CRISPRCasFinder matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 1, identity: 0.955

caatccggcggcgccgccggca	CRISPR spacer
caattcggcggcgccgccggca	Protospacer
****.*****************

81. spacer 6.7|1217494|22|NC_022350|CRISPRCasFinder matches to NZ_CP049249 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence) position: , mismatch: 2, identity: 0.909

tgtcggcggtgccggcggtgtc	CRISPR spacer
tgtcggcggtgccggcggtggg	Protospacer
********************  

82. spacer 6.7|1217494|22|NC_022350|CRISPRCasFinder matches to NC_015314 (Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence) position: , mismatch: 2, identity: 0.909

tgtcggcggtgccggcggtgtc	CRISPR spacer
agtcggcggtgccgacggtgtc	Protospacer
 *************.*******

83. spacer 6.7|1217494|22|NC_022350|CRISPRCasFinder matches to NZ_CP030772 (Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence) position: , mismatch: 2, identity: 0.909

tgtcggcggtgccggcggtgtc	CRISPR spacer
cgtcggcggtgccggcggcgtc	Protospacer
.*****************.***

84. spacer 6.7|1217494|22|NC_022350|CRISPRCasFinder matches to NC_021056 (Streptomyces sp. PAMC 26508 plasmid pSP01, complete sequence) position: , mismatch: 2, identity: 0.909

tgtcggcggtgccggcggtgtc	CRISPR spacer
cgtcggcggtgtcggcggtgtc	Protospacer
.**********.**********

85. spacer 6.7|1217494|22|NC_022350|CRISPRCasFinder matches to NZ_CP045122 (Rubrobacter sp. SCSIO 52915 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.909

tgtcggcggtgccggcggtgtc	CRISPR spacer
ggtcggcggtgccggcggcgtc	Protospacer
 *****************.***

86. spacer 6.7|1217494|22|NC_022350|CRISPRCasFinder matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 2, identity: 0.909

tgtcggcggtgccggcggtgtc	CRISPR spacer
tgtcggcggtgccggccgtgta	Protospacer
**************** **** 

87. spacer 6.7|1217494|22|NC_022350|CRISPRCasFinder matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 2, identity: 0.909

tgtcggcggtgccggcggtgtc	CRISPR spacer
tgtcggcggtgccggccgtgta	Protospacer
**************** **** 

88. spacer 6.7|1217494|22|NC_022350|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 2, identity: 0.909

tgtcggcggtgccggcggtgtc	CRISPR spacer
ggtcggcggtgccggccgtgtc	Protospacer
 *************** *****

89. spacer 6.7|1217494|22|NC_022350|CRISPRCasFinder matches to NC_047977 (Microbacterium phage Hendrix, complete genome) position: , mismatch: 2, identity: 0.909

tgtcggcggtgccggcggtgtc	CRISPR spacer
tgacggcggtgccggcggtgtg	Protospacer
** ****************** 

90. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909

cgtcggcggcgtcggcggtgtc	CRISPR spacer
ggtcggcggcgtcggcggtgta	Protospacer
 ******************** 

91. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to NC_008271 (Rhodococcus jostii RHA1 plasmid pRHL3, complete sequence) position: , mismatch: 2, identity: 0.909

cgtcggcggcgtcggcggtgtc	CRISPR spacer
tgtcggcggcgtcgacggtgtc	Protospacer
.*************.*******

92. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.909

cgtcggcggcgtcggcggtgtc	CRISPR spacer
ggtcggcggcgtcggcggtgcc	Protospacer
 *******************.*

93. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 2, identity: 0.909

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcgtcggcggcgtg	Protospacer
******************.** 

94. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 2, identity: 0.909

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcgtcggcggcgtt	Protospacer
******************.**.

95. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 2, identity: 0.909

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcgtcggcggcgtt	Protospacer
******************.**.

96. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to NC_041989 (Mycobacterium phage Shauna1, complete genome) position: , mismatch: 2, identity: 0.909

cgtcggcggcgtcggcggtgtc	CRISPR spacer
ggtcggcggcgtcggcggcgtc	Protospacer
 *****************.***

97. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to MT889380 (Mycobacterium phage Coco12, complete genome) position: , mismatch: 2, identity: 0.909

cgtcggcggcgtcggcggtgtc	CRISPR spacer
ggtcggcggcgtcggcggcgtc	Protospacer
 *****************.***

98. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to KY702574 (Mycobacterium phage Kingsley, complete genome) position: , mismatch: 2, identity: 0.909

cgtcggcggcgtcggcggtgtc	CRISPR spacer
ggtcggcggcgtcggcggcgtc	Protospacer
 *****************.***

99. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to MT114167 (Mycobacterium phage Phanphagia, complete genome) position: , mismatch: 2, identity: 0.909

cgtcggcggcgtcggcggtgtc	CRISPR spacer
ggtcggcggcgtcggcggcgtc	Protospacer
 *****************.***

100. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 2, identity: 0.909

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcgtcggcggcgtt	Protospacer
******************.**.

101. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to NZ_CP015530 (Rhodococcus sp. WB1 plasmid pWB1, complete sequence) position: , mismatch: 2, identity: 0.909

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcgtcgccggtgtg	Protospacer
************** ****** 

102. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 2, identity: 0.909

cgtcggcggcgtcggcggtgtc	CRISPR spacer
tgtcggcggcggcggcggtgtc	Protospacer
.********** **********

103. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 2, identity: 0.909

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcgtcggcggcgtt	Protospacer
******************.**.

104. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to NZ_CP034156 (Rhodococcus sp. NJ-530 plasmid unnamed4, complete sequence) position: , mismatch: 2, identity: 0.909

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcgtcgtcggtgtg	Protospacer
************** ****** 

105. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to MF541410 (Streptomyces phage Ozzie, complete genome) position: , mismatch: 2, identity: 0.909

cgtcggcggcgtcggcggtgtc	CRISPR spacer
ggttggcggcgtcggcggtgtc	Protospacer
 **.******************

106. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to MF541403 (Streptomyces phage BeardedLady, complete genome) position: , mismatch: 2, identity: 0.909

cgtcggcggcgtcggcggtgtc	CRISPR spacer
ggttggcggcgtcggcggtgtc	Protospacer
 **.******************

107. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to NC_028892 (Streptomyces phage Caliburn, complete genome) position: , mismatch: 2, identity: 0.909

cgtcggcggcgtcggcggtgtc	CRISPR spacer
ggttggcggcgtcggcggtgtc	Protospacer
 **.******************

108. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to MF541409 (Streptomyces phage Oliynyk, complete genome) position: , mismatch: 2, identity: 0.909

cgtcggcggcgtcggcggtgtc	CRISPR spacer
ggttggcggcgtcggcggtgtc	Protospacer
 **.******************

109. spacer 6.16|1217932|22|NC_022350|CRISPRCasFinder matches to KT124229 (Streptomyces phage Hydra, complete genome) position: , mismatch: 2, identity: 0.909

cgtcggcggcgtcggcggtgtc	CRISPR spacer
ggttggcggcgtcggcggtgtc	Protospacer
 **.******************

110. spacer 7.2|1572898|22|NC_022350|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909

gttgccgattaggacggcggcc	CRISPR spacer
cttgccgatcaggacggcggcc	Protospacer
 ********.************

111. spacer 7.2|1572898|22|NC_022350|CRISPRCasFinder matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 2, identity: 0.909

gttgccgattaggacggcggcc	CRISPR spacer
cttgccgatcaggacggcggcc	Protospacer
 ********.************

112. spacer 7.2|1572898|22|NC_022350|CRISPRCasFinder matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909

gttgccgattaggacggcggcc	CRISPR spacer
cttgccgatcaggacggcggcc	Protospacer
 ********.************

113. spacer 7.2|1572898|22|NC_022350|CRISPRCasFinder matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909

gttgccgattaggacggcggcc	CRISPR spacer
cttgccgatcaggacggcggcc	Protospacer
 ********.************

114. spacer 7.2|1572898|22|NC_022350|CRISPRCasFinder matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 2, identity: 0.909

gttgccgattaggacggcggcc	CRISPR spacer
cttgccgatcaggacggcggcc	Protospacer
 ********.************

115. spacer 7.3|1572952|22|NC_022350|CRISPRCasFinder matches to NZ_CP025510 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvD, complete sequence) position: , mismatch: 2, identity: 0.909

ggtaccgtcctcgccggcggtg	CRISPR spacer
ggcaccgtcctcgccggcggtt	Protospacer
**.****************** 

116. spacer 7.4|1573006|22|NC_022350|CRISPRCasFinder matches to NZ_CP021032 (Rhizobium sp. NXC14 plasmid pRspNXC14b, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
atcgccgatcaggccggcggcc	Protospacer
.******************** 

117. spacer 7.4|1573006|22|NC_022350|CRISPRCasFinder matches to NC_007765 (Rhizobium etli CFN 42 plasmid p42e, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
atcgccgatcaggccggcggcg	Protospacer
.********************.

118. spacer 7.4|1573006|22|NC_022350|CRISPRCasFinder matches to NZ_CP021028 (Rhizobium sp. TAL182 plasmid pRetTAL182d, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
atcgccgatcaggccggcggcg	Protospacer
.********************.

119. spacer 7.4|1573006|22|NC_022350|CRISPRCasFinder matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
atcgccgatcaggccggcggcc	Protospacer
.******************** 

120. spacer 7.4|1573006|22|NC_022350|CRISPRCasFinder matches to NZ_CP013503 (Rhizobium esperanzae strain N561 plasmid pRspN561c, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
atcgccgatcaggccggcggcg	Protospacer
.********************.

121. spacer 7.4|1573006|22|NC_022350|CRISPRCasFinder matches to NZ_CP013509 (Rhizobium sp. N1341 plasmid pRspN1341d, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
atcgccgatcaggccggcggcg	Protospacer
.********************.

122. spacer 7.4|1573006|22|NC_022350|CRISPRCasFinder matches to NZ_CP013520 (Rhizobium sp. N113 plasmid pRspN113c, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
atcgccgatcaggccggcggcg	Protospacer
.********************.

123. spacer 7.4|1573006|22|NC_022350|CRISPRCasFinder matches to NZ_CP013493 (Rhizobium sp. N6212 plasmid pRspN6212c, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
atcgccgatcaggccggcggcg	Protospacer
.********************.

124. spacer 7.4|1573006|22|NC_022350|CRISPRCasFinder matches to NZ_CP013516 (Rhizobium sp. N1314 plasmid pRspN1314e, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
atcgccgatcaggccggcggcg	Protospacer
.********************.

125. spacer 7.4|1573006|22|NC_022350|CRISPRCasFinder matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggccggcgggg	Protospacer
******************** .

126. spacer 7.4|1573006|22|NC_022350|CRISPRCasFinder matches to NZ_CP012698 (Microbacterium sp. No. 7 plasmid A, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
accgccgatcaggccggcggca	Protospacer
..********************

127. spacer 7.4|1573006|22|NC_022350|CRISPRCasFinder matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
ctcggcgatcaggccggcggca	Protospacer
 *** *****************

128. spacer 7.4|1573006|22|NC_022350|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatccggccggcggct	Protospacer
********** ********** 

129. spacer 7.4|1573006|22|NC_022350|CRISPRCasFinder matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggccgggggcc	Protospacer
***************** *** 

130. spacer 7.4|1573006|22|NC_022350|CRISPRCasFinder matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggccgggggcc	Protospacer
***************** *** 

131. spacer 7.4|1573006|22|NC_022350|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatccggccggcggct	Protospacer
********** ********** 

132. spacer 7.4|1573006|22|NC_022350|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggccgggggcg	Protospacer
***************** ***.

133. spacer 7.4|1573006|22|NC_022350|CRISPRCasFinder matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
ggcgccgatcaggccggcggcc	Protospacer
* ******************* 

134. spacer 7.4|1573006|22|NC_022350|CRISPRCasFinder matches to NZ_CP054029 (Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggcctgcggcg	Protospacer
*************** *****.

135. spacer 7.4|1573006|22|NC_022350|CRISPRCasFinder matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatccggccggcggct	Protospacer
********** ********** 

136. spacer 7.4|1573006|22|NC_022350|CRISPRCasFinder matches to NZ_CP024312 (Rhizobium sp. NXC24 plasmid pRspNXC24a, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggccggcgccg	Protospacer
******************* *.

137. spacer 7.4|1573006|22|NC_022350|CRISPRCasFinder matches to CP042595 (Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgagcaggccggcggcc	Protospacer
******** ************ 

138. spacer 7.4|1573006|22|NC_022350|CRISPRCasFinder matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggccgggggcc	Protospacer
***************** *** 

139. spacer 7.5|1573060|25|NC_022350|CRISPRCasFinder matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92

cttgccgaacacgccgaagccgtcg	CRISPR spacer
cttgccgaacccgccgaacccgtcg	Protospacer
********** ******* ******

140. spacer 7.5|1573060|25|NC_022350|CRISPRCasFinder matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92

cttgccgaacacgccgaagccgtcg	CRISPR spacer
cttgccgaacccgccgaacccgtcg	Protospacer
********** ******* ******

141. spacer 7.5|1573060|25|NC_022350|CRISPRCasFinder matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92

cttgccgaacacgccgaagccgtcg	CRISPR spacer
cttgccgaacccgccgaacccgtcg	Protospacer
********** ******* ******

142. spacer 15.11|3946672|26|NC_022350|CRT matches to NC_023695 (Mycobacterium phage Violet, complete genome) position: , mismatch: 2, identity: 0.923

accggcggcaaaggcggcatgggcgg	CRISPR spacer
accggcggcaaaggcggcaacggcgg	Protospacer
*******************  *****

143. spacer 2.8|341396|27|NC_022350|CRT matches to NZ_CP042265 (Litoreibacter sp. LN3S51 plasmid unnamed4, complete sequence) position: , mismatch: 3, identity: 0.889

-gcgccgaacagcccgccagagccgcca	CRISPR spacer
tgcg-cgaacaacccgccagaaccgcca	Protospacer
 *** ******.*********.******

144. spacer 2.14|341741|27|NC_022350|CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 3, identity: 0.889

ttgccgatgagcccgccggcgccgccg	CRISPR spacer
tcgccgatcagcccgccggcgacgccg	Protospacer
*.****** ************ *****

145. spacer 2.14|341741|27|NC_022350|CRT matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 3, identity: 0.889

ttgccgatgagcccgccggcgccgccg	CRISPR spacer
tcgccgatcagcccgccggcgacgccg	Protospacer
*.****** ************ *****

146. spacer 2.14|341741|27|NC_022350|CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 3, identity: 0.889

ttgccgatgagcccgccggcgccgccg	CRISPR spacer
tcgccgatcagcccgccggcgacgccg	Protospacer
*.****** ************ *****

147. spacer 5.16|930834|24|NC_022350|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
gaccgacctcggcggcgcgggcga	Protospacer
.***************** ****.

148. spacer 5.16|930834|24|NC_022350|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
caccggcctgggcggcgctggcgg	Protospacer
 ****.*** **************

149. spacer 5.16|930834|24|NC_022350|CRT matches to NZ_CP034768 (Enterobacter sp. N18-03635 plasmid pFRI-6, complete sequence) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
taacgtcctcggcggcgctggcgg	Protospacer
 * ** ******************

150. spacer 5.16|930834|24|NC_022350|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
agccgacctcggcggcgatggcgc	Protospacer
*.*************** ***** 

151. spacer 5.16|930834|24|NC_022350|CRT matches to NZ_AP019631 (Enterobacter asburiae strain 17Nkhm-UP2 plasmid pEAS17Nkhm-UP2-1, complete sequence) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
taacgtcctcggcggcgctggcgg	Protospacer
 * ** ******************

152. spacer 5.16|930834|24|NC_022350|CRT matches to NZ_AP019631 (Enterobacter asburiae strain 17Nkhm-UP2 plasmid pEAS17Nkhm-UP2-1, complete sequence) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
taacgtcctcggcggcgctggcgg	Protospacer
 * ** ******************

153. spacer 5.16|930834|24|NC_022350|CRT matches to KU716094 (Mycobacterium phage Eidsmoe, complete genome) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
gaccgcgctcggcggcgctggcgg	Protospacer
.****  *****************

154. spacer 5.16|930834|24|NC_022350|CRT matches to MH371122 (Mycobacterium phage Priya, complete genome) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
gaccgcgctcggcggcgctggcgg	Protospacer
.****  *****************

155. spacer 5.16|930834|24|NC_022350|CRT matches to MK016502 (Mycobacterium phage Pat3, complete genome) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
catcggcctcggcggcgctggcgg	Protospacer
 *.**.******************

156. spacer 5.16|930834|24|NC_022350|CRT matches to MK937593 (Mycobacterium phage Flypotenuse, complete genome) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
catcggcctcggcggcgctggcgg	Protospacer
 *.**.******************

157. spacer 5.16|930834|24|NC_022350|CRT matches to MG872835 (Mycobacterium phage Conquerage, complete genome) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
gaccgcgctcggcggcgctggcgg	Protospacer
.****  *****************

158. spacer 5.16|930834|24|NC_022350|CRT matches to MH536820 (Mycobacterium phage Glexan, complete genome) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
catcggcctcggcggcgctggcgg	Protospacer
 *.**.******************

159. spacer 5.16|930834|24|NC_022350|CRT matches to NC_010510 (Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
aaccggcctcggcggcgctgccgc	Protospacer
*****.************** ** 

160. spacer 5.16|930834|24|NC_022350|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
caccgagctcggcggcgctgccgg	Protospacer
 ***** ************* ***

161. spacer 5.16|930834|24|NC_022350|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
caccggcctcggcggcgcgggcgg	Protospacer
 ****.************ *****

162. spacer 5.16|930834|24|NC_022350|CRT matches to MH271298 (Microbacterium phage Floof, complete genome) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
aacccacctcggcggcgatggcgc	Protospacer
**** ************ ***** 

163. spacer 6.4|1217314|25|NC_022350|CRISPRCasFinder matches to MN703413 (Arthrobacter phage Powerpuff, complete genome) position: , mismatch: 3, identity: 0.88

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgcgggcggcctcggcgtagcgctt	Protospacer
*** *******************..

164. spacer 6.4|1217314|25|NC_022350|CRISPRCasFinder matches to MT024871 (Arthrobacter phage YesChef, complete genome) position: , mismatch: 3, identity: 0.88

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgcgggcggcctcggcgtagcgctt	Protospacer
*** *******************..

165. spacer 6.7|1217494|22|NC_022350|CRISPRCasFinder matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 3, identity: 0.864

tgtcggcggtgccggcggtgtc	CRISPR spacer
cgtcggcggtgccggcggtgag	Protospacer
.*******************  

166. spacer 6.7|1217494|22|NC_022350|CRISPRCasFinder matches to NZ_CP040721 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.864

tgtcggcggtgccggcggtgtc	CRISPR spacer
gtgcggcggtgccggcggtgtc	Protospacer
   *******************

167. spacer 6.7|1217494|22|NC_022350|CRISPRCasFinder matches to NZ_CP040721 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.864

tgtcggcggtgccggcggtgtc	CRISPR spacer
gtgcggcggtgccggcggtgtc	Protospacer
   *******************

168. spacer 6.7|1217494|22|NC_022350|CRISPRCasFinder matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 3, identity: 0.864

tgtcggcggtgccggcggtgtc	CRISPR spacer
cgtcggcggtgccggcggtgag	Protospacer
.*******************  

169. spacer 6.7|1217494|22|NC_022350|CRISPRCasFinder matches to NZ_CP021082 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence) position: , mismatch: 3, identity: 0.864

tgtcggcggtgccggcggtgtc	CRISPR spacer
cgtcggcggtgccggcggtggt	Protospacer
.******************* .

170. spacer 6.7|1217494|22|NC_022350|CRISPRCasFinder matches to KT381864 (Thiobacimonas phage vB_ThpS-P1, complete genome) position: , mismatch: 3, identity: 0.864

tgtcggcggtgccggcggtgtc	CRISPR spacer
catcggcggtgccggcggtgtg	Protospacer
..******************* 

171. spacer 6.11|1217677|22|NC_022350|CRISPRCasFinder matches to NZ_CP048287 (Paenibacillus sp. 14171R-81 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.864

gctgtggggcggcggtggtgcc	CRISPR spacer
cgtgtggggcggcggtggtgca	Protospacer
  ******************* 

172. spacer 7.4|1573006|22|NC_022350|CRISPRCasFinder matches to NZ_KY349138 (Mycolicibacterium sp. CBMA 213 plasmid pCBMA213_2, complete sequence) position: , mismatch: 3, identity: 0.864

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggccggcgcgg	Protospacer
*******************  .

173. spacer 7.4|1573006|22|NC_022350|CRISPRCasFinder matches to NZ_CP021649 (Acidovorax sp. T1 plasmid p1-T1, complete sequence) position: , mismatch: 3, identity: 0.864

gtcgccgatcaggccggcggca	CRISPR spacer
ttcgccgatcaggccggcggtg	Protospacer
 *******************..

174. spacer 7.5|1573060|25|NC_022350|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.88

cttgccgaacacgccgaagccgtcg	CRISPR spacer
ctcgccgaacacgcggaagccgtct	Protospacer
**.*********** ********* 

175. spacer 7.5|1573060|25|NC_022350|CRISPRCasFinder matches to NZ_CP022999 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence) position: , mismatch: 3, identity: 0.88

cttgccgaacacgccgaagccgtcg	CRISPR spacer
attgtcgaacacgcggaagccgtcg	Protospacer
 ***.********* **********

176. spacer 7.5|1573060|25|NC_022350|CRISPRCasFinder matches to MN586053 (Arthrobacter phage BeatusComedenti, complete genome) position: , mismatch: 3, identity: 0.88

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gttgccgaactcgccgaagccgttg	Protospacer
 ********* ************.*

177. spacer 7.5|1573060|25|NC_022350|CRISPRCasFinder matches to NC_031254 (Arthrobacter phage Kitkat, complete genome) position: , mismatch: 3, identity: 0.88

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gttgccgaactcgccgaagccgttg	Protospacer
 ********* ************.*

178. spacer 7.5|1573060|25|NC_022350|CRISPRCasFinder matches to NC_031231 (Arthrobacter phage KellEzio, complete genome) position: , mismatch: 3, identity: 0.88

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gttgccgaactcgccgaagccgttg	Protospacer
 ********* ************.*

179. spacer 7.5|1573060|25|NC_022350|CRISPRCasFinder matches to NC_021289 (Burkholderia insecticola plasmid p1, complete sequence) position: , mismatch: 3, identity: 0.88

cttgccgaacacgccgaagccgtcg	CRISPR spacer
catgcggaacacgccgaatccgtcg	Protospacer
* *** ************ ******

180. spacer 7.5|1573060|25|NC_022350|CRISPRCasFinder matches to NZ_CP030129 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.88

cttgccgaacacgccgaagccgtcg	CRISPR spacer
cttgccgatcacgccgtagccgttg	Protospacer
******** ******* ******.*

181. spacer 7.15|1573825|22|NC_022350|CRISPRCasFinder matches to NC_008270 (Rhodococcus jostii RHA1 plasmid pRHL2, complete sequence) position: , mismatch: 3, identity: 0.864

caatccggcggcgccgccggca	CRISPR spacer
gaatccggcggcgccgccgggc	Protospacer
 *******************  

182. spacer 8.5|2087748|24|NC_022350|CRT matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 3, identity: 0.875

atcgaagaagctgaacccgccgtt	CRISPR spacer
cgcgaagaagctgaagccgccgtt	Protospacer
  ************* ********

183. spacer 8.5|2087748|24|NC_022350|CRT matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 3, identity: 0.875

atcgaagaagctgaacccgccgtt	CRISPR spacer
cgcgaagaagctgaagccgccgtt	Protospacer
  ************* ********

184. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP054029 (Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence) position: , mismatch: 3, identity: 0.885

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ctcggcggcaaaggcggcattggcgg	Protospacer
 .****************** *****

185. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP022541 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-1, complete sequence) position: , mismatch: 3, identity: 0.885

accggcggcaaaggcggcatgggcgg	CRISPR spacer
cccggcggcaaaggcgcaatgggcgg	Protospacer
 ***************  ********

186. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP014276 (Martelella sp. AD-3 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.885

accggcggcaaaggcggcatgggcgg	CRISPR spacer
atcggcggcaagggcggcatggccgg	Protospacer
*.*********.********** ***

187. spacer 15.11|3946672|26|NC_022350|CRT matches to MN585973 (Mycobacterium phage StAnnes, complete genome) position: , mismatch: 3, identity: 0.885

accggcggcaaaggcggcatgggcgg	CRISPR spacer
aacggcggcaacggcggcaagggcgg	Protospacer
* ********* ******* ******

188. spacer 15.11|3946672|26|NC_022350|CRT matches to MG944221 (Mycobacterium phage Scowl, complete genome) position: , mismatch: 3, identity: 0.885

accggcggcaaaggcggcatgggcgg	CRISPR spacer
aacggcggcaacggcggcaagggcgg	Protospacer
* ********* ******* ******

189. spacer 15.11|3946672|26|NC_022350|CRT matches to KT309034 (Mycobacterium phage Dante, complete genome) position: , mismatch: 3, identity: 0.885

accggcggcaaaggcggcatgggcgg	CRISPR spacer
aacggcggcaacggcggcaagggcgg	Protospacer
* ********* ******* ******

190. spacer 15.11|3946672|26|NC_022350|CRT matches to NC_021538 (Mycobacterium phage Job42, complete genome) position: , mismatch: 3, identity: 0.885

accggcggcaaaggcggcatgggcgg	CRISPR spacer
aacggcggcaacggcggcaagggcgg	Protospacer
* ********* ******* ******

191. spacer 15.11|3946672|26|NC_022350|CRT matches to NC_026584 (Mycobacterium phage Minerva, complete genome) position: , mismatch: 3, identity: 0.885

accggcggcaaaggcggcatgggcgg	CRISPR spacer
aacggcggcaacggcggcaagggcgg	Protospacer
* ********* ******* ******

192. spacer 15.11|3946672|26|NC_022350|CRT matches to KJ409696 (Mycobacterium phage Lamina13, complete genome) position: , mismatch: 3, identity: 0.885

accggcggcaaaggcggcatgggcgg	CRISPR spacer
aacggcggcaacggcggcaggggcgg	Protospacer
* ********* ******* ******

193. spacer 15.11|3946672|26|NC_022350|CRT matches to NC_028784 (Mycobacterium phage Tasp14, complete genome) position: , mismatch: 3, identity: 0.885

accggcggcaaaggcggcatgggcgg	CRISPR spacer
aacggcggcaacggcggcaggggcgg	Protospacer
* ********* ******* ******

194. spacer 2.8|341396|27|NC_022350|CRT matches to MN617843 (Mycobacterium phage Quesadilla, complete genome) position: , mismatch: 4, identity: 0.852

gcgccgaacagcccgccagagccgcca	CRISPR spacer
ccgccgaacagcccgccaccgccgccg	Protospacer
 *****************  ******.

195. spacer 2.14|341741|27|NC_022350|CRT matches to NC_014818 (Asticcacaulis excentricus CB 48 plasmid pASTEX01, complete sequence) position: , mismatch: 4, identity: 0.852

ttgccgatgagcccgccggcgccgccg	CRISPR spacer
ttgccgatcagcccgccggctccgcgc	Protospacer
******** *********** ****  

196. spacer 2.14|341741|27|NC_022350|CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.852

ttgccgatgagcccgccggcgccgccg	CRISPR spacer
ccgccgatgagccagtcggcgccgccg	Protospacer
..*********** *.***********

197. spacer 2.14|341741|27|NC_022350|CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.852

ttgccgatgagcccgccggcgccgccg	CRISPR spacer
ccgccgatgagccggtcggcgccgccg	Protospacer
..*********** *.***********

198. spacer 2.14|341741|27|NC_022350|CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 4, identity: 0.852

ttgccgatgagcccgccggcgccgccg	CRISPR spacer
cggccgatgagcccgacgacgccgccg	Protospacer
. ************* **.********

199. spacer 2.14|341741|27|NC_022350|CRT matches to MK392366 (Streptomyces phage Janus, complete genome) position: , mismatch: 4, identity: 0.852

ttgccgatgagcccgccggcgccgccg	CRISPR spacer
atgccgatgaggccgcccgcgccgcca	Protospacer
 ********** ***** ********.

200. spacer 2.14|341741|27|NC_022350|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 4, identity: 0.852

ttgccgatgagcccgccggcgccgccg	CRISPR spacer
atgttgatcagcccgccggcgccgccg	Protospacer
 **..*** ******************

201. spacer 2.14|341741|27|NC_022350|CRT matches to NZ_CP017079 (Novosphingobium resinovorum strain SA1 plasmid pSA4, complete sequence) position: , mismatch: 4, identity: 0.852

ttgccgatgagcccgccggcgccgccg	CRISPR spacer
tgggcgatcagcccgccagcgccgccg	Protospacer
* * **** ********.*********

202. spacer 2.14|341741|27|NC_022350|CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 4, identity: 0.852

ttgccgatgagcccgccggcgccgccg	CRISPR spacer
tcgacgatgaccccgccggcgacgccg	Protospacer
*.* ****** ********** *****

203. spacer 2.14|341741|27|NC_022350|CRT matches to NZ_CP005089 (Sphingobium sp. TKS plasmid pTK5, complete sequence) position: , mismatch: 4, identity: 0.852

ttgccgatgagcccgccggcgccgccg	CRISPR spacer
tgggcgatcagcccgccagcgccgccg	Protospacer
* * **** ********.*********

204. spacer 3.1|369657|27|NC_022350|CRISPRCasFinder matches to NC_023591 (Mycobacterium phage Adler, complete genome) position: , mismatch: 4, identity: 0.852

-aacgcaccggtgtccacatcgcccgtg	CRISPR spacer
cagtgc-ccggtgtccccatcgcccgtg	Protospacer
 *..** ********* ***********

205. spacer 3.1|369657|27|NC_022350|CRISPRCasFinder matches to KF981876 (UNVERIFIED: Mycobacterium phage ADLER F1725, complete genome) position: , mismatch: 4, identity: 0.852

-aacgcaccggtgtccacatcgcccgtg	CRISPR spacer
cagtgc-ccggtgtccccatcgcccgtg	Protospacer
 *..** ********* ***********

206. spacer 3.7|370053|27|NC_022350|CRISPRCasFinder matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 4, identity: 0.852

gcgaagccgatgttgtagctgccggtg	CRISPR spacer
ccgaagccgatgtcgtagcggccggcg	Protospacer
 ************.***** *****.*

207. spacer 3.10|370263|27|NC_022350|CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.852

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgaaggtgaggtcgccgggg	Protospacer
.* ********* ***********.**

208. spacer 3.10|370263|27|NC_022350|CRISPRCasFinder matches to NC_016652 (Rhodococcus phage REQ2, complete genome) position: , mismatch: 4, identity: 0.852

accccgccgaagttgaggtcgccgagg	CRISPR spacer
acggcgccgaagttgaggccgccgacg	Protospacer
**  **************.****** *

209. spacer 5.6|930393|27|NC_022350|CRT matches to NZ_CP010326 (Pantoea sp. PSNIH1 plasmid pPSP-3a9, complete sequence) position: , mismatch: 4, identity: 0.852

cgtcagcggcggggctggcggggaggg	CRISPR spacer
cgtcagcggctgggctggcggggatat	Protospacer
********** ************* . 

210. spacer 5.6|930393|27|NC_022350|CRT matches to NZ_CP021045 (Phaeobacter gallaeciensis strain P129 plasmid pP129_e, complete sequence) position: , mismatch: 4, identity: 0.852

cgtcagcggcggggctggcggggaggg	CRISPR spacer
cgacagcggcggggctggcggcgacag	Protospacer
** ****************** ** .*

211. spacer 5.6|930393|27|NC_022350|CRT matches to NZ_CP010678 (Phaeobacter gallaeciensis strain P75 plasmid pP75_e, complete sequence) position: , mismatch: 4, identity: 0.852

cgtcagcggcggggctggcggggaggg	CRISPR spacer
cgacagcggcggggctggcggcgacag	Protospacer
** ****************** ** .*

212. spacer 5.6|930393|27|NC_022350|CRT matches to NC_023142 (Phaeobacter gallaeciensis DSM 26640 plasmid pGal_F69, complete sequence) position: , mismatch: 4, identity: 0.852

cgtcagcggcggggctggcggggaggg	CRISPR spacer
cgacagcggcggggctggcggcgacag	Protospacer
** ****************** ** .*

213. spacer 5.6|930393|27|NC_022350|CRT matches to NZ_CP010789 (Phaeobacter gallaeciensis strain P63 plasmid pP63_e, complete sequence) position: , mismatch: 4, identity: 0.852

cgtcagcggcggggctggcggggaggg	CRISPR spacer
cgacagcggcggggctggcggcgacag	Protospacer
** ****************** ** .*

214. spacer 5.6|930393|27|NC_022350|CRT matches to NZ_CP010642 (Phaeobacter gallaeciensis strain P73 plasmid pP73_f, complete sequence) position: , mismatch: 4, identity: 0.852

cgtcagcggcggggctggcggggaggg	CRISPR spacer
cgacagcggcggggctggcggcgacag	Protospacer
** ****************** ** .*

215. spacer 5.6|930393|27|NC_022350|CRT matches to NZ_CP010593 (Phaeobacter gallaeciensis strain P11 plasmid pP11_e, complete sequence) position: , mismatch: 4, identity: 0.852

cgtcagcggcggggctggcggggaggg	CRISPR spacer
cgacagcggcggggctggcggcgacag	Protospacer
** ****************** ** .*

216. spacer 5.6|930393|27|NC_022350|CRT matches to AM419438 (Archaeal BJ1 virus complete genome) position: , mismatch: 4, identity: 0.852

cgtcagcggcggggctggcggggaggg	CRISPR spacer
cgtcggcggcgggggtggcgggggcgg	Protospacer
****.********* ********. **

217. spacer 5.6|930393|27|NC_022350|CRT matches to NC_008695 (Archaeal BJ1 virus, complete genome) position: , mismatch: 4, identity: 0.852

cgtcagcggcggggctggcggggaggg	CRISPR spacer
cgtcggcggcgggggtggcgggggcgg	Protospacer
****.********* ********. **

218. spacer 5.10|930549|27|NC_022350|CRT matches to KY945355 (Mycobacterium phage Shandong1, complete genome) position: , mismatch: 4, identity: 0.852

cggatccggcggcggcggtagcgttgc	CRISPR spacer
cgcatccggcggcggcggttgcgttct	Protospacer
** **************** ***** .

219. spacer 5.10|930549|27|NC_022350|CRT matches to NZ_CP015095 (Pelagibaca abyssi strain JLT2014 plasmid pPABY4, complete sequence) position: , mismatch: 4, identity: 0.852

cggatccggcggcggcggtagcgttgc	CRISPR spacer
cggcctcggcggcggcggtggcgttgc	Protospacer
*** ..*************.*******

220. spacer 5.10|930549|27|NC_022350|CRT matches to NC_041888 (Mycobacterium phage Tortellini, complete genome) position: , mismatch: 4, identity: 0.852

cggatccggcggcggcggtagcgttgc	CRISPR spacer
cggccgcggcggcggcggtagcggtgc	Protospacer
*** . ***************** ***

221. spacer 5.15|930786|30|NC_022350|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 4, identity: 0.867

cctgctgttcggctccggcggcgctggcgg-	CRISPR spacer
gctgctgttcggcgccggcggcg-tggtggc	Protospacer
 ************ ********* ***.** 

222. spacer 5.16|930834|24|NC_022350|CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
ctacgaccacggcggcgctggcgg	Protospacer
   ***** ***************

223. spacer 5.16|930834|24|NC_022350|CRT matches to NZ_CP025431 (Paracoccus zhejiangensis strain J6 plasmid pPZ01, complete sequence) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
gcccgatctcggcggcgctggcgt	Protospacer
. ****.**************** 

224. spacer 5.16|930834|24|NC_022350|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
tcccgacctcggcggtgctggcgc	Protospacer
  *************.******* 

225. spacer 5.16|930834|24|NC_022350|CRT matches to NZ_CP016822 (Rhodococcus sp. p52 plasmid pDF03, complete sequence) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
cgtcgacgtcggcggcgctggcgg	Protospacer
 ..**** ****************

226. spacer 5.16|930834|24|NC_022350|CRT matches to MN582086 (Siphoviridae sp. ctdEk19, complete genome) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
cttcgacttcggcggcgctggcgg	Protospacer
  .****.****************

227. spacer 5.16|930834|24|NC_022350|CRT matches to MF919502 (Mycobacterium phage Demsculpinboyz, complete genome) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
ccgcggcctcggcggcgctggcgg	Protospacer
   **.******************

228. spacer 5.16|930834|24|NC_022350|CRT matches to MT889380 (Mycobacterium phage Coco12, complete genome) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
ccgcggcctcggcggcgctggcgg	Protospacer
   **.******************

229. spacer 5.16|930834|24|NC_022350|CRT matches to NC_023698 (Mycobacterium phage Avani, complete genome) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
ccgcggcctcggcggcgctggcgg	Protospacer
   **.******************

230. spacer 5.16|930834|24|NC_022350|CRT matches to MT114167 (Mycobacterium phage Phanphagia, complete genome) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
ccgcggcctcggcggcgctggcgg	Protospacer
   **.******************

231. spacer 5.16|930834|24|NC_022350|CRT matches to NZ_CP050953 (Rhodococcus sp. DMU1 plasmid unnamed) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
cgccgacctcggcggcggtggcga	Protospacer
 .*************** *****.

232. spacer 5.16|930834|24|NC_022350|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
tcccgacctcggcggtgctggcgc	Protospacer
  *************.******* 

233. spacer 5.16|930834|24|NC_022350|CRT matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
ctacgaccacggcggcgctggcgg	Protospacer
   ***** ***************

234. spacer 5.16|930834|24|NC_022350|CRT matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
tctcgacctcggcggcgatggcgg	Protospacer
  .************** ******

235. spacer 5.16|930834|24|NC_022350|CRT matches to MN096355 (Mycobacterium phage Purky, complete genome) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
tgccgacctcggctgcgctggcgc	Protospacer
 .*********** ********* 

236. spacer 5.16|930834|24|NC_022350|CRT matches to MK279853 (Gordonia phage Gray, complete genome) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
ggtcgacctcgacggcgctggcgg	Protospacer
...********.************

237. spacer 6.4|1217314|25|NC_022350|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
ggccggcggcctcggcggagcgctg	Protospacer
 **************** *****. 

238. spacer 6.4|1217314|25|NC_022350|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
ggccggcggcctcggcggagcgctg	Protospacer
 **************** *****. 

239. spacer 6.4|1217314|25|NC_022350|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgtcggcggcctcgccgtagcgctt	Protospacer
**.*********** ********..

240. spacer 6.4|1217314|25|NC_022350|CRISPRCasFinder matches to CP003956 (Rhodococcus opacus PD630 plasmid 7, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
gtccggcggccttggcgtagcgcct	Protospacer
  **********.***********.

241. spacer 6.4|1217314|25|NC_022350|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgtcggcggcctcgccgtagcgctt	Protospacer
**.*********** ********..

242. spacer 6.4|1217314|25|NC_022350|CRISPRCasFinder matches to NC_012723 (Burkholderia glumae BGR1 plasmid bglu_1p, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgccggcggccccggcgtcgcgcga	Protospacer
***********.****** ****  

243. spacer 6.4|1217314|25|NC_022350|CRISPRCasFinder matches to NZ_CP032828 (Sphingomonas sp. YZ-8 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgccggcggcctcggcgtaatggtc	Protospacer
*******************..* .*

244. spacer 6.4|1217314|25|NC_022350|CRISPRCasFinder matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
cgccggcggcatcggcgtagcggcg	Protospacer
.********* *********** * 

245. spacer 6.4|1217314|25|NC_022350|CRISPRCasFinder matches to CP054917 (Streptomyces sp. NA02950 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
cgccggcggcctccgcgtcgcgcct	Protospacer
.************ **** *****.

246. spacer 6.4|1217314|25|NC_022350|CRISPRCasFinder matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
cgtcggcggcctcggcgtagcgggc	Protospacer
.*.*******************  *

247. spacer 6.4|1217314|25|NC_022350|CRISPRCasFinder matches to NC_022437 (Pseudomonas fluorescens R124 plasmid pMP-R124, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
cgccggcggccgcgtcgtagcgcca	Protospacer
.********** ** ********* 

248. spacer 6.4|1217314|25|NC_022350|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgtcggcggcctcgccgtagcgctt	Protospacer
**.*********** ********..

249. spacer 6.4|1217314|25|NC_022350|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgccggtgtcctcggcgtagcgcga	Protospacer
******.* **************  

250. spacer 6.4|1217314|25|NC_022350|CRISPRCasFinder matches to NZ_CP051294 (Mesorhizobium sp. NZP2077 plasmid pMSNZP2077A, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgccggcggcctccgcgaagcgctt	Protospacer
************* *** *****..

251. spacer 6.4|1217314|25|NC_022350|CRISPRCasFinder matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
ggccggctgcctcggcatagcgccg	Protospacer
 ****** ********.******* 

252. spacer 6.4|1217314|25|NC_022350|CRISPRCasFinder matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgtcggcggcctcgccgtagcgctt	Protospacer
**.*********** ********..

253. spacer 6.4|1217314|25|NC_022350|CRISPRCasFinder matches to NZ_CP010858 (Marinovum algicola DG 898 plasmid pMaD3) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
cgccggtggcctcggcgtagccccg	Protospacer
.*****.************** ** 

254. spacer 6.4|1217314|25|NC_022350|CRISPRCasFinder matches to NZ_CP033363 (Mesorhizobium sp. NZP2077 plasmid pMSNZP2077NSa, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgccggcggcctccgcgaagcgctt	Protospacer
************* *** *****..

255. spacer 6.4|1217314|25|NC_022350|CRISPRCasFinder matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tggcggcggcctcgccgtagcgctt	Protospacer
** *********** ********..

256. spacer 6.4|1217314|25|NC_022350|CRISPRCasFinder matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
cgtcggcggcctcggcgtagcggac	Protospacer
.*.*******************  *

257. spacer 6.4|1217314|25|NC_022350|CRISPRCasFinder matches to NZ_CP014580 (Burkholderia sp. OLGA172 plasmid pOLGA1, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
agccggcggcctcggcctcgcgccg	Protospacer
 *************** * ***** 

258. spacer 6.4|1217314|25|NC_022350|CRISPRCasFinder matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgtcggcggcctcgccgtagcgctt	Protospacer
**.*********** ********..

259. spacer 7.1|1572838|28|NC_022350|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 4, identity: 0.857

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
gccgccgggggtgccctcgttgccgggc	Protospacer
*..************ ********** *

260. spacer 7.1|1572838|28|NC_022350|CRISPRCasFinder matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 4, identity: 0.857

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
gccgccgggggtgccctcgttgccgggc	Protospacer
*..************ ********** *

261. spacer 7.1|1572838|28|NC_022350|CRISPRCasFinder matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 4, identity: 0.857

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
gccgccgggggtgccctcgttgccgggc	Protospacer
*..************ ********** *

262. spacer 7.5|1573060|25|NC_022350|CRISPRCasFinder matches to NZ_CP021372 (Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence) position: , mismatch: 4, identity: 0.84

cttgccgaacacgccgaagccgtcg	CRISPR spacer
tccgccgaacgcgccgaagccgtcg	Protospacer
...*******.**************

263. spacer 7.5|1573060|25|NC_022350|CRISPRCasFinder matches to LR134127 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7) position: , mismatch: 4, identity: 0.84

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gctgccgaacacgccgatgccgacg	Protospacer
 .*************** **** **

264. spacer 7.5|1573060|25|NC_022350|CRISPRCasFinder matches to LR134127 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7) position: , mismatch: 4, identity: 0.84

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gctgccgaacacgccgatgccgacg	Protospacer
 .*************** **** **

265. spacer 7.5|1573060|25|NC_022350|CRISPRCasFinder matches to MT553342 (Microbacterium phage Kelcole, complete genome) position: , mismatch: 4, identity: 0.84

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gatgctgatcacgccgaagccgtcg	Protospacer
  ***.** ****************

266. spacer 7.5|1573060|25|NC_022350|CRISPRCasFinder matches to NC_048068 (Microbacterium phage OneinaGillian, complete genome) position: , mismatch: 4, identity: 0.84

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gatgctgatcacgccgaagccgtcg	Protospacer
  ***.** ****************

267. spacer 7.5|1573060|25|NC_022350|CRISPRCasFinder matches to MT310894 (Microbacterium phage Tempo, complete genome) position: , mismatch: 4, identity: 0.84

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gatgctgatcacgccgaagccgtcg	Protospacer
  ***.** ****************

268. spacer 7.5|1573060|25|NC_022350|CRISPRCasFinder matches to NZ_CP047175 (Rathayibacter sp. VKM Ac-2760 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.84

cttgccgaacacgccgaagccgtcg	CRISPR spacer
cttgccgaacacgccgatgccctgc	Protospacer
***************** *** *  

269. spacer 7.5|1573060|25|NC_022350|CRISPRCasFinder matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 4, identity: 0.84

cttgccgaacacgccgaagccgtcg	CRISPR spacer
aatgccgaattcgccgaagccgtcg	Protospacer
  *******. **************

270. spacer 7.5|1573060|25|NC_022350|CRISPRCasFinder matches to MN034284 (Leviviridae sp. isolate H2_Rhizo_Litter_49_scaffold_25938 sequence) position: , mismatch: 4, identity: 0.84

cttgccgaacacgccgaagccgtcg	CRISPR spacer
cccgtagaacacgccgaagccgtcg	Protospacer
*..*. *******************

271. spacer 7.14|1573768|25|NC_022350|CRISPRCasFinder matches to MN582064 (Podoviridae sp. ctka020, complete genome) position: , mismatch: 4, identity: 0.84

cttgccgccaccgacccccccttgc	CRISPR spacer
ttttccgacaccgacccccccttga	Protospacer
.** *** **************** 

272. spacer 8.5|2087748|24|NC_022350|CRT matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 4, identity: 0.833

atcgaagaagctgaacccgccgtt	CRISPR spacer
atcgaagaagctgaacacgcccgc	Protospacer
**************** ****  .

273. spacer 8.5|2087748|24|NC_022350|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 4, identity: 0.833

atcgaagaagctgaacccgccgtt	CRISPR spacer
gtcgatgaagctgaacccgccgaa	Protospacer
.**** ****************  

274. spacer 8.5|2087748|24|NC_022350|CRT matches to NZ_CP015007 (Aminobacter aminovorans strain KCTC 2477 plasmid pAA02, complete sequence) position: , mismatch: 4, identity: 0.833

atcgaagaagctgaacccgccgtt	CRISPR spacer
atcggagaagctgaacccgcccgg	Protospacer
****.****************   

275. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP013224 (Salmonella enterica subsp. enterica serovar Anatum strain GT-38 plasmid PDM04, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

276. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_KX470734 (Escherichia coli strain Ecoli14-55 plasmid pEC55-NDM4, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

277. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_KY296103 (Enterobacter cloacae strain 13E169 plasmid pHN84NDM, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

278. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_KY978629 (Cronobacter sakazakii strain 505108 plasmid p505108-NDM, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

279. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_MF072961 (Citrobacter freundii strain P10159 plasmid pP10159-1, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

280. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_MF042356 (Enterobacter cloacae strain 20ES plasmid pNDM_20ES, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

281. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_MF042359 (Serratia marcescens strain 7209 plasmid pNDM_7209, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

282. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_KU726616 (Salmonella enterica subsp. enterica serovar Stanley strain LS001 plasmid pHS36-NDM, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

283. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_KU314941 (Klebsiella pneumoniae isolate KP04 plasmid pKP04NDM, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

284. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_KX094555 (Escherichia coli strain ZHDC33 plasmid pZHDC33, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

285. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP009413 (Salmonella enterica strain CFSAN007427 isolate N20272 plasmid pCFSAN007427_01, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

286. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_KR059864 (Klebsiella pneumoniae strain KP-YQ13450 plasmid pYQ12450, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

287. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_KP987216 (Citrobacter freundii strain 112298 plasmid p112298-NDM, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

288. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP022126 (Klebsiella pneumoniae strain DHQP1605752_NV plasmid p1605752AC2, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

289. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP010373 (Escherichia coli strain 6409 plasmid p6409-202.186kb, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

290. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP010373 (Escherichia coli strain 6409 plasmid p6409-202.186kb, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

291. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP010373 (Escherichia coli strain 6409 plasmid p6409-202.186kb, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

292. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP028588 (Escherichia coli strain WCHEC4533 plasmid pNDM4_000533, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

293. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP041930 (Klebsiella pneumoniae strain 18-2374 plasmid pSECR18-2374C, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

294. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP048296 (Escherichia coli strain CVM N18EC0432 plasmid pN18EC0432-2, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

295. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP028560 (Acinetobacter sp. WCHA45 plasmid pNDM1_010045, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

296. spacer 15.11|3946672|26|NC_022350|CRT matches to NC_018994 (Escherichia coli plasmid pNDM-1_Dok01, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

297. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

298. spacer 15.11|3946672|26|NC_022350|CRT matches to NC_019153 (Klebsiella pneumoniae plasmid pNDM-KN, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

299. spacer 15.11|3946672|26|NC_022350|CRT matches to NC_019162 (Klebsiella pneumoniae strain CRE380 plasmid pNDM-HN380, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

300. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP032878 (Escherichia coli strain WCHEC000837 plasmid pNDM4_000837, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

301. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP018817 (Klebsiella pneumoniae strain AR_0049 plasmid unitig_1, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

302. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ctcggccgcaaaggcggcattggcgg	Protospacer
 .**** ************* *****

303. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP020951 (Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ctcggccgcaaaggcggcattggcgg	Protospacer
 .**** ************* *****

304. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ccgggccggaaaggcggcatgggcgg	Protospacer
 * *** * *****************

305. spacer 15.11|3946672|26|NC_022350|CRT matches to CP049311 (Salmonella enterica subsp. enterica serovar Heidelberg strain CVM N53023 plasmid pN53023, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

306. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP041642 (Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-NDM4, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

307. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP048828 (Acinetobacter baumannii strain ABF9692 plasmid pABF9692, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

308. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP021206 (Escherichia coli strain Z1002 plasmid p1002-NDM1, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

309. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP050416 (Acinetobacter baumannii strain PM193665 plasmid pPM193665_1, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

310. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP032284 (Acinetobacter sp. WCHA55 plasmid pNDM1_010055, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

311. spacer 15.11|3946672|26|NC_022350|CRT matches to NC_020811 (Klebsiella pneumoniae strain KPN5047 plasmid pKPN5047, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

312. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP030191 (Salmonella enterica strain SA20104250 plasmid pSA20104250.1, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

313. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP050426 (Acinetobacter baumannii strain PM194188 plasmid pPM194122_1, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

314. spacer 15.11|3946672|26|NC_022350|CRT matches to NC_023914 (Enterobacter cloacae strain CRE727 plasmid pNDM-HF727, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

315. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP044035 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

316. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP029118 (Escherichia coli strain AR435 plasmid unnamed5, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

317. spacer 15.11|3946672|26|NC_022350|CRT matches to NC_019123 (Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH1148_107, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

318. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

319. spacer 15.11|3946672|26|NC_022350|CRT matches to MN178638 (Kluyvera cryocrescens strain SCW13 plasmid pNDM1_SCW13, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

320. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP038280 (Raoultella ornithinolytica strain WLK218 plasmid pWLK-NDM, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

321. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

322. spacer 15.11|3946672|26|NC_022350|CRT matches to CP050158 (Enterobacter cloacae plasmid Carbapenemase(NDM-1)_IncX3, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

323. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

324. spacer 15.11|3946672|26|NC_022350|CRT matches to CP050161 (Escherichia coli plasmid Carbapenemase(NDM-1)_IncX3, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

325. spacer 15.11|3946672|26|NC_022350|CRT matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

326. spacer 15.11|3946672|26|NC_022350|CRT matches to NC_021501 (Klebsiella michiganensis E718 plasmid pKOX_NDM1, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

327. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP017672 (Providencia rettgeri strain RB151 plasmid pRB151-NDM, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

328. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP023914 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

329. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP029386 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 plasmid pNDM6_040074, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

330. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP030264 (Ensifer adhaerens strain Corn53 plasmid AB, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcaaaagcggcctgggcgg	Protospacer
. **********.***** *******

331. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP022226 (Escherichia coli strain WCHEC96200 plasmid pNDM4_WCHEC96200, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

332. spacer 15.11|3946672|26|NC_022350|CRT matches to MN823999 (Klebsiella pneumoniae strain 362713 plasmid p362713-FIIK, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

333. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

334. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
gtcggcggcaatggcggcgtgggcgg	Protospacer
..********* ******.*******

335. spacer 15.11|3946672|26|NC_022350|CRT matches to NC_020552 (Citrobacter freundii plasmid pYE315203, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

336. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP040598 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15_NDM-1, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

337. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP014297 (Klebsiella pneumoniae strain KP38731 plasmid unnamed13 sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

338. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP016453 (Sphingobium sp. RAC03 plasmid pBSY17_1, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
accggcggcaatggcggcattggcct	Protospacer
*********** ******** ***  

339. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP020056 (Escherichia coli strain AR_0069 plasmid unitig_2, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

340. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP031884 (Klebsiella pneumoniae strain WCHKP095845 plasmid pNDM1_095845, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

341. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP027409 (Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_317 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

342. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP027409 (Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_317 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

343. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP031297 (Escherichia coli strain EC17GD31 plasmid pGD31-NDM, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

344. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP041229 (Acinetobacter haemolyticus strain AN54 plasmid pAhaeAN54e, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

345. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_LT985293 (Escherichia coli strain 4410-1 plasmid RCS79_p, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

346. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_LT985268 (Escherichia coli strain 699 plasmid RCS58_p, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

347. spacer 15.11|3946672|26|NC_022350|CRT matches to MN604267 (Salmonella enterica subsp. enterica serovar London strain SAL-19-0623 plasmid pSAL-19-0623_NDM, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

348. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_MK372385 (Morganella morganii strain ABC140 plasmid pABC140-NDM-1, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

349. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_MK372381 (Klebsiella pneumoniae strain ABC52 plasmid pABC52-NDM-1, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

350. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP053899 (Proteus mirabilis strain YPM35 plasmid pJPM35-1, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

351. spacer 15.11|3946672|26|NC_022350|CRT matches to MN657249 (Enterobacteriaceae bacterium strain 1086-16 plasmid pKP39-T3, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

352. spacer 15.11|3946672|26|NC_022350|CRT matches to MN657250 (Enterobacteriaceae bacterium strain 1083-16 plasmid pKP39-T4, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

353. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_MH909333 (Klebsiella pneumoniae strain 7-SP plasmid p7SP-NDM, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

354. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_MH909346 (Klebsiella pneumoniae strain 20130907-4 plasmid p309074-NDM, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

355. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_MH909335 (Klebsiella pneumoniae strain 11-SP plasmid p11SP-NDM, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

356. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_MH234505 (Escherichia coli strain CRE3694 plasmid pNDM-HK3694, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

357. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_MH917282 (Klebsiella pneumoniae strain A457 plasmid pA457-NDA, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

358. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_MH349095 (Escherichia coli strain 948 plasmid pMTC948, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

359. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_MK372386 (Klebsiella pneumoniae strain BC700 plasmid pBC700-NDM-1, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

360. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_MK372380 (Enterobacter cloacae strain ABC40 plasmid pABC40-NDM-1, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

361. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_MK372382 (Escherichia coli strain ABC54 plasmid pABC54-NDM-1, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

362. spacer 15.11|3946672|26|NC_022350|CRT matches to MN657241 (Enterobacteriaceae bacterium strain 20-16 plasmid pCF104a-T3, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

363. spacer 15.11|3946672|26|NC_022350|CRT matches to MN657242 (Enterobacteriaceae bacterium strain 128-16 plasmid pEC405a-T3, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

364. spacer 15.11|3946672|26|NC_022350|CRT matches to MN657243 (Enterobacteriaceae bacterium strain 24-16 plasmid pEC744-T5, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

365. spacer 15.11|3946672|26|NC_022350|CRT matches to MN657244 (Enterobacteriaceae bacterium strain 690-16 plasmid pEC6332-T3, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

366. spacer 15.11|3946672|26|NC_022350|CRT matches to MN657247 (Enterobacteriaceae bacterium strain 460-16 plasmid pECl-T3, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

367. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_MG462728 (Escherichia coli strain AMA1416 plasmid pAMA1416, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

368. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_MH457126 (Vibrio alginolyticus strain Vb1394 plasmid pC1394, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

369. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_MH105052 (Escherichia coli strain EC600 plasmid pSL131T_IncX3, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

370. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP044464 (Acinetobacter schindleri strain HZE23-1 plasmid pHZE23-1-1, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

371. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_MF042350 (Klebsiella pneumoniae strain 18ES plasmid pNDM_18ES, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

372. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_MF042354 (Klebsiella pneumoniae strain 6TM plasmid pNDM_6TM, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

373. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_MF042353 (Klebsiella pneumoniae strain 1TM plasmid pNDM_1TM, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

374. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_MF042351 (Serratia marcescens strain 12TM plasmid pNDM_12TM, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

375. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_MF042358 (Enterobacter cloacae strain 22ES plasmid pNDM_22ES, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

376. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_MF415608 (Enterobacter cloacae strain hhy03 plasmid pNDM-BJ03, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

377. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_MF042352 (Serratia marcescens strain 4TM plasmid pNDM_4TM, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

378. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_MF042357 (Serratia marcescens strain 9580 plasmid pNDM_9580, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

379. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_MG252893 (Raoultella ornithinolytica strain pRor-30818cz plasmid Ror-30818cz, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

380. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP041048 (Citrobacter sp. CF971 plasmid pBM527-2, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

381. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_KX832927 (Providencia rettgeri strain 16pre36 plasmid p16Pre36-NDM, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

382. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_KX786648 (Enterobacter cloacae strain B557 plasmid pB557-NDM, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

383. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_KY399975 (Enterobacter cloacae strain EClY2403 plasmid pNDM1_EClY2403, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

384. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_KY399974 (Enterobacter cloacae strain EClY2402 plasmid pNDM1_EClY2402, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

385. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP053895 (Proteus mirabilis strain JPM24 plasmid pJPM24, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

386. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_AP023051 (Citrobacter portucalensis strain IOMTU157 plasmid pIOMTU157, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

387. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP034756 (Enterobacter hormaechei subsp. hoffmannii strain Eh1 plasmid p2, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

388. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_KX636095 (Klebsiella pneumoniae strain RJ119 plasmid pRJ119-NDM1, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

389. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_KU302802 (Enterobacter cloacae strain SZECL1 plasmid pNDM1_SZ2 clone ST231, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

390. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_KU302801 (Enterobacter cloacae strain SZECL1 plasmid pNDM1_SZ1 clone ST231, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

391. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_KJ588779 (Klebsiella pneumoniae strain ATCC BAA-2146 plasmid pNDM-US-2, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

392. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_KR351290 (Klebsiella pneumoniae subsp. pneumoniae strain K351 plasmid pK351, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

393. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_KJ802405 (Providencia stuartii isolate GN576 plasmid pNDM-PstGN576, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

394. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_KJ812998 (Enterobacter cloacae isolate GN574 plasmid pNDM-Ec1GN574, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

395. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_KP900016 (Leclercia adecarboxylata strain P10164 plasmid pP10164-NDM, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

396. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_KP765744 (Enterobacter cloacae strain ECN49 plasmid pNDM-ECN49, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

397. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_KP868647 (Enterobacter cloacae strain WCHECl-14653 plasmid pNDM1_EC14653, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

398. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_KJ802404 (Escherichia coli isolate GN568 plasmid pNDM-EcoGN568, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

399. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_KT965092 (Acinetobacter towneri strain G165 plasmid pNDM-GJ01, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

400. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_KT965093 (Acinetobacter towneri strain G295 plasmid pNDM-GJ02, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

401. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP053729 (Escherichia coli strain CP61_Sichuan plasmid pCP61-IncFIB, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

402. spacer 15.11|3946672|26|NC_022350|CRT matches to NC_023322 (Acinetobacter bereziniae strain CHI-40-1 plasmid pNDM-40-1, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

403. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP029731 (Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

404. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP053737 (Escherichia coli strain CP8-3_Sichuan plasmid pCP8-3-IncFII, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

405. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_KC887916 (Escherichia coli strain ARL10/167 isolate EC4 plasmid pEC4-NDM-6, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

406. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_KC887917 (Enterobacter cloacae isolate ECL3 plasmid pECL3-NDM-1, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

407. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP020524 (Escherichia coli strain 190 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

408. spacer 15.11|3946672|26|NC_022350|CRT matches to MT077883 (Escherichia coli plasmid p23, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

409. spacer 15.11|3946672|26|NC_022350|CRT matches to NC_009838 (Escherichia coli APEC O1 plasmid pAPEC-O1-R, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

410. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP010370 (Acinetobacter nosocomialis strain 6411 plasmid p6411-9.012kb, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

411. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP013221 (Salmonella enterica subsp. enterica serovar Anatum strain GT-01 plasmid PDM02, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

412. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP024285 (Escherichia albertii strain 2014C-4356 plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

413. spacer 15.11|3946672|26|NC_022350|CRT matches to MN061454 (Enterobacter cloacae strain EC-14-60 plasmid pECL-14-60-NDM-1, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

414. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP032278 (Acinetobacter sp. WCHAc010034 plasmid pNDM1_010034, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

415. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP045561 (Acinetobacter nosocomialis strain AC1530 plasmid pAC1530, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

416. spacer 15.11|3946672|26|NC_022350|CRT matches to NC_019045 (Escherichia coli strain N10-2337 plasmid pNDM102337, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

417. spacer 15.11|3946672|26|NC_022350|CRT matches to NC_025130 (Raoultella planticola strain RJA274 plasmid NDM-1, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

418. spacer 15.11|3946672|26|NC_022350|CRT matches to NC_019158 (Klebsiella pneumoniae plasmid pNDM10469, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

419. spacer 15.11|3946672|26|NC_022350|CRT matches to MN310375 (Klebsiella quasipneumoniae strain QD1501 plasmid pQD1501-Ct1, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

420. spacer 15.11|3946672|26|NC_022350|CRT matches to MN310377 (Klebsiella pneumoniae strain 12085 plasmid p12085-Ct1, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

421. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

422. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

423. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP037965 (Klebsiella pneumoniae strain SCKP020135 plasmid pNDM1_020135, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

424. spacer 15.11|3946672|26|NC_022350|CRT matches to NC_025184 (Klebsiella pneumoniae strain RJF866 plasmid pRJF866, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

425. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP011518 (Pandoraea oxalativorans strain DSM 23570 plasmid pPO70-1, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcagaggcggcaagggcgg	Protospacer
. ********.******** ******

426. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP021961 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

427. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP021962 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000008, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

428. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP022350 (Klebsiella michiganensis strain K516 plasmid pK516_NDM1, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

429. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP046274 (Enterobacter hormaechei strain E70 plasmid pE70-NDM1, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

430. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP039811 (Klebsiella pneumoniae strain C2660 plasmid pC2660-4-NDM, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

431. spacer 15.11|3946672|26|NC_022350|CRT matches to CP049307 (Salmonella enterica subsp. enterica serovar Heidelberg strain CVM N58631 plasmid p58631, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

432. spacer 15.11|3946672|26|NC_022350|CRT matches to NC_011366 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG202, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ctcggccgcaaaggcggcattggcgg	Protospacer
 .**** ************* *****

433. spacer 15.11|3946672|26|NC_022350|CRT matches to NC_025000 (Acinetobacter lwoffii strain Iz4b plasmid pNDM-Iz4b, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

434. spacer 15.11|3946672|26|NC_022350|CRT matches to NC_024959 (Acinetobacter calcoaceticus strain NDM-WS2 plasmid pNDM-WS2, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

435. spacer 15.11|3946672|26|NC_022350|CRT matches to NC_009140 (Salmonella enterica subsp. enterica serovar Newport str. SL254 plasmid pSN254, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

436. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP012168 (Enterobacter hormaechei subsp. steigerwaltii strain 34998 plasmid p34998-239.973kb, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

437. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP021536 (Escherichia coli strain AR_0119 plasmid unitig_2, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

438. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP010399 (Acinetobacter baumannii strain 6200 plasmid p6200-47.274kb, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

439. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP035935 (Acinetobacter cumulans strain WCHAc060092 plasmid pNDM1_060092, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

440. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP006661 (Klebsiella pneumoniae strain ATCC BAA-2146 plasmid pNDM-US, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

441. spacer 15.11|3946672|26|NC_022350|CRT matches to NC_010625 (Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcaaaggcggcaagagcgg	Protospacer
. ***************** *.****

442. spacer 15.11|3946672|26|NC_022350|CRT matches to NC_012690 (Escherichia coli plasmid peH4H, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

443. spacer 15.11|3946672|26|NC_022350|CRT matches to CP050164 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncA/C2, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

444. spacer 15.11|3946672|26|NC_022350|CRT matches to MK933278 (Enterobacter hormaechei strain SCNJ07 plasmid pNDM-SCNJ07, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

445. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

446. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP015882 (Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcaaacgcggcctgggcgg	Protospacer
. ********** ***** *******

447. spacer 15.11|3946672|26|NC_022350|CRT matches to CP048298 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL_SAL-A00527 plasmid pN1566-1, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

448. spacer 15.11|3946672|26|NC_022350|CRT matches to NC_019066 (Escherichia coli plasmid pAPEC1990_61, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

449. spacer 15.11|3946672|26|NC_022350|CRT matches to NC_019069 (Escherichia coli plasmid pNDM10505, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

450. spacer 15.11|3946672|26|NC_022350|CRT matches to AMXH01000087 (Acinetobacter pittii strain XM1570 plasmid pXM1, complete sequence, whole genome shotgun sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

451. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_JQ739158 (Acinetobacter lwoffii strain ABZ78 plasmid pABZ78, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

452. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP043383 (Enterobacter hormaechei subsp. xiangfangensis strain WCHEX045001 plasmid pNDM1_045001, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

453. spacer 15.11|3946672|26|NC_022350|CRT matches to NC_019985 (Acinetobacter baumannii ZW85-1 plasmid pAbNDM-1, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

454. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP053365 (Klebsiella pneumoniae strain BA2275 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

455. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP018366 (Klebsiella pneumoniae strain Kp_Goe_62629 plasmid pKp_Goe_629-2, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

456. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP023187 (Klebsiella michiganensis strain K518 plasmid pK518_NDM1, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

457. spacer 15.11|3946672|26|NC_022350|CRT matches to NC_021813 (Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002069 plasmid pCFSAN002069_01, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

458. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP028786 (Klebsiella pneumoniae strain SCKP020049 plasmid pNDM1_020049, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

459. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP021936 (Escherichia coli strain AR_0055 plasmid unitig_2, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

460. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

461. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP023948 (Klebsiella pneumoniae strain FDAARGOS_446 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

462. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP041938 (Klebsiella pneumoniae strain KP14003 plasmid pNDM-KP14003, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

463. spacer 15.11|3946672|26|NC_022350|CRT matches to NC_022589 (Providencia rettgeri strain 09ACRGNY2001 plasmid pPrY2001, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

464. spacer 15.11|3946672|26|NC_022350|CRT matches to NC_012692 (Escherichia coli plasmid pAR060302, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

465. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP015835 (Escherichia coli strain MS6198 plasmid pMS6198A, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

466. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

467. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP014478 (Acinetobacter pittii strain AP_882 plasmid pNDM-AP_882, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

468. spacer 15.11|3946672|26|NC_022350|CRT matches to NC_023908 (Klebsiella pneumoniae strain KP1 plasmid pKP1-NDM-1, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

469. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_AP018830 (Enterobacter hormaechei subsp. xiangfangensis strain M206 plasmid pM206-NDM1, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

470. spacer 15.11|3946672|26|NC_022350|CRT matches to NC_019268 (Acinetobacter lwoffii plasmid pNDM-BJ01, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

471. spacer 15.11|3946672|26|NC_022350|CRT matches to NC_019281 (Acinetobacter lwoffii plasmid pNDM-BJ02, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

472. spacer 15.11|3946672|26|NC_022350|CRT matches to NC_025116 (Acinetobacter sp. M131 plasmid pM131_NDM1, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

473. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP040884 (Escherichia coli strain K71-77 plasmid pK71-77-1-NDM, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

474. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP026015 (Klebsiella variicola strain 13450 plasmid p13450-3, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

475. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_AP018143 (Escherichia coli strain M214 isolate M214 plasmid pM214_AC2, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

476. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP035001 (Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ctcggccgcaaaggcggcattggcgg	Protospacer
 .**** ************* *****

477. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP048797 (Providencia vermicola strain P8538 plasmid p8538-NDM-1, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

478. spacer 15.11|3946672|26|NC_022350|CRT matches to MN937240 (Enterobacter cloacae strain BSI034 plasmid pBSI034-NDM1, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

479. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP037904 (Escherichia coli strain LHM10-1 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

480. spacer 15.11|3946672|26|NC_022350|CRT matches to MN603981 (Klebsiella aerogenes strain 1564 plasmid p1564, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

481. spacer 15.11|3946672|26|NC_022350|CRT matches to MN604268 (Escherichia coli strain J53 plasmid pJ53_SAL-19-0623_NDM, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

482. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_LN833432 (Acinetobacter baumannii isolate CHI-32 plasmid pNDM-32, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

483. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_MK123268 (Serratia marcescens strain M17468 plasmid pSMA17468, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

484. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP053897 (Providencia rettgeri strain YPR31 plasmid pYPR31, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

485. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP032132 (Acinetobacter chinensis strain WCHAc010005 plasmid pNDM1_010005, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

486. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_MH995508 (Enterobacter cloacae strain ECL17464 plasmid pECL17464, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

487. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_MH995506 (Citrobacter freundii strain CFR17394 plasmid pCFR17394, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

488. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_MH917283 (Klebsiella pneumoniae strain A575 plasmid pA575-NDM, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

489. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_MH909345 (Klebsiella pneumoniae strain N201205880 plasmid p205880-NDM, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

490. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_MH105050 (Salmonella enterica subsp. enterica serovar Lomita strain SL131 plasmid pSL131_IncA/C-IncX3, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

491. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_MH909343 (Klebsiella pneumoniae strain 1012018 plasmid p12018-NDM, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

492. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_MH909347 (Klebsiella pneumoniae strain 362713 plasmid p362713-NDM, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

493. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_MH263652 (Providencia rettgeri strain QD51 plasmid pNDM-QD51, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

494. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_MH917281 (Klebsiella pneumoniae strain 14504 plasmid p14504-NDM, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

495. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_MK101346 (Citrobacter freundii strain CRE3 plasmid pCRE7-NDM, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

496. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_MK757441 (Alcaligenes faecalis strain AN70 plasmid pAN70-1, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

497. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP020090 (Enterobacter cloacae strain PIMB10EC27 plasmid pEC27-1, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

498. spacer 15.11|3946672|26|NC_022350|CRT matches to MN657245 (Enterobacteriaceae bacterium strain 23-16 plasmid pEC6332-T6, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

499. spacer 15.11|3946672|26|NC_022350|CRT matches to MN657246 (Enterobacteriaceae bacterium strain 23-17 plasmid pEC6332-T7, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

500. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_MF344560 (Enterobacter hormaechei strain 128379 plasmid p128379-NDM, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

501. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_MG462729 (Escherichia coli strain AMA1742 plasmid pAMA1742, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

502. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP035537 (Klebsiella pneumoniae subsp. pneumoniae strain CCRI-22199 plasmid pKp199-2, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

503. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

504. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

505. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcatgggcggcatgggcgg	Protospacer
. ******** .**************

506. spacer 15.11|3946672|26|NC_022350|CRT matches to MH001451 (Mycobacterium phage Nairb, complete genome) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ccgggcggcaagggcggcaagggcgg	Protospacer
 * ********.******* ******

507. spacer 15.11|3946672|26|NC_022350|CRT matches to MK994522 (Methanobacterium virus PhiF1, complete genome) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcaaaggcggcaagggagg	Protospacer
. ***************** *** **

508. spacer 15.11|3946672|26|NC_022350|CRT matches to MF155936 (Mycobacterium phage ZenTime222, complete genome) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ccgggcggcaagggcggcaagggcgg	Protospacer
 * ********.******* ******

509. spacer 15.11|3946672|26|NC_022350|CRT matches to MK494089 (Mycobacterium phage Ibrahim, complete genome) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ccgggcggcaagggcggcaagggcgg	Protospacer
 * ********.******* ******

510. spacer 15.11|3946672|26|NC_022350|CRT matches to NC_024135 (Mycobacterium phage Bernal13, complete genome) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ccgggcggcaagggcggcaagggcgg	Protospacer
 * ********.******* ******

511. spacer 15.11|3946672|26|NC_022350|CRT matches to KM591905 (Mycobacterium phage RonRayGun, complete genome) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ccgggcggcaagggcggcaagggcgg	Protospacer
 * ********.******* ******

512. spacer 15.11|3946672|26|NC_022350|CRT matches to MN735432 (Mycobacteriophage Whitty, complete genome) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ccgggcggcaagggcggcaagggcgg	Protospacer
 * ********.******* ******

513. spacer 15.11|3946672|26|NC_022350|CRT matches to LT599585 (Pseudomonas veronii 1YdBTEX2 genome assembly, plasmid: PVE_plasmid) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
atgggcggcatgggcggcatgggcgg	Protospacer
*. ******* .**************

514. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ccgggccggaaaggcggcatgggcgg	Protospacer
 * *** * *****************

515. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
aagggcggcaagggcggcatcggcgg	Protospacer
*  ********.******** *****

516. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP021821 (Sinorhizobium meliloti strain M162 plasmid accessoryA, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
cctggcggcatgggcggcatgggcgg	Protospacer
 *.******* .**************

517. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ccgggccggaaaggcggcatgggcgg	Protospacer
 * *** * *****************

518. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP041045 (Paracoccus sp. AK26 plasmid pAK1, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
atgggcggcatgggcggcatgggcgg	Protospacer
*. ******* .**************

519. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP046705 (Nostoc sp. ATCC 53789 plasmid pNsp_b, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
aagggcggcaatggcggcatcggcgg	Protospacer
*  ******** ******** *****

520. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
tcaggcggcaaaggcggcagcggcgg	Protospacer
 * ****************  *****

521. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP011481 (Hoeflea sp. IMCC20628 plasmid, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
gcgggcggcacagccggcatgggcgg	Protospacer
.* ******* ** ************

522. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP023072 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666a, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ccgggcggcatgggcggcatgggcgg	Protospacer
 * ******* .**************

523. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
tcaggcggcaaaggcggcagcggcgg	Protospacer
 * ****************  *****

524. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
tcaggcggcaaaggcggcagcggcgg	Protospacer
 * ****************  *****

525. spacer 15.11|3946672|26|NC_022350|CRT matches to NC_009621 (Sinorhizobium medicae WSM419 plasmid pSMED02, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
cctggcggcatgggcggcatgggcgg	Protospacer
 *.******* .**************

526. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
gcgggcggcaacggcggcaggggcgg	Protospacer
.* ******** ******* ******

527. spacer 15.11|3946672|26|NC_022350|CRT matches to JN698993 (Mycobacterium phage Firecracker, complete genome) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
atgggcggcaagggcggcaagggcgg	Protospacer
*. ********.******* ******

528. spacer 15.11|3946672|26|NC_022350|CRT matches to MN694268 (Marine virus AFVG_250M110, complete genome) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
atgggcggcatgggcggcatgggcgg	Protospacer
*. ******* .**************

529. spacer 15.11|3946672|26|NC_022350|CRT matches to MN694268 (Marine virus AFVG_250M110, complete genome) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
atgggcggcatgggcggcatgggcgg	Protospacer
*. ******* .**************

530. spacer 15.11|3946672|26|NC_022350|CRT matches to MN694268 (Marine virus AFVG_250M110, complete genome) position: , mismatch: 4, identity: 0.846

accggcggcaaaggcggcatgggcgg	CRISPR spacer
atgggcggcatgggcggcatgggcgg	Protospacer
*. ******* .**************

531. spacer 2.8|341396|27|NC_022350|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 5, identity: 0.815

gcgccgaacagcccgccagagccgcca	CRISPR spacer
aagccgaccagcccgccatagccgccc	Protospacer
. ***** ********** ******* 

532. spacer 2.8|341396|27|NC_022350|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcgccgaacagcccgccagagccgcca	CRISPR spacer
gcgccgaacagccagccggagccgatg	Protospacer
************* ***.****** ..

533. spacer 2.8|341396|27|NC_022350|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 5, identity: 0.815

gcgccgaacagcccgccagagccgcca	CRISPR spacer
gcgccgaacagccagccggagccgatg	Protospacer
************* ***.****** ..

534. spacer 2.8|341396|27|NC_022350|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcgccgaacagcccgccagagccgcca	CRISPR spacer
gcgccgaacagccagccggagccgatg	Protospacer
************* ***.****** ..

535. spacer 2.8|341396|27|NC_022350|CRT matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 5, identity: 0.815

gcgccgaacagcccgccagagccgcca	CRISPR spacer
ccgccgaacagcgcgcctgagccgcat	Protospacer
 *********** **** *******  

536. spacer 2.8|341396|27|NC_022350|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcgccgaacagcccgccagagccgcca	CRISPR spacer
gcgccgaacagccagccggagccgatg	Protospacer
************* ***.****** ..

537. spacer 2.8|341396|27|NC_022350|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 5, identity: 0.815

gcgccgaacagcccgccagagccgcca	CRISPR spacer
gcgccgaacagccagccggagccgatg	Protospacer
************* ***.****** ..

538. spacer 2.8|341396|27|NC_022350|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcgccgaacagcccgccagagccgcca	CRISPR spacer
gcgccgaacagccagccggagccgatg	Protospacer
************* ***.****** ..

539. spacer 2.8|341396|27|NC_022350|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcgccgaacagcccgccagagccgcca	CRISPR spacer
gcgccgaacagccagccggagccgatg	Protospacer
************* ***.****** ..

540. spacer 2.8|341396|27|NC_022350|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcgccgaacagcccgccagagccgcca	CRISPR spacer
gcgccgaacagccagccggagccgatg	Protospacer
************* ***.****** ..

541. spacer 2.8|341396|27|NC_022350|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcgccgaacagcccgccagagccgcca	CRISPR spacer
gcgccgaacagccagccggagccgatg	Protospacer
************* ***.****** ..

542. spacer 2.8|341396|27|NC_022350|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcgccgaacagcccgccagagccgcca	CRISPR spacer
gcgccgaacagccagccggagccgatg	Protospacer
************* ***.****** ..

543. spacer 2.8|341396|27|NC_022350|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcgccgaacagcccgccagagccgcca	CRISPR spacer
gcgccgaacagccagccggagccgatg	Protospacer
************* ***.****** ..

544. spacer 2.8|341396|27|NC_022350|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcgccgaacagcccgccagagccgcca	CRISPR spacer
gcgccgaacagccagccggagccgatg	Protospacer
************* ***.****** ..

545. spacer 2.8|341396|27|NC_022350|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcgccgaacagcccgccagagccgcca	CRISPR spacer
gcgccgaacagccagccggagccgatg	Protospacer
************* ***.****** ..

546. spacer 2.8|341396|27|NC_022350|CRT matches to NZ_CP009296 (Novosphingobium pentaromativorans US6-1 plasmid pLA2, complete sequence) position: , mismatch: 5, identity: 0.815

gcgccgaacagcccgccagagccgcca	CRISPR spacer
tgggcgatcagcccgccagcgccgcca	Protospacer
  * *** *********** *******

547. spacer 2.8|341396|27|NC_022350|CRT matches to NC_025133 (Sphingobium wenxiniae strain JZ-1 plasmid pPBA, complete sequence) position: , mismatch: 5, identity: 0.815

gcgccgaacagcccgccagagccgcca	CRISPR spacer
tgggcgatcagcccgccagcgccgcca	Protospacer
  * *** *********** *******

548. spacer 2.8|341396|27|NC_022350|CRT matches to NZ_CP005192 (Sphingobium sp. MI1205 plasmid pMI3, complete sequence) position: , mismatch: 5, identity: 0.815

gcgccgaacagcccgccagagccgcca	CRISPR spacer
tgggcgatcagcccgccagcgccgcca	Protospacer
  * *** *********** *******

549. spacer 2.8|341396|27|NC_022350|CRT matches to AB244976 (Uncultured bacterium plasmid pLB1 DNA, complete sequence) position: , mismatch: 5, identity: 0.815

gcgccgaacagcccgccagagccgcca	CRISPR spacer
tgggcgatcagcccgccagcgccgcca	Protospacer
  * *** *********** *******

550. spacer 2.8|341396|27|NC_022350|CRT matches to NZ_CP012702 (Sphingopyxis macrogoltabida strain EY-1 isolate activated sludge plasmid 2, complete sequence) position: , mismatch: 5, identity: 0.815

gcgccgaacagcccgccagagccgcca	CRISPR spacer
tgggcgatcagcccgccagcgccgcca	Protospacer
  * *** *********** *******

551. spacer 2.8|341396|27|NC_022350|CRT matches to NZ_CP022749 (Sphingobium hydrophobicum strain C1 plasmid p3, complete sequence) position: , mismatch: 5, identity: 0.815

gcgccgaacagcccgccagagccgcca	CRISPR spacer
tgggcgatcagcccgccagcgccgcca	Protospacer
  * *** *********** *******

552. spacer 2.8|341396|27|NC_022350|CRT matches to MH744423 (Mycobacterium phage Saguaro, complete genome) position: , mismatch: 5, identity: 0.815

gcgccgaacagcccgccagagccgcca	CRISPR spacer
ccaccgaacagcccgccaccgccgccg	Protospacer
 *.***************  ******.

553. spacer 2.8|341396|27|NC_022350|CRT matches to NZ_CP023452 (Rhizorhabdus dicambivorans strain Ndbn-20 plasmid p3, complete sequence) position: , mismatch: 5, identity: 0.815

gcgccgaacagcccgccagagccgcca	CRISPR spacer
tgggcgatcagcccgccagcgccgcca	Protospacer
  * *** *********** *******

554. spacer 2.8|341396|27|NC_022350|CRT matches to NZ_CP033229 (Sphingobium yanoikuyae strain SJTF8 plasmid pF3, complete sequence) position: , mismatch: 5, identity: 0.815

gcgccgaacagcccgccagagccgcca	CRISPR spacer
tgggcgatcagcccgccagcgccgcca	Protospacer
  * *** *********** *******

555. spacer 2.8|341396|27|NC_022350|CRT matches to NZ_CP017244 (Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence) position: , mismatch: 5, identity: 0.815

gcgccgaacagcccgccagagccgcca	CRISPR spacer
ccgccgaactgcccgccggagccggcg	Protospacer
 ******** *******.****** *.

556. spacer 2.14|341741|27|NC_022350|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 5, identity: 0.815

ttgccgatgagcccgccggcgccgccg	CRISPR spacer
cggacgatccgcccgccggcgccgccg	Protospacer
. * ****  *****************

557. spacer 2.14|341741|27|NC_022350|CRT matches to NZ_CP024891 (Rhodococcus ruber strain YYL plasmid pYYL1.2, complete sequence) position: , mismatch: 5, identity: 0.815

ttgccgatgagcccgccggcgccgccg	CRISPR spacer
aatccgatgcgcccgccggtgccgccg	Protospacer
   ****** *********.*******

558. spacer 2.14|341741|27|NC_022350|CRT matches to NZ_CP024892 (Rhodococcus ruber strain YYL plasmid pYYL1.1, complete sequence) position: , mismatch: 5, identity: 0.815

ttgccgatgagcccgccggcgccgccg	CRISPR spacer
aatccgatgcgcccgccggtgccgccg	Protospacer
   ****** *********.*******

559. spacer 2.14|341741|27|NC_022350|CRT matches to NZ_CP010960 (Sphingobium sp. YBL2 plasmid 6pYBL2-6, complete sequence) position: , mismatch: 5, identity: 0.815

ttgccgatgagcccgccggcgccgccg	CRISPR spacer
cgggcgatgaggccgccggcgccgcgg	Protospacer
. * ******* ************* *

560. spacer 2.14|341741|27|NC_022350|CRT matches to NZ_CP015091 (Pelagibaca abyssi strain JLT2014 plasmid pPABY1, complete sequence) position: , mismatch: 5, identity: 0.815

ttgccgatgagcccgccggcgccgccg	CRISPR spacer
cggtcgctgcgcccgccggcgccgccg	Protospacer
. *.** ** *****************

561. spacer 2.14|341741|27|NC_022350|CRT matches to CP054927 (Streptomyces fulvissimus strain NA06532 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815

ttgccgatgagcccgccggcgccgccg	CRISPR spacer
ccgccgaggaggccgccggcgccgcag	Protospacer
..***** *** ************* *

562. spacer 2.14|341741|27|NC_022350|CRT matches to NZ_LR134451 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence) position: , mismatch: 5, identity: 0.815

ttgccgatgagcccgccggcgccgccg	CRISPR spacer
tgctcgacgagcccgccggcggcgccg	Protospacer
*  .***.************* *****

563. spacer 2.14|341741|27|NC_022350|CRT matches to NC_008537 (Arthrobacter sp. FB24 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.815

ttgccgatgagcccgccggcgccgccg	CRISPR spacer
aggccgctgagcccggcggcgccgcag	Protospacer
  **** ******** ********* *

564. spacer 2.14|341741|27|NC_022350|CRT matches to NZ_CP040819 (Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence) position: , mismatch: 5, identity: 0.815

ttgccgatgagcccgccggcgccgccg	CRISPR spacer
tcggggatgagcccgccggcgccgggg	Protospacer
*.*  *******************  *

565. spacer 2.14|341741|27|NC_022350|CRT matches to NZ_AP014706 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_2p, complete sequence) position: , mismatch: 5, identity: 0.815

ttgccgatgagcccgccggcgccgccg	CRISPR spacer
gtgccgatgagcccgacggcggcgagg	Protospacer
 ************** ***** **  *

566. spacer 2.14|341741|27|NC_022350|CRT matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 5, identity: 0.815

ttgccgatgagcccgccggcgccgccg	CRISPR spacer
acggcgatgagccagccggcgccggcg	Protospacer
 .* ********* ********** **

567. spacer 2.14|341741|27|NC_022350|CRT matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 5, identity: 0.815

ttgccgatgagcccgccggcgccgccg	CRISPR spacer
atgcctatgaccccgccggcgccgaag	Protospacer
 **** **** *************  *

568. spacer 2.14|341741|27|NC_022350|CRT matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 5, identity: 0.815

ttgccgatgagcccgccggcgccgccg	CRISPR spacer
aggtcgatgagaccgccggccccgccg	Protospacer
  *.******* ******** ******

569. spacer 2.14|341741|27|NC_022350|CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.815

ttgccgatgagcccgccggcgccgccg	CRISPR spacer
acgacgatgagcccgccggcgttgccg	Protospacer
 .* *****************..****

570. spacer 2.14|341741|27|NC_022350|CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.815

ttgccgatgagcccgccggcgccgccg	CRISPR spacer
acgacgatgagcccgccggcgttgccg	Protospacer
 .* *****************..****

571. spacer 2.14|341741|27|NC_022350|CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 5, identity: 0.815

ttgccgatgagcccgccggcgccgccg	CRISPR spacer
acgacgatgagcccgccggcgttgccg	Protospacer
 .* *****************..****

572. spacer 2.14|341741|27|NC_022350|CRT matches to NZ_CP035000 (Rhizobium acidisoli strain FH23 plasmid pRapFH23b, complete sequence) position: , mismatch: 5, identity: 0.815

ttgccgatgagcccgccggcgccgccg	CRISPR spacer
taatcgatgcgcccgccggcgccgtcg	Protospacer
* ..***** **************.**

573. spacer 2.14|341741|27|NC_022350|CRT matches to NZ_CP047223 (Sphingobium yanoikuyae strain YC-JY1 plasmid unnamed5, complete sequence) position: , mismatch: 5, identity: 0.815

ttgccgatgagcccgccggcgccgccg	CRISPR spacer
cgggcgatgaggccgccggcgccgcgg	Protospacer
. * ******* ************* *

574. spacer 2.14|341741|27|NC_022350|CRT matches to NC_020205 (Xanthomonas citri phage CP2 DNA, complete genome) position: , mismatch: 5, identity: 0.815

ttgccgatgagcccgccggcgccgccg	CRISPR spacer
tggccgatgagccagccggcgcccttg	Protospacer
* *********** ********* ..*

575. spacer 3.1|369657|27|NC_022350|CRISPRCasFinder matches to LR794124 (Vibrio phage vB_Vc_SrVc9 genome assembly, chromosome: 1) position: , mismatch: 5, identity: 0.815

aacgcaccggtgtccacatcgcccgtg	CRISPR spacer
aacgcaccgttgtccacatcaccaatc	Protospacer
********* **********.** .* 

576. spacer 3.1|369657|27|NC_022350|CRISPRCasFinder matches to NC_012662 (Vibrio phage VP93, complete genome) position: , mismatch: 5, identity: 0.815

aacgcaccggtgtccacatcgcccgtg	CRISPR spacer
aacgcaccgttgtccacatcaccaatc	Protospacer
********* **********.** .* 

577. spacer 3.7|370053|27|NC_022350|CRISPRCasFinder matches to NZ_CP016084 (Streptomyces sp. SAT1 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.815

gcgaagccgatgttgtagctgccggtg	CRISPR spacer
gcgaagccgaagttgtagctgcgctcg	Protospacer
********** ***********   .*

578. spacer 3.7|370053|27|NC_022350|CRISPRCasFinder matches to MN693945 (Marine virus AFVG_250M952, complete genome) position: , mismatch: 5, identity: 0.815

gcgaagccgatgttgtagctgccggtg	CRISPR spacer
atgaagccgatgttgtcgctaccgggg	Protospacer
..************** ***.**** *

579. spacer 3.10|370263|27|NC_022350|CRISPRCasFinder matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

580. spacer 3.10|370263|27|NC_022350|CRISPRCasFinder matches to NZ_CP013525 (Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

581. spacer 3.10|370263|27|NC_022350|CRISPRCasFinder matches to NZ_CP013554 (Rhizobium phaseoli strain N931 plasmid pRphaN931b, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

582. spacer 3.10|370263|27|NC_022350|CRISPRCasFinder matches to NZ_CP015368 (Methylobacterium phyllosphaerae strain CBMB27 plasmid CBMB27-p1, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tccccgcggaagttgaggtcgcgggtg	Protospacer
 ****** ************** *. *

583. spacer 3.10|370263|27|NC_022350|CRISPRCasFinder matches to NZ_CP013588 (Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

584. spacer 3.10|370263|27|NC_022350|CRISPRCasFinder matches to NZ_CP013560 (Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

585. spacer 3.10|370263|27|NC_022350|CRISPRCasFinder matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

586. spacer 3.10|370263|27|NC_022350|CRISPRCasFinder matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

587. spacer 3.10|370263|27|NC_022350|CRISPRCasFinder matches to NZ_CP013529 (Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

588. spacer 3.10|370263|27|NC_022350|CRISPRCasFinder matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

589. spacer 3.10|370263|27|NC_022350|CRISPRCasFinder matches to NZ_CP013539 (Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

590. spacer 3.10|370263|27|NC_022350|CRISPRCasFinder matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

591. spacer 3.10|370263|27|NC_022350|CRISPRCasFinder matches to NZ_CP020444 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcaccgccgaagttgaagtggccgagc	Protospacer
 * *************.** ****** 

592. spacer 3.10|370263|27|NC_022350|CRISPRCasFinder matches to NZ_CP013565 (Rhizobium phaseoli strain N831 plasmid pRphaN831b, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

593. spacer 3.10|370263|27|NC_022350|CRISPRCasFinder matches to NZ_CP013582 (Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

594. spacer 3.10|370263|27|NC_022350|CRISPRCasFinder matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

595. spacer 3.10|370263|27|NC_022350|CRISPRCasFinder matches to NZ_CP044078 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcaccgccgaagttgaagtggccgagc	Protospacer
 * *************.** ****** 

596. spacer 3.10|370263|27|NC_022350|CRISPRCasFinder matches to NZ_CP031081 (Paracoccus yeei strain CCUG 32053 plasmid pYEE3, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcaccgccgaagttgaagtggccgagc	Protospacer
 * *************.** ****** 

597. spacer 3.10|370263|27|NC_022350|CRISPRCasFinder matches to MN586031 (Gordonia phage Gambino, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

598. spacer 3.10|370263|27|NC_022350|CRISPRCasFinder matches to KU998236 (Gordonia phage Blueberry, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

599. spacer 3.10|370263|27|NC_022350|CRISPRCasFinder matches to MN062704 (Gordonia phage JuJu, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

600. spacer 3.10|370263|27|NC_022350|CRISPRCasFinder matches to MK501729 (Gordonia phage Walrus, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

601. spacer 3.10|370263|27|NC_022350|CRISPRCasFinder matches to NC_031226 (Gordonia phage BaxterFox, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

602. spacer 3.10|370263|27|NC_022350|CRISPRCasFinder matches to MK967393 (Rhodococcus phage Whack, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tccttaccgaagttgaggtcgacgagg	Protospacer
 **...*************** *****

603. spacer 3.10|370263|27|NC_022350|CRISPRCasFinder matches to MT723935 (Gordonia phage Azula, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

604. spacer 3.10|370263|27|NC_022350|CRISPRCasFinder matches to KU963249 (Gordonia phage Yeezy, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

605. spacer 3.10|370263|27|NC_022350|CRISPRCasFinder matches to MH153808 (Gordonia phage Petra, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

606. spacer 3.10|370263|27|NC_022350|CRISPRCasFinder matches to MT639650 (Gordonia phage Ohgeesy, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

607. spacer 3.10|370263|27|NC_022350|CRISPRCasFinder matches to MH536818 (Gordonia phage Frokostdame, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

608. spacer 3.10|370263|27|NC_022350|CRISPRCasFinder matches to KX557275 (Gordonia phage CarolAnn, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

609. spacer 5.6|930393|27|NC_022350|CRT matches to CP009871 (Pantoea sp. PSNIH2 plasmid pPSP-cd6, complete sequence) position: , mismatch: 5, identity: 0.815

cgtcagcggcggggctggcggggaggg	CRISPR spacer
cgtcagcggctgggcaggcggggatat	Protospacer
********** **** ******** . 

610. spacer 5.6|930393|27|NC_022350|CRT matches to NZ_CP030354 (Novosphingobium sp. P6W plasmid pP6W1, complete sequence) position: , mismatch: 5, identity: 0.815

cgtcagcggcggggctggcggggaggg	CRISPR spacer
cgtcaccggcggggctggcggcatcgg	Protospacer
***** *************** .  **

611. spacer 5.6|930393|27|NC_022350|CRT matches to NZ_CP045223 (Achromobacter xylosoxidans strain DN002 plasmid unnamed) position: , mismatch: 5, identity: 0.815

cgtcagcggcggggctggcggggaggg	CRISPR spacer
ccaaagcggcgagactggcggggaggg	Protospacer
*   *******.*.*************

612. spacer 5.6|930393|27|NC_022350|CRT matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 5, identity: 0.815

cgtcagcggcggggctggcggggaggg	CRISPR spacer
tgttcacggcggggctggcggggacgg	Protospacer
.**. .****************** **

613. spacer 5.6|930393|27|NC_022350|CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.815

cgtcagcggcggggctggcggggaggg	CRISPR spacer
cggcagcggcggggctggcggagccgc	Protospacer
** ******************.*  * 

614. spacer 5.6|930393|27|NC_022350|CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 5, identity: 0.815

cgtcagcggcggggctggcggggaggg	CRISPR spacer
cggcagcggcggggctggcggagccgc	Protospacer
** ******************.*  * 

615. spacer 5.6|930393|27|NC_022350|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815

cgtcagcggcggggctggcggggaggg	CRISPR spacer
actcgccggcgcggctggcggggaggg	Protospacer
  **. ***** ***************

616. spacer 5.10|930549|27|NC_022350|CRT matches to NZ_CP022264 (Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plA, complete sequence) position: , mismatch: 5, identity: 0.815

cggatccggcggcggcggtagcgttgc	CRISPR spacer
ggcaggcggcggcggcggtagcgttgg	Protospacer
 * *  ******************** 

617. spacer 5.10|930549|27|NC_022350|CRT matches to NZ_CP022264 (Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plA, complete sequence) position: , mismatch: 5, identity: 0.815

cggatccggcggcggcggtagcgttgc	CRISPR spacer
ggcaggcggcggcggcggtagcgttgg	Protospacer
 * *  ******************** 

618. spacer 5.10|930549|27|NC_022350|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 5, identity: 0.815

cggatccggcggcggcggtagcgttgc	CRISPR spacer
aggatccggccgcggcggtagcgctcg	Protospacer
 ********* ************.*  

619. spacer 5.10|930549|27|NC_022350|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 5, identity: 0.815

cggatccggcggcggcggtagcgttgc	CRISPR spacer
aggatccggccgcggcggtagcgctcg	Protospacer
 ********* ************.*  

620. spacer 5.10|930549|27|NC_022350|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.815

cggatccggcggcggcggtagcgttgc	CRISPR spacer
cgggtccggcggcggcggtggcggttt	Protospacer
***.***************.*** * .

621. spacer 5.10|930549|27|NC_022350|CRT matches to NZ_CP049908 (Hymenobacter sp. HDW8 plasmid p_unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815

cggatccggcggcggcggtagcgttgc	CRISPR spacer
cgactccggcggcgggggtagcgttcg	Protospacer
**. *********** *********  

622. spacer 5.10|930549|27|NC_022350|CRT matches to NZ_CP049700 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2a, complete sequence) position: , mismatch: 5, identity: 0.815

cggatccggcggcggcggtagcgttgc	CRISPR spacer
cgccgccggcggcggcggtggcgttgg	Protospacer
**   **************.****** 

623. spacer 5.10|930549|27|NC_022350|CRT matches to MH576962 (Streptomyces phage Satis, complete genome) position: , mismatch: 5, identity: 0.815

cggatccggcggcggcggtagcgttgc	CRISPR spacer
tgactccggcggcggccgtggcgttgc	Protospacer
.*. ************ **.*******

624. spacer 5.10|930549|27|NC_022350|CRT matches to MK620894 (Streptomyces phage Kradal, complete genome) position: , mismatch: 5, identity: 0.815

cggatccggcggcggcggtagcgttgc	CRISPR spacer
tgactccggcggcggccgtggcgttgc	Protospacer
.*. ************ **.*******

625. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 5, identity: 0.833

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgaggccggcctgctggtcgtctccgggct	Protospacer
*** **************** ******   

626. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 5, identity: 0.833

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
agattccggcctgttcgtcggctccggcgg	Protospacer
 **. ********.* **************

627. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 5, identity: 0.833

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgccatcggcctgctgctcggcaccggcgg	Protospacer
** *..********** ***** *******

628. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP031193 (Humibacter sp. BT305 plasmid unnamed1) position: , mismatch: 5, identity: 0.833

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgccgccggcctgctggtcggcgcggcggg	Protospacer
** ******************* * *  **

629. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP050092 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence) position: , mismatch: 5, identity: 0.833

cgacgccggcctgctggtcggc-tccggcgg	CRISPR spacer
cgacgccggcatgccggtcggcttcctgct-	Protospacer
********** ***.******* *** **  

630. spacer 5.15|930786|30|NC_022350|CRT matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.833

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
attgctgttcggctgcggcggcgcgggcgc	Protospacer
 .************ ********* **** 

631. spacer 5.15|930786|30|NC_022350|CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
attgctgttcggctgcggcggcgcgggcgc	Protospacer
 .************ ********* **** 

632. spacer 5.15|930786|30|NC_022350|CRT matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 5, identity: 0.833

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cctgctgctcggcaccggcggcgcactcgg	Protospacer
*******.***** **********   ***

633. spacer 5.15|930786|30|NC_022350|CRT matches to NZ_CP046705 (Nostoc sp. ATCC 53789 plasmid pNsp_b, complete sequence) position: , mismatch: 5, identity: 0.833

cctgctg--ttcggctccggcggcgctggcgg	CRISPR spacer
--tactgattacggctccggcggtgctggcgg	Protospacer
  *.***  * ************.********

634. spacer 5.15|930786|30|NC_022350|CRT matches to AY950802 (Haloarcula phage SH1, complete genome) position: , mismatch: 5, identity: 0.833

--cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
ggcctac--ttcggctccggcggctccggcgg	Protospacer
  ***.*  *************** *.*****

635. spacer 5.16|930834|24|NC_022350|CRT matches to NC_006911 (Streptomyces sp. F11 plasmid pFP11, complete sequence) position: , mismatch: 5, identity: 0.792

aaccgacctcggcggcgctggcgg	CRISPR spacer
gggcgacctcggcggcgctggcct	Protospacer
.. *******************  

636. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to MG925349 (Mycobacterium phage Mendokysei, complete genome) position: , mismatch: 5, identity: 0.853

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ggccggcggcaacggcggcgacggcgggttcccc	Protospacer
******************** ********  *. 

637. spacer 6.4|1217314|25|NC_022350|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.8

tgccggcggcctcggcgtagcgccc	CRISPR spacer
gcgcggcggcctcggcgtagagccg	Protospacer
   ***************** *** 

638. spacer 6.4|1217314|25|NC_022350|CRISPRCasFinder matches to NC_015178 (Acidiphilium multivorum AIU301 plasmid pACMV1, complete sequence) position: , mismatch: 5, identity: 0.8

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgccggcggcctcggcgtggccgag	Protospacer
******************.**    

639. spacer 6.4|1217314|25|NC_022350|CRISPRCasFinder matches to NZ_CP035002 (Rhizobium acidisoli strain FH23 plasmid pRapFH23d, complete sequence) position: , mismatch: 5, identity: 0.8

tgccggcggcctcggcgtagcgccc	CRISPR spacer
caccggcggcctcggcgtagcttgc	Protospacer
..******************* . *

640. spacer 6.4|1217314|25|NC_022350|CRISPRCasFinder matches to NC_009469 (Acidiphilium cryptum JF-5 plasmid pACRY03, complete sequence) position: , mismatch: 5, identity: 0.8

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgccggcggcctcggcgtggccgag	Protospacer
******************.**    

641. spacer 7.1|1572838|28|NC_022350|CRISPRCasFinder matches to NZ_LN907828 (Erwinia gerundensis isolate E_g_EM595 plasmid pEM01, complete sequence) position: , mismatch: 5, identity: 0.821

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
gctgccgtgggtgccatcgttgccgagt	Protospacer
*.***** *****************. .

642. spacer 7.1|1572838|28|NC_022350|CRISPRCasFinder matches to KU728633 (Mycobacterium phage Bipper, complete genome) position: , mismatch: 5, identity: 0.821

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
gcgtccgggggtgccgtcgttgccgtcc	Protospacer
*.  ***********.********* **

643. spacer 7.1|1572838|28|NC_022350|CRISPRCasFinder matches to MK977701 (Mycobacterium phage Cracklewink, complete genome) position: , mismatch: 5, identity: 0.821

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
gcgtccgggggtgccgtcgttgccgtcc	Protospacer
*.  ***********.********* **

644. spacer 7.1|1572838|28|NC_022350|CRISPRCasFinder matches to NZ_CP016354 (Prauserella marina strain DSM 45268 plasmid pPmarDSM45268, complete sequence) position: , mismatch: 5, identity: 0.821

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
gttgccgcgggtgccctcgttgcggacg	Protospacer
******* ******* ******* *.* 

645. spacer 7.5|1573060|25|NC_022350|CRISPRCasFinder matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 5, identity: 0.8

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gccgccgaacacgccgaagccgttt	Protospacer
 ..********************. 

646. spacer 7.5|1573060|25|NC_022350|CRISPRCasFinder matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 5, identity: 0.8

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gttgccgaacacgccgacgccgcgc	Protospacer
 **************** ****.  

647. spacer 7.10|1573453|31|NC_022350|CRISPRCasFinder matches to NC_018746 (Pseudomonas putida ND6 plasmid pND6-2, complete sequence) position: , mismatch: 5, identity: 0.839

aattg--cgccttgcccgccgttgccgccggca	CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca	Protospacer
  ***  *.****** **** ************

648. spacer 7.10|1573453|31|NC_022350|CRISPRCasFinder matches to MN961671 (Pseudomonas aeruginosa strain 201330 plasmid p201330-IMP, complete sequence) position: , mismatch: 5, identity: 0.839

aattg--cgccttgcccgccgttgccgccggca	CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca	Protospacer
  ***  *.****** **** ************

649. spacer 7.10|1573453|31|NC_022350|CRISPRCasFinder matches to MN961672 (Pseudomonas aeruginosa strain PA15W plasmid pPA15W-NR, complete sequence) position: , mismatch: 5, identity: 0.839

aattg--cgccttgcccgccgttgccgccggca	CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca	Protospacer
  ***  *.****** **** ************

650. spacer 7.13|1573702|34|NC_022350|CRISPRCasFinder matches to NC_006362 (Nocardia farcinica IFM 10152 plasmid pNF1, complete sequence) position: , mismatch: 5, identity: 0.853

gtcgccgtgcagccagccaccaccgcca-ccggcg	CRISPR spacer
ttcgccgtgcagccggccaccacctccagcctgc-	Protospacer
 *************.********* *** ** ** 

651. spacer 13.7|3736150|31|NC_022350|CRT matches to NC_010850 (Rhodococcus sp. NS1 plasmid pNSL1, complete sequence) position: , mismatch: 5, identity: 0.839

aacgccc-acttcaccgccgttgccgccgtca	CRISPR spacer
-acacccgacttcaccgccgctgccgccgaga	Protospacer
 **.*** ************.********  *

652. spacer 15.5|3946147|32|NC_022350|CRT matches to NZ_LR134451 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence) position: , mismatch: 5, identity: 0.844

aaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
agcagcgccaccggcggggccggcggcgactc	Protospacer
*. .*** *****************.******

653. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP025613 (Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggccaaggcggcatcggcgc	Protospacer
. ******* ********** **** 

654. spacer 15.11|3946672|26|NC_022350|CRT matches to CP047389 (Agrobacterium sp. CGMCC 11546 plasmid pA) position: , mismatch: 5, identity: 0.808

accggcggcaaaggcggcatgggcgg	CRISPR spacer
accggcggcaaaggcggcatccacct	Protospacer
********************  .*  

655. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP010957 (Sphingobium sp. YBL2 plasmid 3pYBL2-3, complete sequence) position: , mismatch: 5, identity: 0.808

accggcggcaaaggcggcatgggcgg	CRISPR spacer
gacggcggcgaaggcggcacgggcgc	Protospacer
. *******.*********.***** 

656. spacer 15.11|3946672|26|NC_022350|CRT matches to NC_007713 (Sodalis glossinidius str. 'morsitans' plasmid pSG1, complete sequence) position: , mismatch: 5, identity: 0.808

accggcggcaaaggcggcatgggcgg	CRISPR spacer
cccggcggcgaaggcggcctgggcca	Protospacer
 ********.******** ***** .

657. spacer 15.11|3946672|26|NC_022350|CRT matches to NC_014840 (Pantoea sp. At-9b plasmid pPAT9B03, complete sequence) position: , mismatch: 5, identity: 0.808

accggcggcaaaggcggcatgggcgg	CRISPR spacer
atcgtcggcaaaggcggcatggggcc	Protospacer
*.** ******************   

658. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP032313 (Pannonibacter phragmitetus BB plasmid p.BB_1, complete sequence) position: , mismatch: 5, identity: 0.808

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcaaaggtggcatcggcga	Protospacer
. ************.***** ****.

659. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.808

accggcggcaaaggcggcatgggcgg	CRISPR spacer
gccggcggcaatgtcggcatgggcac	Protospacer
.********** * **********. 

660. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_LN854558 (Sodalis glossinidius str. 'morsitans' isolate B4 plasmid pSG1, complete sequence) position: , mismatch: 5, identity: 0.808

accggcggcaaaggcggcatgggcgg	CRISPR spacer
cccggcggcgaaggcggcctgggcca	Protospacer
 ********.******** ***** .

661. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_LT960615 (Hartmannibacter diazotrophicus strain E19T plasmid HDIAp1, complete sequence) position: , mismatch: 5, identity: 0.808

accggcggcaaaggcggcatgggcgg	CRISPR spacer
gccggcggcaaaggcggcatctgtgt	Protospacer
.*******************  *.* 

662. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 5, identity: 0.808

accggcggcaaaggcggcatgggcgg	CRISPR spacer
atcgtcggcaaaggcggcatggggcc	Protospacer
*.** ******************   

663. spacer 15.11|3946672|26|NC_022350|CRT matches to NC_013859 (Azospirillum sp. B510 plasmid pAB510e, complete sequence) position: , mismatch: 5, identity: 0.808

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcgacggcggcatgggcgt	Protospacer
. *******.* ************* 

664. spacer 15.11|3946672|26|NC_022350|CRT matches to NC_007182 (Sodalis glossinidius pSG1 plasmid from Glossina austeni) position: , mismatch: 5, identity: 0.808

accggcggcaaaggcggcatgggcgg	CRISPR spacer
cccggcggcgaaggcggcctgggcca	Protospacer
 ********.******** ***** .

665. spacer 15.11|3946672|26|NC_022350|CRT matches to NC_007183 (Sodalis glossinidius pSG1 plasmid from Glossina palpalis palpalis) position: , mismatch: 5, identity: 0.808

accggcggcaaaggcggcatgggcgg	CRISPR spacer
cccggcggcgaaggcggcctgggcca	Protospacer
 ********.******** ***** .

666. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 5, identity: 0.808

accggcggcaaaggcggcatgggcgg	CRISPR spacer
accggcggcaacggcggcatcgggca	Protospacer
*********** ******** **  .

667. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_AP022338 (Mameliella alba strain KU6B plasmid pKUB257, complete sequence) position: , mismatch: 5, identity: 0.808

accggcggcaaaggcggcatgggcgg	CRISPR spacer
acaggcggcaagggcggcatgggtca	Protospacer
** ********.***********. .

668. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP041045 (Paracoccus sp. AK26 plasmid pAK1, complete sequence) position: , mismatch: 5, identity: 0.808

accggcggcaaaggcggcatgggcgg	CRISPR spacer
tccggcggcaccggcggcatgggcaa	Protospacer
 *********  ************..

669. spacer 15.11|3946672|26|NC_022350|CRT matches to NC_042098 (Erwinia phage vB_EamM_Desertfox, complete genome) position: , mismatch: 5, identity: 0.808

accggcggcaaaggcggcatgggcgg	CRISPR spacer
tccggcggcaaaggcgtcatggatga	Protospacer
 *************** *****..*.

670. spacer 15.11|3946672|26|NC_022350|CRT matches to MG655267 (Erwinia phage vB_EamM_Bosolaphorus, complete genome) position: , mismatch: 5, identity: 0.808

accggcggcaaaggcggcatgggcgg	CRISPR spacer
tccggcggcaaaggcgtcatggatga	Protospacer
 *************** *****..*.

671. spacer 15.11|3946672|26|NC_022350|CRT matches to MG655269 (Erwinia phage vB_EamM_MadMel, complete genome) position: , mismatch: 5, identity: 0.808

accggcggcaaaggcggcatgggcgg	CRISPR spacer
tccggcggcaaaggcgtcatggatga	Protospacer
 *************** *****..*.

672. spacer 15.11|3946672|26|NC_022350|CRT matches to KF806589 (Erwinia phage Ea35-70, complete genome) position: , mismatch: 5, identity: 0.808

accggcggcaaaggcggcatgggcgg	CRISPR spacer
tccggcggcaaaggcgtcatggatga	Protospacer
 *************** *****..*.

673. spacer 15.11|3946672|26|NC_022350|CRT matches to KU886223 (Erwinia phage vB_EamM_Simmy50, complete genome) position: , mismatch: 5, identity: 0.808

accggcggcaaaggcggcatgggcgg	CRISPR spacer
tccggcggcaaaggcgtcatggatga	Protospacer
 *************** *****..*.

674. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 5, identity: 0.808

accggcggcaaaggcggcatgggcgg	CRISPR spacer
accggcggcaacggcggcatcgggca	Protospacer
*********** ******** **  .

675. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP009975 (Pseudomonas putida S12 plasmid pTTS12, complete sequence) position: , mismatch: 5, identity: 0.808

accggcggcaaaggcggcatgggcgg	CRISPR spacer
gtgggcggcaagggcggcaagggcgg	Protospacer
.. ********.******* ******

676. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP045381 (Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence) position: , mismatch: 5, identity: 0.808

accggcggcaaaggcggcatgggcgg	CRISPR spacer
gtgggcggcacaggcggcacgggcgg	Protospacer
.. ******* ********.******

677. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP007797 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence) position: , mismatch: 5, identity: 0.808

accggcggcaaaggcggcatgggcgg	CRISPR spacer
accggcggcaacggcggcatcgggca	Protospacer
*********** ******** **  .

678. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP023549 (Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808

accggcggcaaaggcggcatgggcgg	CRISPR spacer
gccggcggcaagggcggcacgggcct	Protospacer
.**********.*******.****  

679. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP010860 (Marinovum algicola DG 898 plasmid pMaD5, complete sequence) position: , mismatch: 5, identity: 0.808

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggcggcggcaaaggcggcgagggcga	Protospacer
. ****************. *****.

680. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 5, identity: 0.808

accggcggcaaaggcggcatgggcgg	CRISPR spacer
accggcggcaacggcggcatcgggca	Protospacer
*********** ******** **  .

681. spacer 15.11|3946672|26|NC_022350|CRT matches to AY129335 (Mycobacterium virus Corndog, complete genome) position: , mismatch: 5, identity: 0.808

accggcggcaaaggcggcatgggcgg	CRISPR spacer
gtgggcggcaagggcggcaagggcgg	Protospacer
.. ********.******* ******

682. spacer 15.11|3946672|26|NC_022350|CRT matches to NC_004685 (Mycobacterium phage Corndog, complete genome) position: , mismatch: 5, identity: 0.808

accggcggcaaaggcggcatgggcgg	CRISPR spacer
gtgggcggcaagggcggcaagggcgg	Protospacer
.. ********.******* ******

683. spacer 15.11|3946672|26|NC_022350|CRT matches to MG099943 (Mycobacterium phage Familton, complete genome) position: , mismatch: 5, identity: 0.808

accggcggcaaaggcggcatgggcgg	CRISPR spacer
gtgggcggcaagggcggcaagggcgg	Protospacer
.. ********.******* ******

684. spacer 15.11|3946672|26|NC_022350|CRT matches to MN585964 (Mycobacterium phage Blessica, complete genome) position: , mismatch: 5, identity: 0.808

accggcggcaaaggcggcatgggcgg	CRISPR spacer
gtgggcggcaagggcggcaagggcgg	Protospacer
.. ********.******* ******

685. spacer 15.11|3946672|26|NC_022350|CRT matches to KJ829260 (Mycobacterium phage YungJamal, complete genome) position: , mismatch: 5, identity: 0.808

accggcggcaaaggcggcatgggcgg	CRISPR spacer
gtgggcggcaagggcggcaagggcgg	Protospacer
.. ********.******* ******

686. spacer 15.11|3946672|26|NC_022350|CRT matches to NC_022057 (Mycobacterium phage Catdawg, complete genome) position: , mismatch: 5, identity: 0.808

accggcggcaaaggcggcatgggcgg	CRISPR spacer
gtgggcggcaagggcggcaagggcgg	Protospacer
.. ********.******* ******

687. spacer 15.11|3946672|26|NC_022350|CRT matches to MN428052 (Mycobacterium phage Smooch, complete genome) position: , mismatch: 5, identity: 0.808

accggcggcaaaggcggcatgggcgg	CRISPR spacer
gtgggcggcaagggcggcaagggcgg	Protospacer
.. ********.******* ******

688. spacer 15.11|3946672|26|NC_022350|CRT matches to NC_048047 (Caulobacter phage CcrBL9, complete genome) position: , mismatch: 5, identity: 0.808

accggcggcaaaggcggcatgggcgg	CRISPR spacer
ggtggcggcgcaggcggcatgggcgg	Protospacer
. .******. ***************

689. spacer 2.8|341396|27|NC_022350|CRT matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 6, identity: 0.778

gcgccgaacagcccgccagagccgcca	CRISPR spacer
ttgccgaacagcccgccggagccgagc	Protospacer
 .***************.******   

690. spacer 2.8|341396|27|NC_022350|CRT matches to NZ_CP042263 (Litoreibacter sp. LN3S51 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.778

gcgccgaacagcccgccagagccgcca	CRISPR spacer
ccgccaaacagcccgccagagcggaag	Protospacer
 ****.**************** *  .

691. spacer 2.8|341396|27|NC_022350|CRT matches to NZ_CP024423 (Paracoccus yeei strain TT13 plasmid pTT13-1, complete sequence) position: , mismatch: 6, identity: 0.778

gcgccgaacagcccgccagagccgcca	CRISPR spacer
atttcgaacggcccgccagacccgcca	Protospacer
.. .*****.********** ******

692. spacer 2.8|341396|27|NC_022350|CRT matches to NZ_CP014964 (Geobacter anodireducens strain SD-1 plasmid pSD, complete sequence) position: , mismatch: 6, identity: 0.778

gcgccgaacagcccgccagagccgcca	CRISPR spacer
tcgccgaacagcccgccagatcgatga	Protospacer
 ******************* * .. *

693. spacer 2.8|341396|27|NC_022350|CRT matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 6, identity: 0.778

gcgccgaacagcccgccagagccgcca	CRISPR spacer
aatccgaccagcccgccatagccgccc	Protospacer
.  **** ********** ******* 

694. spacer 2.8|341396|27|NC_022350|CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 6, identity: 0.778

gcgccgaacagcccgccagagccgcca	CRISPR spacer
gcgccgaacagcccggcaaagcccttg	Protospacer
*************** **.**** ...

695. spacer 2.9|341441|30|NC_022350|CRT matches to NZ_CP010863 (Marinovum algicola DG 898 plasmid pMaD8, complete sequence) position: , mismatch: 6, identity: 0.8

ccaaagatgccgaatccgccgggcccaccg---	CRISPR spacer
ccgaagatgccgaatccgccg---ccgcagagc	Protospacer
**.******************   **.* *   

696. spacer 2.14|341741|27|NC_022350|CRT matches to NZ_CP050082 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b4, complete sequence) position: , mismatch: 6, identity: 0.778

ttgccgatgagcccgccggcgccgccg	CRISPR spacer
ccgccgatgaacccgccggcgtcgcgc	Protospacer
..********.**********.***  

697. spacer 2.14|341741|27|NC_022350|CRT matches to NZ_CP015090 (Pelagibaca abyssi strain JLT2014 plasmid pPABY2, complete sequence) position: , mismatch: 6, identity: 0.778

ttgccgatgagcccgccggcgccgccg	CRISPR spacer
cggcccatgggcccgccggcgccgctc	Protospacer
. *** ***.***************. 

698. spacer 2.14|341741|27|NC_022350|CRT matches to NZ_CP049732 (Rhizobium leguminosarum strain A1 plasmid pRL11, complete sequence) position: , mismatch: 6, identity: 0.778

ttgccgatgagcccgccggcgccgccg	CRISPR spacer
ccgccgatgaacccgccggcgtcgcgc	Protospacer
..********.**********.***  

699. spacer 2.14|341741|27|NC_022350|CRT matches to NZ_CP022317 (Brachybacterium avium strain VR2415 plasmid unnamed1) position: , mismatch: 6, identity: 0.778

ttgccgatgagcccgccggcgccgccg	CRISPR spacer
ccagcgaggaggccgccggcgccgccg	Protospacer
... *** *** ***************

700. spacer 2.14|341741|27|NC_022350|CRT matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 6, identity: 0.778

ttgccgatgagcccgccggcgccgccg	CRISPR spacer
cgatcgatgatcccgcccgcgccgccg	Protospacer
. ..****** ****** *********

701. spacer 2.14|341741|27|NC_022350|CRT matches to NZ_CP023549 (Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.778

ttgccgatgagcccgccggcgccgccg	CRISPR spacer
gtggcgatgagcccgccgacgccgtta	Protospacer
 ** **************.*****...

702. spacer 2.14|341741|27|NC_022350|CRT matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.778

ttgccgatgagcccgccggcgccgccg	CRISPR spacer
acgccgacgagcccgcccgcgccgcgt	Protospacer
 .*****.********* *******  

703. spacer 2.14|341741|27|NC_022350|CRT matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 6, identity: 0.778

ttgccgatgagcccgccggcgccgccg	CRISPR spacer
ccgccgatgcgctcgccggcgccgcgc	Protospacer
..******* **.************  

704. spacer 2.14|341741|27|NC_022350|CRT matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 6, identity: 0.778

ttgccgatgagcccgccggcgccgccg	CRISPR spacer
acgccgacgagcccgcccgcgccgcgt	Protospacer
 .*****.********* *******  

705. spacer 2.14|341741|27|NC_022350|CRT matches to NZ_CP046573 (Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence) position: , mismatch: 6, identity: 0.778

ttgccgatgagcccgccggcgccgccg	CRISPR spacer
gcgccgatgagcccgccggcgatgcac	Protospacer
 .******************* .**  

706. spacer 2.14|341741|27|NC_022350|CRT matches to NZ_CP025550 (Mycobacterium paragordonae strain 49061 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.778

ttgccgatgagcccgccggcgccgccg	CRISPR spacer
cagggtatgagcccgccagcgccgccg	Protospacer
. *   ***********.*********

707. spacer 2.14|341741|27|NC_022350|CRT matches to NZ_CP016619 (Microvirga ossetica strain V5/3m plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.778

ttgccgatgagcccgccggcgccgccg	CRISPR spacer
gctccgatgatcccgccggcgtcgcct	Protospacer
 . ******* **********.**** 

708. spacer 3.1|369657|27|NC_022350|CRISPRCasFinder matches to NZ_CP045917 (Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence) position: , mismatch: 6, identity: 0.778

aacgcaccggtgtccacatcgcccgtg	CRISPR spacer
agttcactggtgtccacatcgcccgaa	Protospacer
*.. ***.***************** .

709. spacer 3.6|369987|33|NC_022350|CRISPRCasFinder matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.818

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
agcaggtcgatcacgatctggccgttgccggcg	Protospacer
**   *.***** ******************.*

710. spacer 3.7|370053|27|NC_022350|CRISPRCasFinder matches to NZ_CP022542 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-2, complete sequence) position: , mismatch: 6, identity: 0.778

gcgaagccgatgttgtagctgccggtg	CRISPR spacer
ggataggcgatgttgtagctgccggaa	Protospacer
* . ** ****************** .

711. spacer 3.9|370203|27|NC_022350|CRISPRCasFinder matches to NC_009959 (Dinoroseobacter shibae DFL 12 = DSM 16493 plasmid pDSHI05, complete sequence) position: , mismatch: 6, identity: 0.778

gccaagccgatatcgaagatcccggtg	CRISPR spacer
accatgccgatatcgacgatcccgtcc	Protospacer
.*** *********** ******* . 

712. spacer 3.10|370263|27|NC_022350|CRISPRCasFinder matches to NZ_CP009112 (Rhodococcus opacus strain 1CP plasmid pR1CP1, complete sequence) position: , mismatch: 6, identity: 0.778

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tagacgccgaagtcgaggtcggcgagg	Protospacer
    *********.******* *****

713. spacer 3.10|370263|27|NC_022350|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.778

accccgccgaagttgaggtcgccgagg	CRISPR spacer
ctcccgccgaagttgagggtgccgaac	Protospacer
 .**************** .*****. 

714. spacer 3.10|370263|27|NC_022350|CRISPRCasFinder matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 6, identity: 0.778

accccgccgaagttgaggtcgccgagg	CRISPR spacer
aagaagccgaagttgaggtcgccgtag	Protospacer
*    ******************* .*

715. spacer 3.10|370263|27|NC_022350|CRISPRCasFinder matches to MK494099 (Mycobacterium phage Typha, complete genome) position: , mismatch: 6, identity: 0.778

accccgccgaagttgaggtcgccgagg	CRISPR spacer
cggtcgccgaggtcgaggtcgccgagg	Protospacer
   .******.**.*************

716. spacer 4.1|696509|31|NC_022350|CRISPRCasFinder matches to GQ141189 (Bifidobacterium phage Bbif-1, complete sequence) position: , mismatch: 6, identity: 0.806

agcgcgaacggcaagccgaac----cgttggaccc	CRISPR spacer
agcgcgaacggccagccgaaccatgcgctgg----	Protospacer
************ ********    **.***    

717. spacer 5.6|930393|27|NC_022350|CRT matches to NZ_LN907829 (Erwinia gerundensis isolate E_g_EM595 plasmid pEM02, complete sequence) position: , mismatch: 6, identity: 0.778

cgtcagcggcggggctggcggggaggg	CRISPR spacer
tgtaagcggctgggctggcggggatat	Protospacer
.** ****** ************* . 

718. spacer 5.6|930393|27|NC_022350|CRT matches to NZ_CP041653 (Streptomyces sp. RLB1-9 plasmid pRLB1-9.1, complete sequence) position: , mismatch: 6, identity: 0.778

cgtcagcggcggggctggcggggaggg	CRISPR spacer
tgtcagcggcggggctggcgttcatcg	Protospacer
.*******************   *  *

719. spacer 5.6|930393|27|NC_022350|CRT matches to NZ_CP010826 (Thermus aquaticus Y51MC23 plasmid pTA78, complete sequence) position: , mismatch: 6, identity: 0.778

cgtcagcggcggggctggcggggaggg	CRISPR spacer
tagaagcggcggggctggtggagaggg	Protospacer
..  **************.**.*****

720. spacer 5.6|930393|27|NC_022350|CRT matches to NZ_CP054620 (Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence) position: , mismatch: 6, identity: 0.778

cgtcagcggcggggctggcggggaggg	CRISPR spacer
gcgcaccggcggggctggcggggcggc	Protospacer
   ** ***************** ** 

721. spacer 5.10|930549|27|NC_022350|CRT matches to NZ_AP021845 (Azospira sp. I09 plasmid pAZI09, complete sequence) position: , mismatch: 6, identity: 0.778

cggatccggcggcggcggtagcgttgc	CRISPR spacer
cggatcctgcggcggcggtagaaagcc	Protospacer
******* ************* .   *

722. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
gagcgtcggcctgctggtcggcttcggcgc	Protospacer
 ..**.*****************.***** 

723. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
gagcgtcggcctgctggtcggcttcggcgc	Protospacer
 ..**.*****************.***** 

724. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgacgacggcctggtggtcggctacctcga	Protospacer
***** ******* ********* *  **.

725. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgcgatcggcctgctgctcggcaccggcgg	Protospacer
**  ..********** ***** *******

726. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgcgatcggcctgctgctcggcaccggcgg	Protospacer
**  ..********** ***** *******

727. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgcgcgcggcgtgccggtcggctccggcgg	Protospacer
**    **** ***.***************

728. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP053207 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgcgatcggcctgctgctcggcaccggcgg	Protospacer
**  ..********** ***** *******

729. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgcgcgcggcgtgccggtcggctccggcgg	Protospacer
**    **** ***.***************

730. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgcggcgggcctgctggtcggcttcggcac	Protospacer
**  ** ****************.****. 

731. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

732. spacer 5.13|930690|30|NC_022350|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

733. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

734. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP037868 (Hydrogenophaga pseudoflava strain DSM 1084 plasmid pDSM1084, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcg----gctccggcgg	CRISPR spacer
cgacgccggccggctggtcggagagctgcg----	Protospacer
*********** ********    *** **    

735. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

736. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

737. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP023549 (Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgtcgccggcctgctgatcggcttcttctg	Protospacer
** *************.******.*  * *

738. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

739. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

740. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

741. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

742. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

743. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

744. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

745. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

746. spacer 5.13|930690|30|NC_022350|CRT matches to NC_019408 (Caulobacter phage CcrRogue, complete genome) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgtcatcggcctgctggtcgtcgccggcgc	Protospacer
** *..************** * ****** 

747. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgacgccgacctgctggtcggggcggactg	Protospacer
********.************  * *.* *

748. spacer 5.15|930786|30|NC_022350|CRT matches to NZ_CP017941 (Phyllobacterium zundukense strain Tri-48 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
caagctggtcggccccggcggcgctggcaa	Protospacer
*  **** *****.**************..

749. spacer 5.15|930786|30|NC_022350|CRT matches to MK937608 (Microbacterium phage Cressida, complete genome) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tcacctgtccggctccggcggcggtggcga	Protospacer
.*  ****.************** *****.

750. spacer 5.15|930786|30|NC_022350|CRT matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cctgctgctcggcaccggcggcgcgcttgg	Protospacer
*******.***** **********   .**

751. spacer 5.15|930786|30|NC_022350|CRT matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cctgctgctcggcaccggcggcgcgcttgg	Protospacer
*******.***** **********   .**

752. spacer 5.15|930786|30|NC_022350|CRT matches to NZ_CP017592 (Pantoea stewartii subsp. stewartii DC283 plasmid ppDSJ01, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg--	CRISPR spacer
tctgctgttcggctgcggcggcg--agcagcg	Protospacer
.************* ********  .**.*  

753. spacer 5.15|930786|30|NC_022350|CRT matches to NZ_CP008898 (Enterobacter hormaechei subsp. hoffmannii ECNIH3 plasmid pENT-576, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gctgctgttcggcgccgccggcgctattgg	Protospacer
 ************ *** *******. .**

754. spacer 5.15|930786|30|NC_022350|CRT matches to NZ_CP023489 (Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_02, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gctgctgttcggcgccgccggcgctattgg	Protospacer
 ************ *** *******. .**

755. spacer 5.15|930786|30|NC_022350|CRT matches to NZ_CP043515 (Enterobacter kobei strain EB_P8_L5_01.19 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gctgctgttcggcgccgccggcgctattgg	Protospacer
 ************ *** *******. .**

756. spacer 5.15|930786|30|NC_022350|CRT matches to NZ_CP053207 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cctgctgctcggcaccggcggcgcgcttgg	Protospacer
*******.***** **********   .**

757. spacer 5.15|930786|30|NC_022350|CRT matches to NZ_LT984809 (Cupriavidus taiwanensis isolate Cupriavidus taiwanensis STM 8555 plasmid I, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
catcgcgctcggcttcggcggcgctggcgg	Protospacer
* *  .*.******.***************

758. spacer 5.15|930786|30|NC_022350|CRT matches to NZ_CP026371 (Klebsiella quasipneumoniae strain A708 plasmid pA708-3, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gctgctgttcggcgccgccggcgctattgg	Protospacer
 ************ *** *******. .**

759. spacer 5.15|930786|30|NC_022350|CRT matches to NZ_CP050069 (Klebsiella aerogenes strain 035 plasmid p035_A-VIM-1, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gctgctgttcggcgccgccggcgctattgg	Protospacer
 ************ *** *******. .**

760. spacer 5.15|930786|30|NC_022350|CRT matches to NZ_CP039425 (Citricoccus sp. SGAir0253 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cctgctgttcggcaccgacggcgccctccg	Protospacer
************* ***.******.  * *

761. spacer 5.15|930786|30|NC_022350|CRT matches to NZ_CP009856 (UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH5 plasmid pENT-784, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gctgctgttcggcgccgccggcgctattgg	Protospacer
 ************ *** *******. .**

762. spacer 5.15|930786|30|NC_022350|CRT matches to NZ_CP039430 (Citricoccus sp. SGAir0453 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cctgctgttcggcaccgacggcgccctccg	Protospacer
************* ***.******.  * *

763. spacer 5.15|930786|30|NC_022350|CRT matches to NZ_CP040937 (Hymenobacter sp. DG01 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgt-tcggctccggcggcgctggcgg	CRISPR spacer
-ccgccgcgccggctccggccgcgctggcgg	Protospacer
 *.**.*. .********** **********

764. spacer 5.15|930786|30|NC_022350|CRT matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cgtccagctcggcgccggcggcgctggcgt	Protospacer
* * * *.***** *************** 

765. spacer 5.15|930786|30|NC_022350|CRT matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cgtccagctcggcgccggcggcgctggcgt	Protospacer
* * * *.***** *************** 

766. spacer 5.15|930786|30|NC_022350|CRT matches to NZ_CP006588 (Hymenobacter sp. APR13 plasmid pHA, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgt-tcggctccggcggcgctggcgg	CRISPR spacer
-ccgccgcgccggctccggccgcgctggcgg	Protospacer
 *.**.*. .********** **********

767. spacer 5.15|930786|30|NC_022350|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgtt--cggctccggcggcgctggcgg	CRISPR spacer
--cgccgctggcggcgccggcggcgctggcgg	Protospacer
  .**.*.*  **** ****************

768. spacer 5.15|930786|30|NC_022350|CRT matches to NZ_AP022333 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgtt----cggctccggcggcgctggcgg	CRISPR spacer
----cagttggggcggctccggcggcgcgggcgg	Protospacer
    * ***    *************** *****

769. spacer 5.15|930786|30|NC_022350|CRT matches to MH029534 (Myoviridae environmental samples clone NHS-Seq2, complete sequence) position: , mismatch: 6, identity: 0.8

-cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
atttggt-ttcggcgctggcggcgctggcgg	Protospacer
 ..** * ****** *.**************

770. spacer 5.17|930876|36|NC_022350|CRT matches to MT723940 (Mycobacterium phage Ellie, complete genome) position: , mismatch: 6, identity: 0.833

gctgatcggcaacggcggtaacggcggggccggcgg	CRISPR spacer
cgttgtcggcaacggcggtaacggcgggggtggcgg	Protospacer
  * .************************ .*****

771. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.824

ggccggcggcaacggcggcgccggcg--ggtggcta	CRISPR spacer
ggccggcggcaagggcggcgacggcggcgccggc--	Protospacer
************ ******* *****  * .***  

772. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.824

ggccggcggcaacggcggcgccggcgggt--ggcta	CRISPR spacer
caccggcggcaacggcggcggcggcggcttcggc--	Protospacer
 .****************** ****** *  ***  

773. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 6, identity: 0.824

ggccggcggcaacggcggcgccggcgg-gtggcta	CRISPR spacer
caccggcggcagcggcggcgccggcggcacggct-	Protospacer
 .*********.*************** ..**** 

774. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 6, identity: 0.824

ggccggcggcaacggcggcgccggcgggtggcta-	CRISPR spacer
cggcggcggcaacggcggcgctggt-ggtggcaac	Protospacer
 * ******************.**. ****** * 

775. spacer 7.1|1572838|28|NC_022350|CRISPRCasFinder matches to NZ_AP022571 (Mycolicibacterium poriferae strain JCM 12603 plasmid pJCM12603, complete sequence) position: , mismatch: 6, identity: 0.786

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
ggtgccgggggtggcaccgttgccgcgg	Protospacer
* *********** **.********   

776. spacer 7.1|1572838|28|NC_022350|CRISPRCasFinder matches to NC_008703 (Mycobacterium sp. KMS plasmid pMKMS01, complete sequence) position: , mismatch: 6, identity: 0.786

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
ggtgccgggggtggcaccgttgccgcgg	Protospacer
* *********** **.********   

777. spacer 7.1|1572838|28|NC_022350|CRISPRCasFinder matches to NZ_LR594663 (Variovorax sp. RA8 plasmid 2) position: , mismatch: 6, identity: 0.786

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
ggtgccggcggtgccatcggtgccgagg	Protospacer
* ****** ********** *****.  

778. spacer 7.10|1573453|31|NC_022350|CRISPRCasFinder matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 6, identity: 0.806

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ccttgcgccttgcccgccgctgccgcagggc	Protospacer
  *****************.****** **  

779. spacer 7.10|1573453|31|NC_022350|CRISPRCasFinder matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 6, identity: 0.806

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ccttgcgccttgcccgccgctgccgcagggc	Protospacer
  *****************.****** **  

780. spacer 7.13|1573702|34|NC_022350|CRISPRCasFinder matches to NZ_CP044425 (Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence) position: , mismatch: 6, identity: 0.824

--gtcgccgtgcagccagccaccaccgccaccggcg	CRISPR spacer
ctgtcgtc--gcagcgcgccaccaccgccaccggca	Protospacer
  ****.*  *****  ******************.

781. spacer 13.7|3736150|31|NC_022350|CRT matches to NC_009478 (Clavibacter michiganensis subsp. michiganensis NCPPB 382 plasmid pCM1, complete sequence) position: , mismatch: 6, identity: 0.806

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgaccacttcaccgccgtcgccgccggcg	Protospacer
. ** ***************.******* *.

782. spacer 14.12|3930108|30|NC_022350|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.8

gcggtgggcagcgtcggtaacgccgggatc	CRISPR spacer
ccggtgggcatcgtcggtgacgccggacgc	Protospacer
 ********* *******.*******.  *

783. spacer 15.5|3946147|32|NC_022350|CRT matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 6, identity: 0.812

aaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
aagcgcggcaccggcgggaccggcggcgtgtc	Protospacer
**. **************.******.**  **

784. spacer 15.11|3946672|26|NC_022350|CRT matches to NC_008271 (Rhodococcus jostii RHA1 plasmid pRHL3, complete sequence) position: , mismatch: 6, identity: 0.769

accggcggcaaaggcggcatgggcgg	CRISPR spacer
cttctcggcaaaggcggcatgggcga	Protospacer
 ..  ********************.

785. spacer 15.11|3946672|26|NC_022350|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.769

accggcggcaaaggcggcatgggcgg	CRISPR spacer
accggcggcaaaggcggcaacctctt	Protospacer
*******************    *  

786. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP013528 (Rhizobium phaseoli strain R723 plasmid pRphaR723a, complete sequence) position: , mismatch: 6, identity: 0.769

accggcggcaaaggcggcatgggcgg	CRISPR spacer
gccggcggcaagggcggcatggcgtc	Protospacer
.**********.**********    

787. spacer 15.11|3946672|26|NC_022350|CRT matches to NZ_CP013581 (Rhizobium phaseoli strain N261 plasmid pRphaN261a, complete sequence) position: , mismatch: 6, identity: 0.769

accggcggcaaaggcggcatgggcgg	CRISPR spacer
gccggcggcaagggcggcatggcgtc	Protospacer
.**********.**********    

788. spacer 2.8|341396|27|NC_022350|CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.741

gcgccgaacagcccgccagagccgcca	CRISPR spacer
ttgccgaacagcccgccagaccccagg	Protospacer
 .****************** **   .

789. spacer 2.14|341741|27|NC_022350|CRT matches to MT740732 (Ralstonia phage Darius, complete genome) position: , mismatch: 7, identity: 0.741

ttgccgatgagcccgccggcgccgccg	CRISPR spacer
ccagctctgagcccgccggcgccgcca	Protospacer
... *  *******************.

790. spacer 2.14|341741|27|NC_022350|CRT matches to MT740740 (Ralstonia phage Gervaise, complete genome) position: , mismatch: 7, identity: 0.741

ttgccgatgagcccgccggcgccgccg	CRISPR spacer
ccagctctgagcccgccggcgccgcca	Protospacer
... *  *******************.

791. spacer 2.14|341741|27|NC_022350|CRT matches to MH638294 (Ralstonia phage GP4, complete genome) position: , mismatch: 7, identity: 0.741

ttgccgatgagcccgccggcgccgccg	CRISPR spacer
ccagctctgagcccgccggcgccgcca	Protospacer
... *  *******************.

792. spacer 3.4|369852|27|NC_022350|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.741

aagccgcccgagttcgcgagaccgaag	CRISPR spacer
tgaccgcccgagttcgcgagacgttgg	Protospacer
 ..*******************   .*

793. spacer 4.1|696509|31|NC_022350|CRISPRCasFinder matches to MK977708 (Mycobacterium phage Fulbright, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

794. spacer 4.1|696509|31|NC_022350|CRISPRCasFinder matches to MG099948 (Mycobacterium phage Philonius, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

795. spacer 4.1|696509|31|NC_022350|CRISPRCasFinder matches to MH926055 (Mycobacterium phage Chewbacca, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

796. spacer 4.1|696509|31|NC_022350|CRISPRCasFinder matches to MT723932 (Mycobacterium phage Schnauzer, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

797. spacer 4.1|696509|31|NC_022350|CRISPRCasFinder matches to KU935726 (Mycobacterium phage Xerxes, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

798. spacer 4.1|696509|31|NC_022350|CRISPRCasFinder matches to KU935730 (Mycobacterium phage Pipsqueaks, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

799. spacer 4.1|696509|31|NC_022350|CRISPRCasFinder matches to MH316570 (Mycobacterium phage Silvafighter, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

800. spacer 4.1|696509|31|NC_022350|CRISPRCasFinder matches to MK524518 (Mycobacterium phage Smurph, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

801. spacer 4.1|696509|31|NC_022350|CRISPRCasFinder matches to MK524515 (Mycobacterium phage Parmesanjohn, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

802. spacer 4.1|696509|31|NC_022350|CRISPRCasFinder matches to MH697585 (Mycobacterium phage Gex, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

803. spacer 4.1|696509|31|NC_022350|CRISPRCasFinder matches to KM588359 (Mycobacterium phage Carcharodon, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

804. spacer 4.1|696509|31|NC_022350|CRISPRCasFinder matches to MH697576 (Mycobacterium phage Aggie, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

805. spacer 4.1|696509|31|NC_022350|CRISPRCasFinder matches to MH697593 (Mycobacterium phage Tapioca, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

806. spacer 4.1|696509|31|NC_022350|CRISPRCasFinder matches to MG099936 (Mycobacterium phage Andies, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

807. spacer 4.1|696509|31|NC_022350|CRISPRCasFinder matches to NC_031243 (Mycobacterium phage Xeno, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

808. spacer 4.1|696509|31|NC_022350|CRISPRCasFinder matches to JN256079 (Mycobacterium phage Charlie, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

809. spacer 5.6|930393|27|NC_022350|CRT matches to NZ_CP010614 (Phaeobacter inhibens strain P92 plasmid pP92_d, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
gattcgcggcggggctggcggggatct	Protospacer
 .*. *******************   

810. spacer 5.6|930393|27|NC_022350|CRT matches to NZ_CP010626 (Phaeobacter inhibens strain P51 plasmid pP51_c, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
gattcgcggcggggctggcggggatct	Protospacer
 .*. *******************   

811. spacer 5.6|930393|27|NC_022350|CRT matches to NZ_CP010671 (Phaeobacter inhibens strain P57 plasmid pP57_c, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
gattcgcggcggggctggcggggatct	Protospacer
 .*. *******************   

812. spacer 5.6|930393|27|NC_022350|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
cgtcagcggcgggggtggcggcacacc	Protospacer
************** ****** . .  

813. spacer 5.6|930393|27|NC_022350|CRT matches to NZ_CP010598 (Phaeobacter inhibens strain P10 plasmid pP10_c, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
gattcgcggcggggctggcggggatct	Protospacer
 .*. *******************   

814. spacer 5.6|930393|27|NC_022350|CRT matches to NC_018288 (Phaeobacter inhibens DSM 17395 plasmid pPGA1_65, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
gattcgcggcggggctggcggggatct	Protospacer
 .*. *******************   

815. spacer 5.6|930393|27|NC_022350|CRT matches to NZ_CP031955 (Phaeobacter inhibens strain 2.10 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
gattcgcggcggggctggcggggatct	Protospacer
 .*. *******************   

816. spacer 5.6|930393|27|NC_022350|CRT matches to NZ_CP016368 (Phaeobacter porticola strain P97 plasmid pP97_d, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
gattggcggcggggctggcggggatct	Protospacer
 .*..*******************   

817. spacer 5.6|930393|27|NC_022350|CRT matches to NC_018422 (Phaeobacter inhibens 2.10 plasmid pPGA2_71, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
gattcgcggcggggctggcggggatct	Protospacer
 .*. *******************   

818. spacer 5.6|930393|27|NC_022350|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
cgtcagcggcgggggtggcggcacacc	Protospacer
************** ****** . .  

819. spacer 5.6|930393|27|NC_022350|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
cgtcagcggcgggggtggcggcacacc	Protospacer
************** ****** . .  

820. spacer 5.6|930393|27|NC_022350|CRT matches to NZ_CP010605 (Phaeobacter inhibens strain P83 plasmid pP83_f, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
gattcgcggcggggctggcggggatct	Protospacer
 .*. *******************   

821. spacer 5.6|930393|27|NC_022350|CRT matches to NZ_CP010744 (Phaeobacter inhibens strain P59 plasmid pP59_c, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
gattcgcggcggggctggcggggatct	Protospacer
 .*. *******************   

822. spacer 5.6|930393|27|NC_022350|CRT matches to NZ_CP010622 (Phaeobacter inhibens strain P30 isolate M4-3.1A plasmid pP30_e, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
gattcgcggcggggctggcggggatct	Protospacer
 .*. *******************   

823. spacer 5.6|930393|27|NC_022350|CRT matches to NZ_CP010732 (Phaeobacter inhibens strain P88 plasmid pP88_g, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
gattcgcggcggggctggcggggatct	Protospacer
 .*. *******************   

824. spacer 5.6|930393|27|NC_022350|CRT matches to NZ_CP010655 (Phaeobacter inhibens strain P54 plasmid pP54_e, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
gattcgcggcggggctggcggggatct	Protospacer
 .*. *******************   

825. spacer 5.6|930393|27|NC_022350|CRT matches to NZ_CP010711 (Phaeobacter inhibens strain P66 plasmid pP66_f, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
gattcgcggcggggctggcggggatct	Protospacer
 .*. *******************   

826. spacer 5.6|930393|27|NC_022350|CRT matches to NZ_CP010702 (Phaeobacter inhibens strain P24 plasmid pP24_f, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
gattcgcggcggggctggcggggatct	Protospacer
 .*. *******************   

827. spacer 5.6|930393|27|NC_022350|CRT matches to NZ_CP010748 (Phaeobacter inhibens strain P48 isolate M21-2.3 plasmid pP48_c, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
gattcgcggcggggctggcggggatct	Protospacer
 .*. *******************   

828. spacer 5.6|930393|27|NC_022350|CRT matches to NZ_CP010739 (Phaeobacter inhibens strain P72 plasmid pP72_d, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
gattcgcggcggggctggcggggatct	Protospacer
 .*. *******************   

829. spacer 5.13|930690|30|NC_022350|CRT matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggtcgccggcctgctggtcgggttcggatc	Protospacer
 * ****************** *.***   

830. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

831. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

832. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ctgctgcagcctgctggtcagctccggcgc	Protospacer
* .*  *.***********.********* 

833. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

834. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

835. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ctgctgcagcctgctggtcagctccggcgc	Protospacer
* .*  *.***********.********* 

836. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

837. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

838. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

839. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

840. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

841. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

842. spacer 5.13|930690|30|NC_022350|CRT matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgggaccggcccgctggtcggccccggctt	Protospacer
**. .******.**********.*****  

843. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
gctgggcggcctgctggtcggctggggcgg	Protospacer
    * *****************  *****

844. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

845. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

846. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

847. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

848. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

849. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

850. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgcaggtcggcttcacctt	Protospacer
 ************* ********.*. *  

851. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

852. spacer 5.13|930690|30|NC_022350|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

853. spacer 5.13|930690|30|NC_022350|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

854. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

855. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

856. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

857. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

858. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

859. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

860. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

861. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

862. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

863. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

864. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

865. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

866. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

867. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

868. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

869. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

870. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

871. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

872. spacer 5.13|930690|30|NC_022350|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

873. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

874. spacer 5.13|930690|30|NC_022350|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

875. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

876. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

877. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

878. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

879. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

880. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

881. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

882. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

883. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

884. spacer 5.13|930690|30|NC_022350|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

885. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

886. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

887. spacer 5.13|930690|30|NC_022350|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

888. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

889. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

890. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

891. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

892. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

893. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

894. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

895. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

896. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

897. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

898. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

899. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

900. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

901. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

902. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

903. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

904. spacer 5.13|930690|30|NC_022350|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

905. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

906. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

907. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

908. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

909. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

910. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

911. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

912. spacer 5.13|930690|30|NC_022350|CRT matches to HM560026 (Uncultured bacterium plasmid pTRACA45, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
acacgccgccctgctggtcggcttaggtcg	Protospacer
  ****** **************. **. *

913. spacer 5.13|930690|30|NC_022350|CRT matches to NC_010867 (Neisseria lactamica plasmid pNL3.1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
gaacgccgccctgctggtcggcttagtcgc	Protospacer
 .****** **************. * ** 

914. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP020471 (Rhodobacter blasticus strain 28/5 plasmid pRsa, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
agacgccggcctgctgttcggcctcgaccc	Protospacer
 *************** *****..**.*  

915. spacer 5.13|930690|30|NC_022350|CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgggctcggcctgctgctcggcttcggcga	Protospacer
**.  .********** ******.*****.

916. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggc-tccggcgg	CRISPR spacer
gtcggccggcctgctggtcggcgcccggct-	Protospacer
    ****************** .*****  

917. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP035710 (Sphaerotilus natans subsp. sulfidivorans strain D-507 plasmid pSna507_unt10, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgacgacggcctgctggtcgacttcatccc	Protospacer
***** **************.**.*. *  

918. spacer 5.13|930690|30|NC_022350|CRT matches to KT997827 (Uncultured Mediterranean phage uvDeep-CGR0-KM15-C219, complete genome) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
gttcgccggcctgctggaccgctccgtggg	Protospacer
   ************** * ******  **

919. spacer 5.13|930690|30|NC_022350|CRT matches to AP021850 (Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgtgtccggcctgctggtcgggttcggcac	Protospacer
**   **************** *.****. 

920. spacer 5.13|930690|30|NC_022350|CRT matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
tgacgccgccctgctggtcggcaaagtcga	Protospacer
.******* *************   * **.

921. spacer 5.13|930690|30|NC_022350|CRT matches to KT997829 (Uncultured Mediterranean phage uvDeep-CGR0-KM22-C158, complete genome) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
gttcgccggcctgctggaccgctccgtggg	Protospacer
   ************** * ******  **

922. spacer 5.15|930786|30|NC_022350|CRT matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tttcggggtcggctccggcggcgctggcga	Protospacer
..*   * *********************.

923. spacer 5.15|930786|30|NC_022350|CRT matches to NZ_CP035001 (Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tttcggggtcggctccggcggcgctggcga	Protospacer
..*   * *********************.

924. spacer 5.15|930786|30|NC_022350|CRT matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
ctccgcgctcggctccggcggcggtggcgg	Protospacer
*..  .*.*************** ******

925. spacer 5.15|930786|30|NC_022350|CRT matches to NC_007765 (Rhizobium etli CFN 42 plasmid p42e, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tttccggctcggcgccggcggcgctggcga	Protospacer
..* * *.***** ***************.

926. spacer 5.15|930786|30|NC_022350|CRT matches to NZ_CP006989 (Rhizobium sp. IE4771 plasmid pRetIE4771c, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tttccggctcggcgccggcggcgctggcga	Protospacer
..* * *.***** ***************.

927. spacer 5.15|930786|30|NC_022350|CRT matches to NZ_CP020909 (Rhizobium etli strain NXC12 plasmid pRetNXC12c, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tttccggctcggcgccggcggcgctggcga	Protospacer
..* * *.***** ***************.

928. spacer 5.15|930786|30|NC_022350|CRT matches to NZ_CP024423 (Paracoccus yeei strain TT13 plasmid pTT13-1, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tctcgggctcggccccggcggcgctggcgc	Protospacer
.**   *.*****.*************** 

929. spacer 5.15|930786|30|NC_022350|CRT matches to NZ_CP020951 (Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tttccggctcggcgccggcggcgctggcga	Protospacer
..* * *.***** ***************.

930. spacer 5.15|930786|30|NC_022350|CRT matches to NC_021908 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1d, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tttccggctcggcgccggcggcgctggcga	Protospacer
..* * *.***** ***************.

931. spacer 5.15|930786|30|NC_022350|CRT matches to NZ_CP020441 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tctcgggctcggccccggcggcgctggcgc	Protospacer
.**   *.*****.*************** 

932. spacer 5.15|930786|30|NC_022350|CRT matches to CP007642 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803a, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tttccggctcggcgccggcggcgctggcga	Protospacer
..* * *.***** ***************.

933. spacer 5.15|930786|30|NC_022350|CRT matches to NZ_CP044080 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tctcgggctcggccccggcggcgctggcgc	Protospacer
.**   *.*****.*************** 

934. spacer 5.15|930786|30|NC_022350|CRT matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg	Protospacer
*.  *** ***************** *. *

935. spacer 5.15|930786|30|NC_022350|CRT matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg	Protospacer
*.  *** ***************** *. *

936. spacer 5.15|930786|30|NC_022350|CRT matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg-	CRISPR spacer
actgctgtccggctccggcggca-tgatgtc	Protospacer
 *******.*************. **..*  

937. spacer 5.15|930786|30|NC_022350|CRT matches to MN582086 (Siphoviridae sp. ctdEk19, complete genome) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gccggccttcgacttcggcggcgctggcgg	Protospacer
 *.* . ****.**.***************

938. spacer 5.15|930786|30|NC_022350|CRT matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg	Protospacer
*.  *** ***************** *. *

939. spacer 5.15|930786|30|NC_022350|CRT matches to NZ_CP022700 (Acetobacter tropicalis strain BDGP1 plasmid pAtBDGP1A, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gttcctccacggttccggcggcgctggcgg	Protospacer
 .* ** . ***.*****************

940. spacer 5.15|930786|30|NC_022350|CRT matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg	Protospacer
*.  *** ***************** *. *

941. spacer 5.15|930786|30|NC_022350|CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg	Protospacer
*.  *** ***************** *. *

942. spacer 5.15|930786|30|NC_022350|CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg	Protospacer
*.  *** ***************** *. *

943. spacer 5.15|930786|30|NC_022350|CRT matches to NZ_CP031082 (Paracoccus yeei strain CCUG 32053 plasmid pYEE4, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tctcgggctcggccccggcggcgctggcgc	Protospacer
.**   *.*****.*************** 

944. spacer 5.17|930876|36|NC_022350|CRT matches to NC_022087 (Mycobacterium phage AnnaL29, complete genome) position: , mismatch: 7, identity: 0.806

gctgatcggcaacggcggtaacggcggggccggcgg	CRISPR spacer
cgtgatcggcaacggcggaaacggcgggagctgggg	Protospacer
  **************** *********. * * **

945. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg-gtggcta	CRISPR spacer
ggccggaggcaccggcggcgccggcggcacgggc-	Protospacer
****** **** *************** ..** . 

946. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcggg--tggcta	CRISPR spacer
gaccggcggcagcggcggcgcgggcggagccggc--	Protospacer
*.*********.********* *****.  .***  

947. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP025548 (Mycobacterium paragordonae strain 49061 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg-gtggcta	CRISPR spacer
cgcaggcggcaacggcggccccggcggcgccgcc-	Protospacer
 ** *************** ******* *. **. 

948. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgggtggcta----	CRISPR spacer
ggccgggggcaacggcggcgacggc----gtctacgac	Protospacer
****** ************* ****    * ***    

949. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to MT889380 (Mycobacterium phage Coco12, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
tgccggcggcaacggcggcaacggcggcagcagc--	Protospacer
 ******************. ******  *..**  

950. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to MT114167 (Mycobacterium phage Phanphagia, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
tgccggcggcaacggcggcaacggcggcagcagc--	Protospacer
 ******************. ******  *..**  

951. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcggg--tggcta	CRISPR spacer
tgtcggcggcagcggcggcggcggcggggccggc--	Protospacer
 *.********.******** *******  .***  

952. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP039644 (Azospirillum sp. TSA2s plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgggt--ggcta	CRISPR spacer
ggccggcggcatcggcgacgccggctgcttcagc--	Protospacer
*********** *****.******* * *  .**  

953. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgggtggcta-	CRISPR spacer
caccggcggccacggcggcaccggc-ggcggcgat	Protospacer
 .******** ********.***** **.*** * 

954. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP039641 (Azospirillum sp. TSH100 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg-gtggcta	CRISPR spacer
agacggcggcaccggcggcggcggcggtgaggcc-	Protospacer
.* ******** ******** ****** * ***. 

955. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to MH697583 (Mycobacterium phage EricMillard, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg---gtggcta	CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg---	Protospacer
. *************** * *******   ****   

956. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to MH727551 (Mycobacterium phage Kalah2, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg---gtggcta	CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg---	Protospacer
. *************** * *******   ****   

957. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to MH077579 (Mycobacterium phage Halley, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg---gtggcta	CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg---	Protospacer
. *************** * *******   ****   

958. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to MH669017 (Mycobacterium phage Zelink, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg---gtggcta	CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg---	Protospacer
. *************** * *******   ****   

959. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to MN062701 (Mycobacterium phage Dallas, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg---gtggcta	CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg---	Protospacer
. *************** * *******   ****   

960. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to MK524527 (Mycobacterium phage ThreeRngTarjay, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg---gtggcta	CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg---	Protospacer
. *************** * *******   ****   

961. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to MK524529 (Mycobacterium phage Phoebus, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg---gtggcta	CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg---	Protospacer
. *************** * *******   ****   

962. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to MF919512 (Mycobacterium phage Klein, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg---gtggcta	CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg---	Protospacer
. *************** * *******   ****   

963. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to KF114875 (Mycobacterium phage Redno2, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg---gtggcta	CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg---	Protospacer
. *************** * *******   ****   

964. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to MK967379 (Mycobacterium phage HokkenD, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg---gtggcta	CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg---	Protospacer
. *************** * *******   ****   

965. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP025513 (Neorhizobium sp. SOG26 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg-gtggcta	CRISPR spacer
agacggtggcagcggcggcgccggcggcggtgct-	Protospacer
.* ***.****.*************** *  *** 

966. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_LR134450 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 8, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcggg-tggcta	CRISPR spacer
ggtcggcgccaacggcggcgccggtgaactgggt-	Protospacer
**.***** ***************.*.. *** * 

967. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NC_005241 (Cupriavidus necator H16 megaplasmid pHG1, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggc--gggtggcta	CRISPR spacer
cgctggcggcaacgtcggcgccggccatggcggc--	Protospacer
 **.********** **********   **.***  

968. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgggtggcta-	CRISPR spacer
tggcggcggcaacggcggcggtggc-ggtggcggt	Protospacer
 * ***************** .*** ****** . 

969. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP039289 (Cupriavidus necator H16 plasmid pHG1, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggc--gggtggcta	CRISPR spacer
cgctggcggcaacgtcggcgccggccatggcggc--	Protospacer
 **.********** **********   **.***  

970. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to MN813686 (Mycobacterium phage BirdsNest, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcg--ggtggcta	CRISPR spacer
tgctggcggcaacggcggcgtcggcatcgctggc--	Protospacer
 **.****************.****.  * ****  

971. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NC_042035 (Mycobacterium phage Zemanar, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgggtggcta-	CRISPR spacer
cgacggcggcaacggcggcggtggc-ggtggtcac	Protospacer
 * ***************** .*** *****..* 

972. spacer 6.9|1217578|37|NC_022350|CRISPRCasFinder matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 7, identity: 0.811

tgtcggcggtgccggcggcaccggcgggttaggcaac	CRISPR spacer
tgtcggcggtgccggcggtgccggcggtgccggcgac	Protospacer
******************..*******  . ***.**

973. spacer 7.1|1572838|28|NC_022350|CRISPRCasFinder matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 7, identity: 0.75

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
agcacccggggtgccgtcgttgccggcg	Protospacer
. ..** ********.*********** 

974. spacer 7.10|1573453|31|NC_022350|CRISPRCasFinder matches to NZ_CP041045 (Paracoccus sp. AK26 plasmid pAK1, complete sequence) position: , mismatch: 7, identity: 0.774

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
gttgccgccatgcccgccgctgccgccggcc	Protospacer
. *  **** *********.********** 

975. spacer 7.10|1573453|31|NC_022350|CRISPRCasFinder matches to CP017041 (Propionibacterium sp. oral taxon 193 strain F0672 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
aacggcgtcttgcccgccgtggccgccaccg	Protospacer
**. ***.************ ******. *.

976. spacer 8.3|2087658|30|NC_022350|CRT matches to NZ_CP015065 (Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence) position: , mismatch: 7, identity: 0.767

tcggagaaagccgtcggtttgcacgctgtt	CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac	Protospacer
*. *. ************ ********* .

977. spacer 8.3|2087658|30|NC_022350|CRT matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 7, identity: 0.767

tcggagaaagccgtcggtttgcacgctgtt	CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac	Protospacer
*. *. ************ ********* .

978. spacer 8.3|2087658|30|NC_022350|CRT matches to NC_014918 (Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence) position: , mismatch: 7, identity: 0.767

tcggagaaagccgtcggtttgcacgctgtt	CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac	Protospacer
*. *. ************ ********* .

979. spacer 13.7|3736150|31|NC_022350|CRT matches to NZ_CP010990 (Pseudonocardia sp. EC080625-04 plasmid pFRP1-1, complete sequence) position: , mismatch: 7, identity: 0.774

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
cccacccacttcaccgacgtcgccgccgacg	Protospacer
  *.************ ***.******* *.

980. spacer 13.7|3736150|31|NC_022350|CRT matches to NZ_CP012186 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-1, complete sequence) position: , mismatch: 7, identity: 0.774

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
cccacccacttcaccgacgtcgccgccgacg	Protospacer
  *.************ ***.******* *.

981. spacer 13.7|3736150|31|NC_022350|CRT matches to NZ_CP042263 (Litoreibacter sp. LN3S51 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.774

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
atccgccatttcaccgccgttgccgacgccg	Protospacer
* *  ***.**************** **.*.

982. spacer 14.12|3930108|30|NC_022350|CRT matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 7, identity: 0.767

gcggtgggcagcgtcggtaacgccgggatc	CRISPR spacer
gatcagagaagcgacggtaacgccgggatc	Protospacer
*    *.* **** ****************

983. spacer 15.3|3945994|35|NC_022350|CRT matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.8

agcggcggggccggcggtagcggcggggccaactt	CRISPR spacer
aacggcggggccggcggtagcggcggcgcaggcgc	Protospacer
*.************************ ** ..* .

984. spacer 15.3|3945994|35|NC_022350|CRT matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 7, identity: 0.8

agcggcggggccggcggtagcggcggggccaactt	CRISPR spacer
agcggcggggacggcggcagcggcggcgggctctt	Protospacer
********** ******.******** *    ***

985. spacer 15.3|3945994|35|NC_022350|CRT matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.8

agcggcggggccggcggtagcggcgg---ggccaactt	CRISPR spacer
agcggcggtgtcggcggtagcggcggcgaggtcga---	Protospacer
******** *.***************   **.*.*   

986. spacer 15.3|3945994|35|NC_022350|CRT matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.8

agcggcggggccggcggtagcggcgg---ggccaactt	CRISPR spacer
agcggcggtgtcggcggtagcggcggcgaggtcga---	Protospacer
******** *.***************   **.*.*   

987. spacer 15.3|3945994|35|NC_022350|CRT matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.8

agcggcggggccggcggtagcggcgg---ggccaactt	CRISPR spacer
agcggcggtgtcggcggtagcggcggcgaggtcga---	Protospacer
******** *.***************   **.*.*   

988. spacer 15.3|3945994|35|NC_022350|CRT matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.8

agcggcggggccggcggtagcggcgg---ggccaactt	CRISPR spacer
agcggcggtgtcggcggtagcggcggcgaggtcga---	Protospacer
******** *.***************   **.*.*   

989. spacer 15.3|3945994|35|NC_022350|CRT matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 7, identity: 0.8

agcggcggggccggcggtagcggcgg---ggccaactt	CRISPR spacer
agcggcggtgtcggcggtagcggcggcgaggtcga---	Protospacer
******** *.***************   **.*.*   

990. spacer 15.3|3945994|35|NC_022350|CRT matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.8

agcggcggggccggcggtagcggcgg---ggccaactt	CRISPR spacer
agcggcggtgtcggcggtagcggcggcgaggtcga---	Protospacer
******** *.***************   **.*.*   

991. spacer 15.3|3945994|35|NC_022350|CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.8

agcggcggggccggcggtagcggcgg---ggccaactt	CRISPR spacer
agcggcggtgtcggcggtagcggcggcgaggtcga---	Protospacer
******** *.***************   **.*.*   

992. spacer 15.3|3945994|35|NC_022350|CRT matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.8

agcggcggggccggcggtagcggcgg---ggccaactt	CRISPR spacer
agcggcggtgtcggcggtagcggcggcgaggtcga---	Protospacer
******** *.***************   **.*.*   

993. spacer 15.3|3945994|35|NC_022350|CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.8

agcggcggggccggcggtagcggcgg---ggccaactt	CRISPR spacer
agcggcggtgtcggcggtagcggcggcgaggtcga---	Protospacer
******** *.***************   **.*.*   

994. spacer 15.3|3945994|35|NC_022350|CRT matches to NZ_CP030264 (Ensifer adhaerens strain Corn53 plasmid AB, complete sequence) position: , mismatch: 7, identity: 0.8

agcggcggggccggcggtagcggcggggccaactt--	CRISPR spacer
ggcggcgcggccggcggcagcggc--ggccaacccgg	Protospacer
.****** *********.******  *******..  

995. spacer 15.5|3946147|32|NC_022350|CRT matches to NZ_CP050092 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence) position: , mismatch: 7, identity: 0.781

aaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
aaagtcggcaccggcggggacggaacctcctc	Protospacer
**** ************** *** . *  ***

996. spacer 15.5|3946147|32|NC_022350|CRT matches to CP006582 (Mesorhizobium huakuii 7653R plasmid pMHa, complete sequence) position: , mismatch: 7, identity: 0.781

aaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
aaagacggcgccggcggggccgggatcggcgc	Protospacer
****.****.************* . **.* *

997. spacer 15.10|3946600|35|NC_022350|CRT matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.8

agcggcggggccggcggtagcggcggggccaactt	CRISPR spacer
aacggcggggccggcggtagcggcggcgcaggcgc	Protospacer
*.************************ ** ..* .

998. spacer 15.10|3946600|35|NC_022350|CRT matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 7, identity: 0.8

agcggcggggccggcggtagcggcggggccaactt	CRISPR spacer
agcggcggggacggcggcagcggcggcgggctctt	Protospacer
********** ******.******** *    ***

999. spacer 15.10|3946600|35|NC_022350|CRT matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.8

agcggcggggccggcggtagcggcgg---ggccaactt	CRISPR spacer
agcggcggtgtcggcggtagcggcggcgaggtcga---	Protospacer
******** *.***************   **.*.*   

1000. spacer 15.10|3946600|35|NC_022350|CRT matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.8

agcggcggggccggcggtagcggcgg---ggccaactt	CRISPR spacer
agcggcggtgtcggcggtagcggcggcgaggtcga---	Protospacer
******** *.***************   **.*.*   

1001. spacer 15.10|3946600|35|NC_022350|CRT matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.8

agcggcggggccggcggtagcggcgg---ggccaactt	CRISPR spacer
agcggcggtgtcggcggtagcggcggcgaggtcga---	Protospacer
******** *.***************   **.*.*   

1002. spacer 15.10|3946600|35|NC_022350|CRT matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.8

agcggcggggccggcggtagcggcgg---ggccaactt	CRISPR spacer
agcggcggtgtcggcggtagcggcggcgaggtcga---	Protospacer
******** *.***************   **.*.*   

1003. spacer 15.10|3946600|35|NC_022350|CRT matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 7, identity: 0.8

agcggcggggccggcggtagcggcgg---ggccaactt	CRISPR spacer
agcggcggtgtcggcggtagcggcggcgaggtcga---	Protospacer
******** *.***************   **.*.*   

1004. spacer 15.10|3946600|35|NC_022350|CRT matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.8

agcggcggggccggcggtagcggcgg---ggccaactt	CRISPR spacer
agcggcggtgtcggcggtagcggcggcgaggtcga---	Protospacer
******** *.***************   **.*.*   

1005. spacer 15.10|3946600|35|NC_022350|CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.8

agcggcggggccggcggtagcggcgg---ggccaactt	CRISPR spacer
agcggcggtgtcggcggtagcggcggcgaggtcga---	Protospacer
******** *.***************   **.*.*   

1006. spacer 15.10|3946600|35|NC_022350|CRT matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.8

agcggcggggccggcggtagcggcgg---ggccaactt	CRISPR spacer
agcggcggtgtcggcggtagcggcggcgaggtcga---	Protospacer
******** *.***************   **.*.*   

1007. spacer 15.10|3946600|35|NC_022350|CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.8

agcggcggggccggcggtagcggcgg---ggccaactt	CRISPR spacer
agcggcggtgtcggcggtagcggcggcgaggtcga---	Protospacer
******** *.***************   **.*.*   

1008. spacer 15.10|3946600|35|NC_022350|CRT matches to NZ_CP030264 (Ensifer adhaerens strain Corn53 plasmid AB, complete sequence) position: , mismatch: 7, identity: 0.8

agcggcggggccggcggtagcggcggggccaactt--	CRISPR spacer
ggcggcgcggccggcggcagcggc--ggccaacccgg	Protospacer
.****** *********.******  *******..  

1009. spacer 2.9|341441|30|NC_022350|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.733

ccaaagatgccgaatccgccgggcccaccg	CRISPR spacer
gaggcgatgccgaaaccgccgggccgacca	Protospacer
  .. ********* ********** ***.

1010. spacer 2.13|341690|33|NC_022350|CRT matches to NC_007805 (Pseudomonas phage F10, complete genome) position: , mismatch: 8, identity: 0.758

gcgccgccggtccccgtgctggccctcccgccg	CRISPR spacer
gcgccgccggtcgccgtcctggcccagcgctgg	Protospacer
************ **** *******  *  . *

1011. spacer 2.13|341690|33|NC_022350|CRT matches to KJ959591 (Pseudomonas phage PAN70, partial genome) position: , mismatch: 8, identity: 0.758

gcgccgccggtccccgtgctggccctcccgccg	CRISPR spacer
gcgccgccggtcgccgtcctggcccagcgctgg	Protospacer
************ **** *******  *  . *

1012. spacer 2.13|341690|33|NC_022350|CRT matches to NC_031091 (Pseudomonas phage MD8, complete genome) position: , mismatch: 8, identity: 0.758

gcgccgccggtccccgtgctggccctcccgccg	CRISPR spacer
gcgccgccggtcgccgtcctggcccggcactgg	Protospacer
************ **** *******  *  . *

1013. spacer 2.13|341690|33|NC_022350|CRT matches to DQ163912 (Bacteriophage F10, complete genome) position: , mismatch: 8, identity: 0.758

gcgccgccggtccccgtgctggccctcccgccg	CRISPR spacer
gcgccgccggtcgccgtcctggcccagcgctgg	Protospacer
************ **** *******  *  . *

1014. spacer 3.6|369987|33|NC_022350|CRISPRCasFinder matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 8, identity: 0.758

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
ttggtgtcgatctcgatctggccgttgcccgca	Protospacer
  * **.*****.**************** *..

1015. spacer 3.6|369987|33|NC_022350|CRISPRCasFinder matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 8, identity: 0.758

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
agctggttgatgccgatctggccgctgccggtc	Protospacer
** . *..*** ************.******* 

1016. spacer 3.6|369987|33|NC_022350|CRISPRCasFinder matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
atgctgccgaccccgatctggtcgttttcgact	Protospacer
* ********.**********.**** .**.. 

1017. spacer 3.6|369987|33|NC_022350|CRISPRCasFinder matches to CP007644 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence) position: , mismatch: 8, identity: 0.758

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
cggctgccgatcccgatcaggacgtcgaccttc	Protospacer
 ***************** ** ***.* *  * 

1018. spacer 3.6|369987|33|NC_022350|CRISPRCasFinder matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.758

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
agctggttgatgccgatctggccgctgccggtc	Protospacer
** . *..*** ************.******* 

1019. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgacgccggcctgctggtcgggctgacctc	Protospacer
********************* .. . *  

1020. spacer 5.13|930690|30|NC_022350|CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ccgcaaactcctgctggtcggcgccggcgg	Protospacer
* .*.    ************* *******

1021. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgatgccggcctgctggtcggggttcccag	Protospacer
***.*****************  ..  *.*

1022. spacer 5.13|930690|30|NC_022350|CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ccgcaaactcctgctggtcggcgccggcgg	Protospacer
* .*.    ************* *******

1023. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ccttcagggcgtgctggtcggctccggcgc	Protospacer
*  .   *** ****************** 

1024. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_KY126370 (Enterobacter cloacae subsp. cloacae strain MN201516 plasmid pOP-I, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
catggccggcctgctgctcggcaccgggac	Protospacer
*.  ************ ***** **** . 

1025. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP054625 (Cupriavidus gilardii strain FDAARGOS_639 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggccgccggcctgctgtgcggctccgcgct	Protospacer
 * *************  ********    

1026. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgatgccggcctgctggtcggggttcccag	Protospacer
***.*****************  ..  *.*

1027. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_LT960615 (Hartmannibacter diazotrophicus strain E19T plasmid HDIAp1, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
gttcaccgccctgctgatcggctccggcat	Protospacer
   *.*** *******.***********. 

1028. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP046347 (Citrobacter portucalensis strain FDAARGOS_738 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
catggccggcctgctgctcggcaccgggac	Protospacer
*.  ************ ***** **** . 

1029. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP044100 (Citrobacter werkmanii strain FDAARGOS_616 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
catggccggcctgctgctcggcaccgggac	Protospacer
*.  ************ ***** **** . 

1030. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP032156 (Mycobacterium sp. ELW1 plasmid pELW1-1, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
aatcgccggcctgctggtcggtgccgcggt	Protospacer
 . ******************. ***  * 

1031. spacer 5.13|930690|30|NC_022350|CRT matches to KY555144 (Caulobacter phage Ccr5, complete genome) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggtgatcggcctgctggtcgtcgccggcgc	Protospacer
 *  ..************** * ****** 

1032. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_KP873172 (Pseudomonas aeruginosa PAO1 plasmid pAMBL1, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
catggccggcctgctgctcggcaccgggac	Protospacer
*.  ************ ***** **** . 

1033. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP045203 (Citrobacter sp. NMI7904_11 plasmid pCTEL-2, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
catggccggcctgctgctcggcaccgggac	Protospacer
*.  ************ ***** **** . 

1034. spacer 5.13|930690|30|NC_022350|CRT matches to NC_021492 (Enterobacter sp. R4-368 plasmid pENT01, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
catggccggcctgctgctcggcaccgggac	Protospacer
*.  ************ ***** **** . 

1035. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP022156 (Escherichia coli strain ABWA45 plasmid pABWA45_2, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
catggccggcctgctgctcggcaccgggac	Protospacer
*.  ************ ***** **** . 

1036. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP024682 (Citrobacter freundii strain UMH14 plasmid pUMH14_2, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
catggccggcctgctgctcggcaccgggac	Protospacer
*.  ************ ***** **** . 

1037. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgatgccggcctgctggtcggggttcccag	Protospacer
***.*****************  ..  *.*

1038. spacer 5.15|930786|30|NC_022350|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cgaccatctcggctccgacggcgctggcgc	Protospacer
*   *  .*********.*********** 

1039. spacer 5.15|930786|30|NC_022350|CRT matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcgccggcggcgctggcga	Protospacer
. *   *.***** ***************.

1040. spacer 5.15|930786|30|NC_022350|CRT matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gccaccccgcggctccggaggcgctggcgg	Protospacer
 *..*. . ********* ***********

1041. spacer 5.15|930786|30|NC_022350|CRT matches to NZ_CP013525 (Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcaccggcggcgctggcga	Protospacer
. *   *.***** ***************.

1042. spacer 5.15|930786|30|NC_022350|CRT matches to NZ_CP013588 (Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcaccggcggcgctggcga	Protospacer
. *   *.***** ***************.

1043. spacer 5.15|930786|30|NC_022350|CRT matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcgccggcggcgctggcga	Protospacer
. *   *.***** ***************.

1044. spacer 5.15|930786|30|NC_022350|CRT matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcgccggcggcgctggcga	Protospacer
. *   *.***** ***************.

1045. spacer 5.15|930786|30|NC_022350|CRT matches to NZ_CP013529 (Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcgccggcggcgctggcga	Protospacer
. *   *.***** ***************.

1046. spacer 5.15|930786|30|NC_022350|CRT matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcgccggcggcgctggcga	Protospacer
. *   *.***** ***************.

1047. spacer 5.15|930786|30|NC_022350|CRT matches to NZ_CP013539 (Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcgccggcggcgctggcga	Protospacer
. *   *.***** ***************.

1048. spacer 5.15|930786|30|NC_022350|CRT matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcgccggcggcgctggcga	Protospacer
. *   *.***** ***************.

1049. spacer 5.15|930786|30|NC_022350|CRT matches to NZ_CP013582 (Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcgccggcggcgctggcga	Protospacer
. *   *.***** ***************.

1050. spacer 5.15|930786|30|NC_022350|CRT matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcgccggcggcgctggcga	Protospacer
. *   *.***** ***************.

1051. spacer 5.15|930786|30|NC_022350|CRT matches to NC_010998 (Rhizobium etli CIAT 652 plasmid pA, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcaccggcggcgctggcga	Protospacer
. *   *.***** ***************.

1052. spacer 5.15|930786|30|NC_022350|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cctgctgatcggctccggcgccggcttctc	Protospacer
******* ************ ** .  *  

1053. spacer 5.15|930786|30|NC_022350|CRT matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gctgctgtgcggctccggcggcaaccccga	Protospacer
 ******* *************. .  **.

1054. spacer 5.15|930786|30|NC_022350|CRT matches to NZ_LR134452 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cctgatgttcgactccggcggcgacgcacc	Protospacer
**** ******.*********** .*    

1055. spacer 5.15|930786|30|NC_022350|CRT matches to NZ_AP014706 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_2p, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gcaccgcgccggctccggcggcggtggcgg	Protospacer
 *  *   .************** ******

1056. spacer 5.17|930876|36|NC_022350|CRT matches to MG770216 (Mycobacterium phage Rem711, complete genome) position: , mismatch: 8, identity: 0.778

gctgatcggcaacggcggtaacggcggggccggcgg	CRISPR spacer
attcggcggcaacggcggcaacggcgcggccggcgc	Protospacer
..* . ************.******* ******** 

1057. spacer 5.17|930876|36|NC_022350|CRT matches to KY087993 (Mycobacterium phage Hammy, complete genome) position: , mismatch: 8, identity: 0.778

gctgatcggcaacggcggtaacggcggggccggcgg	CRISPR spacer
gcagatcggcaccggcggtaacggcggcggtgcagc	Protospacer
** ******** *************** * .*  * 

1058. spacer 5.17|930876|36|NC_022350|CRT matches to MF140406 (Mycobacterium phage DarthP, complete genome) position: , mismatch: 8, identity: 0.778

gctgatcggcaacggcggtaacggcggggccggcgg	CRISPR spacer
gcagatcggcaccggcggtaacggcggcggtgcagc	Protospacer
** ******** *************** * .*  * 

1059. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
caacggcggcaacggcggcgacggcggtcgcggt--	Protospacer
 . ***************** ******  *.**.  

1060. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
ccccggcggcaacggcggcaacggcggcaatgcc--	Protospacer
  *****************. ******  .** *  

1061. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
cgccggcggcagcgccggcgccggcagtatcggc--	Protospacer
 **********.** **********.*   .***  

1062. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta--	CRISPR spacer
tgtcggcggtaacggcggcgtcggcgg--agccagc	Protospacer
 *.******.**********.******  .**.*  

1063. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta-----	CRISPR spacer
ggccggcggcaacgtcggcgccggt-----gccaatgtt	Protospacer
************** *********.     **.*     

1064. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NC_047958 (Burkholderia phage vB_BmuP_KL4, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
tgccggccgcaacgacggcgccggcggccggtgc	Protospacer
 ****** ******.************ .**.  

1065. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta-----	CRISPR spacer
ggccggcggcaacgtcggcgccggt-----gccaatgtt	Protospacer
************** *********.     **.*     

1066. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta--	CRISPR spacer
ctccggcggcaacggcggtgccgccgg--gaccact	Protospacer
  ****************.**** ***  *.*.*  

1067. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcgggaagggcggcgccggcggcggtctg	Protospacer
  ******* ** **************  * **.

1068. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta-----	CRISPR spacer
ggccggcggcaacgtcggcgccggt-----gccaatgtt	Protospacer
************** *********.     **.*     

1069. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta-----	CRISPR spacer
ggccggcggcaacgtcggcgccggt-----gccaatgtt	Protospacer
************** *********.     **.*     

1070. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
cgccggcggaaacggtggcgccggcggcacggtg	Protospacer
 ******** *****.***********   * *.

1071. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg-gtggcta	CRISPR spacer
taccggcggcaatggaggcgccggcggcatcgcc-	Protospacer
 .**********.** *********** .* **. 

1072. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta--	CRISPR spacer
ctccggcggcaacggcggtgccgccgg--gaccact	Protospacer
  ****************.**** ***  *.*.*  

1073. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta--	CRISPR spacer
ctccggcggcaacggcggtgccgccgg--gaccact	Protospacer
  ****************.**** ***  *.*.*  

1074. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to MN234223 (Mycobacterium phage Philly, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

1075. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to KJ194581 (Mycobacterium phage Audrey, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

1076. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to MH051265 (Mycobacterium phage Yahalom, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

1077. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to MH316565 (Mycobacterium phage Mortcellus, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

1078. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to MT310871 (Mycobacterium phage Jackstina, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

1079. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to EU816589 (Mycobacterium phage Phaedrus, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

1080. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to MT952851 (Mycobacterium phage Gervas, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

1081. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to MG920059 (Mycobacterium phage Baloo, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

1082. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NC_023686 (Mycobacterium phage Gadjet, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

1083. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NC_041965 (Mycobacterium phage Athena, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

1084. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to DQ398049 (Mycobacterium phage Pipefish, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

1085. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to MT310892 (Mycobacterium phage Compostia, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

1086. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to JN699018 (Mycobacterium phage Kamiyu, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

1087. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg----gtggcta	CRISPR spacer
cggcggcggcaccggcggcaccggcggtgccgtg----	Protospacer
 * ******** *******.*******    ***    

1088. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta--	CRISPR spacer
ggccggcggcaacgggagcgccggc--ctcgccgcc	Protospacer
*************** .********   * **..  

1089. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcg-gcaacggcggcgccggcgggtggcta	CRISPR spacer
-ccgagcgcgccacggcggctccggcgggtggccc	Protospacer
  * .*** ** ******** ************. 

1090. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to MK814754 (Mycobacterium phage Sumter, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc--	Protospacer
 .*****************. ******  *..**  

1091. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to MK814754 (Mycobacterium phage Sumter, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc--	Protospacer
 .*****************. ******  *..**  

1092. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to MN369739 (Mycobacterium phage Kenuha5, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc--	Protospacer
 .*****************. ******  *..**  

1093. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to MK967397 (Mycobacterium phage Mahavrat, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc--	Protospacer
 .*****************. ******  *..**  

1094. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to MT522000 (Mycobacterium phage Soul22, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc--	Protospacer
  *****************. ******  *..**  

1095. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to KY348865 (Mycobacterium phage Bubbles123, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc--	Protospacer
 .*****************. ******  *..**  

1096. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to MN428047 (Mycobacterium phage Doomphist, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc--	Protospacer
 .*****************. ******  *..**  

1097. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to MF919502 (Mycobacterium phage Demsculpinboyz, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc--	Protospacer
  *****************. ******  *..**  

1098. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to AY129336 (Mycobacteriophage Che9d, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc--	Protospacer
  *****************. ******  *..**  

1099. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to MT771340 (Mycobacterium phage Jorgensen, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc--	Protospacer
 .*****************. ******  *..**  

1100. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to MK359343 (Mycobacterium phage Pollywog, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc--	Protospacer
  *****************. ******  *..**  

1101. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NC_042030 (Mycobacterium phage Yoshi, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
ctccggcggcaacggcggcaacggcggcagcagc--	Protospacer
  *****************. ******  *..**  

1102. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NC_048729 (Mycobacterium phage Renaud18, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
ctccggcggcaacggcggcaacggcggcagcagc--	Protospacer
  *****************. ******  *..**  

1103. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NC_026585 (Mycobacteriophage Estave1, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc--	Protospacer
  *****************. ******  *..**  

1104. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to MK305886 (Mycobacterium phage Poenanya, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc--	Protospacer
 .*****************. ******  *..**  

1105. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to JN859129 (Mycobacterium virus DotProduct, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc--	Protospacer
 .*****************. ******  *..**  

1106. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to MG925354 (Mycobacterium phage Ogopogo, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc--	Protospacer
  *****************. ******  *..**  

1107. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to JN698995 (Mycobacterium phage Dori, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caccggcggcaacggcggccctggcggctcggtg	Protospacer
 .***************** *.***** * * *.

1108. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NC_023698 (Mycobacterium phage Avani, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc--	Protospacer
  *****************. ******  *..**  

1109. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NC_011054 (Mycobacterium phage Boomer, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc--	Protospacer
 .*****************. ******  *..**  

1110. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to MN234184 (Mycobacterium phage IdentityCrisis, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
caccggcggcagcggcggcgcaggcggaaacggc--	Protospacer
 .*********.********* *****  ..***  

1111. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to MH077585 (Mycobacterium phage TChen, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
ctccggcggcaacggcggcaacggcggcagcagc--	Protospacer
  *****************. ******  *..**  

1112. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NC_048788 (Mycobacterium phage ThetaBob, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
ctccggcggcaacggcggcaacggcggcagcagc--	Protospacer
  *****************. ******  *..**  

1113. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg-gtggcta	CRISPR spacer
tctcggcggcgacggcggcgacggcggtgttgat-	Protospacer
  .*******.********* ****** ** * * 

1114. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP015733 (Arthrobacter sp. U41 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
agccggcggcaacggcggccgcggctgccagcca	Protospacer
.******************  **** * ..**.*

1115. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to MN096355 (Mycobacterium phage Purky, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta-	CRISPR spacer
gcgcggcggcaccggcggcaccggc-ggcggtcat	Protospacer
*  ******** *******.***** **.**..* 

1116. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to MN234183 (Mycobacterium phage Antsirabe, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
cgtcggcggcagcggcggcggcggcggacgtcca	Protospacer
 *.********.******** ******..* *.*

1117. spacer 6.9|1217578|37|NC_022350|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 8, identity: 0.784

tgtcggcggtgccggcggcaccggcgggttaggcaac	CRISPR spacer
agtcggcggcggcggcggcaccggcgggaccggcggc	Protospacer
 ********.* **************** . ***..*

1118. spacer 7.10|1573453|31|NC_022350|CRISPRCasFinder matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
gcgggcgccttgtccgccgctgccgccgggc	Protospacer
.   ********.******.*********  

1119. spacer 7.10|1573453|31|NC_022350|CRISPRCasFinder matches to NZ_CP039899 (Agrobacterium tumefaciens strain CFBP5877 plasmid pAtCFBP5877a, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa	Protospacer
... ****  ******************  *

1120. spacer 7.10|1573453|31|NC_022350|CRISPRCasFinder matches to NZ_CP039913 (Agrobacterium tumefaciens strain CFBP6625 plasmid pAtCFBP6625b, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa	Protospacer
... ****  ******************  *

1121. spacer 7.10|1573453|31|NC_022350|CRISPRCasFinder matches to NZ_CP039890 (Agrobacterium tumefaciens strain CFBP5499 plasmid pAtCFBP5499a, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa	Protospacer
... ****  ******************  *

1122. spacer 7.10|1573453|31|NC_022350|CRISPRCasFinder matches to NZ_CP018001 (Rhizobium sp. Y9 plasmid pY9, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa	Protospacer
... ****  ******************  *

1123. spacer 7.10|1573453|31|NC_022350|CRISPRCasFinder matches to NC_022536 (Rhizobium sp. IRBG74 plasmid IRBL74_p, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa	Protospacer
... ****  ******************  *

1124. spacer 7.10|1573453|31|NC_022350|CRISPRCasFinder matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa	Protospacer
... ****  ******************  *

1125. spacer 7.10|1573453|31|NC_022350|CRISPRCasFinder matches to NZ_CP018075 (Streptomyces venezuelae strain NRRL B-65442 plasmid, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
gcgagcgccttgcccgccgtggtcgccgccc	Protospacer
.   **************** *.***** * 

1126. spacer 7.10|1573453|31|NC_022350|CRISPRCasFinder matches to CP036360 (Agrobacterium sp. 33MFTa1.1 plasmid p_JBx_073812, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa	Protospacer
... ****  ******************  *

1127. spacer 7.10|1573453|31|NC_022350|CRISPRCasFinder matches to NZ_CP021914 (Sagittula sp. P11 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

aattgc--gccttgcccgccgttgccgccggca	CRISPR spacer
--ccgctggccttgcccggggttgccgccgggg	Protospacer
  ..**  **********  *********** .

1128. spacer 7.10|1573453|31|NC_022350|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
attgccgccctggccgccgttgccgccgatc	Protospacer
* *  ****.** ***************.. 

1129. spacer 8.3|2087658|30|NC_022350|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.733

tcggagaaagccgtcggtttgcacgctgtt	CRISPR spacer
ccgcgagcagccgtcggtttgcgcgctgtc	Protospacer
.** ... **************.******.

1130. spacer 8.3|2087658|30|NC_022350|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.733

tcggagaaagccgtcggtttgcacgctgtt	CRISPR spacer
ccgcgagcagccgtcggtttgcgcgctgtc	Protospacer
.** ... **************.******.

1131. spacer 12.25|3117982|29|NC_022350|PILER-CR matches to MK599315 (Pseudomonas phage PA1C, complete genome) position: , mismatch: 8, identity: 0.724

tccgcgaaattcactgcgcgttattcaag	CRISPR spacer
gacgcgaaatacactgcgctttattttca	Protospacer
  ******** ******** *****.  .

1132. spacer 13.7|3736150|31|NC_022350|CRT matches to CP033373 (Lactobacillus fermentum strain DR9 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
ttagcccacttcacggccgttgccgacgcgg	Protospacer
   *********** ********** **. .

1133. spacer 13.7|3736150|31|NC_022350|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg	Protospacer
. *******.********** *****  * .

1134. spacer 13.7|3736150|31|NC_022350|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg	Protospacer
. *******.********** *****  * .

1135. spacer 13.7|3736150|31|NC_022350|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg	Protospacer
. *******.********** *****  * .

1136. spacer 13.7|3736150|31|NC_022350|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg	Protospacer
. *******.********** *****  * .

1137. spacer 13.7|3736150|31|NC_022350|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg	Protospacer
. *******.********** *****  * .

1138. spacer 13.7|3736150|31|NC_022350|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg	Protospacer
. *******.********** *****  * .

1139. spacer 13.7|3736150|31|NC_022350|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg	Protospacer
. *******.********** *****  * .

1140. spacer 13.7|3736150|31|NC_022350|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg	Protospacer
. *******.********** *****  * .

1141. spacer 13.7|3736150|31|NC_022350|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg	Protospacer
. *******.********** *****  * .

1142. spacer 13.7|3736150|31|NC_022350|CRT matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
cgcaactccttcaccgccgctgccgccgtct	Protospacer
 .*. *. ***********.********** 

1143. spacer 13.7|3736150|31|NC_022350|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg	Protospacer
. *******.********** *****  * .

1144. spacer 13.7|3736150|31|NC_022350|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg	Protospacer
. *******.********** *****  * .

1145. spacer 13.7|3736150|31|NC_022350|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg	Protospacer
. *******.********** *****  * .

1146. spacer 13.7|3736150|31|NC_022350|CRT matches to NZ_CP027299 (Streptomyces sp. SGAir0924 plasmid unnamed_5) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
ctcggtggcttcgccgccgtcgccgccgtca	Protospacer
  ** . .****.*******.**********

1147. spacer 13.7|3736150|31|NC_022350|CRT matches to NC_014213 (Meiothermus silvanus DSM 9946 plasmid pMESIL01, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
atcgcccacttcaccggcgtttccgaccctt	Protospacer
* ************** **** *** * .. 

1148. spacer 14.9|3929877|39|NC_022350|CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.795

gccggt-ggcgccggcggggccggcgggcagggcggtagc	CRISPR spacer
-ctgatcggcgccggcggggccgccggccagggcgatgcc	Protospacer
 *.*.* **************** *** *******.*. *

1149. spacer 14.12|3930108|30|NC_022350|CRT matches to NZ_CP048385 (Citrobacter freundii strain 62 plasmid p6_C, complete sequence) position: , mismatch: 8, identity: 0.733

gcggtgggcagcgtcggtaacgccgggatc	CRISPR spacer
gcggtgagcagcgtcggtagcgcgccaacg	Protospacer
******.************.***   .*. 

1150. spacer 15.5|3946147|32|NC_022350|CRT matches to NZ_LR134468 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 26, complete sequence) position: , mismatch: 8, identity: 0.75

aaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
gaaggcggccccggcggtgccggcgataccga	Protospacer
.******** ******* ********.. *  

1151. spacer 15.5|3946147|32|NC_022350|CRT matches to NZ_CP053714 (Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed7, complete sequence) position: , mismatch: 8, identity: 0.75

aaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
ggcggcggcgccggcggggccggcggcgggac	Protospacer
.. ******.***************.**.  *

1152. spacer 15.5|3946147|32|NC_022350|CRT matches to NZ_CP054615 (Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

aaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
ggtgacggcaccggcggtgccggcggcgatgc	Protospacer
.. *.************ *******.***. *

1153. spacer 15.5|3946147|32|NC_022350|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.75

aaaggcg-gcaccggcggggccggcgacgactc	CRISPR spacer
-ctgccgcgcaccgggggggacggcgacgacgg	Protospacer
   * ** ******* **** **********  

1154. spacer 15.5|3946147|32|NC_022350|CRT matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

aaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
gtacccggcaccgccgaggccggcgacgagtt	Protospacer
. *  ******** **.************ *.

1155. spacer 15.5|3946147|32|NC_022350|CRT matches to NZ_KY349138 (Mycolicibacterium sp. CBMA 213 plasmid pCBMA213_2, complete sequence) position: , mismatch: 8, identity: 0.75

aaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
atcggcggcgccggtggggccggcgaagcggc	Protospacer
*  ******.****.*********** *   *

1156. spacer 15.5|3946147|32|NC_022350|CRT matches to NZ_CP050098 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b4, complete sequence) position: , mismatch: 8, identity: 0.75

aaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
aaagtcggcaccggcggggacggaacgtcctc	Protospacer
**** ************** *** .    ***

1157. spacer 15.5|3946147|32|NC_022350|CRT matches to NZ_CP033508 (Mesorhizobium jarvisii strain ATCC 700743 plasmid pMJ700743a, complete sequence) position: , mismatch: 8, identity: 0.75

aaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
aaagacggcgccggcggggccgggatcaccac	Protospacer
****.****.************* . *. * *

1158. spacer 15.5|3946147|32|NC_022350|CRT matches to NZ_CP033369 (Mesorhizobium loti strain SU343 plasmid pMLSU343a, complete sequence) position: , mismatch: 8, identity: 0.75

aaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
aaagacggcgccggcggggccgggatcaccac	Protospacer
****.****.************* . *. * *

1159. spacer 15.5|3946147|32|NC_022350|CRT matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 8, identity: 0.75

aaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
gagcgccgcgccggcggggccggcgaccgctt	Protospacer
.*. ** **.***************** .**.

1160. spacer 15.5|3946147|32|NC_022350|CRT matches to NZ_CP053440 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eF, complete sequence) position: , mismatch: 8, identity: 0.75

aaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
aaagtcggcaccggcggggacggaacgtcctc	Protospacer
**** ************** *** .    ***

1161. spacer 15.5|3946147|32|NC_022350|CRT matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 8, identity: 0.75

aaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
gtcgacgacaccggcgaggccggcgacgccgc	Protospacer
.  *.**.********.*********** * *

1162. spacer 15.5|3946147|32|NC_022350|CRT matches to NZ_CP054022 (Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence) position: , mismatch: 8, identity: 0.75

aaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
aaagtcggcaccggcggggacgggacatcctc	Protospacer
**** ************** *** .    ***

1163. spacer 15.5|3946147|32|NC_022350|CRT matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.75

aaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
gagcgccgcaacggcggggccggcgaccgctt	Protospacer
.*. ** *** **************** .**.

1164. spacer 15.5|3946147|32|NC_022350|CRT matches to NZ_CP032053 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL2, complete sequence) position: , mismatch: 8, identity: 0.75

aaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
atcgtcgggaccggcggggcgggcgacggcga	Protospacer
*  * *** *********** *******.*  

1165. spacer 15.5|3946147|32|NC_022350|CRT matches to NZ_CP054032 (Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence) position: , mismatch: 8, identity: 0.75

aaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
aaagtcggcaccggcggggacgggacatcctc	Protospacer
**** ************** *** .    ***

1166. spacer 15.5|3946147|32|NC_022350|CRT matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 8, identity: 0.75

aaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
gagcgccgcaacggcggggccggcgaccgctt	Protospacer
.*. ** *** **************** .**.

1167. spacer 15.5|3946147|32|NC_022350|CRT matches to MN234185 (Mycobacterium phage Lemuria, complete genome) position: , mismatch: 8, identity: 0.75

aaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
gacgtcggcaccggcggcgccggcggcggcaa	Protospacer
.* * ************ *******.**.*  

1168. spacer 3.6|369987|33|NC_022350|CRISPRCasFinder matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 9, identity: 0.727

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
ttgtattcgatcccgatctggccgtcgccggcc	Protospacer
  *.  .******************.*****. 

1169. spacer 3.6|369987|33|NC_022350|CRISPRCasFinder matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc	Protospacer
 ***************** ** ***.  *  * 

1170. spacer 3.6|369987|33|NC_022350|CRISPRCasFinder matches to NZ_CP022565 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence) position: , mismatch: 9, identity: 0.727

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc	Protospacer
 ***************** ** ***.  *  * 

1171. spacer 3.6|369987|33|NC_022350|CRISPRCasFinder matches to NZ_CP048281 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence) position: , mismatch: 9, identity: 0.727

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc	Protospacer
 ***************** ** ***.  *  * 

1172. spacer 4.1|696509|31|NC_022350|CRISPRCasFinder matches to NZ_CP014964 (Geobacter anodireducens strain SD-1 plasmid pSD, complete sequence) position: , mismatch: 9, identity: 0.71

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
ggaacgaacggcaagccgaaatgttggtgga	Protospacer
.* .**************** .*****    

1173. spacer 4.1|696509|31|NC_022350|CRISPRCasFinder matches to NC_015974 (Sphingobium sp. SYK-6 plasmid pSLPG, complete sequence) position: , mismatch: 9, identity: 0.71

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
taagcgaacggtaagccgaaccgctgaggcg	Protospacer
 . ********.***********.**.. * 

1174. spacer 4.1|696509|31|NC_022350|CRISPRCasFinder matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.71

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
taagcgaacggtaagccgaaccgctgaggcg	Protospacer
 . ********.***********.**.. * 

1175. spacer 5.13|930690|30|NC_022350|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.7

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggcgccggcctgctggtcggactgctcac	Protospacer
**.****************** ..   *. 

1176. spacer 5.15|930786|30|NC_022350|CRT matches to NC_005241 (Cupriavidus necator H16 megaplasmid pHG1, complete sequence) position: , mismatch: 9, identity: 0.7

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gaccacgttcggctccggccgcgctcgcgt	Protospacer
  .  .************* ***** *** 

1177. spacer 5.15|930786|30|NC_022350|CRT matches to NZ_CP039289 (Cupriavidus necator H16 plasmid pHG1, complete sequence) position: , mismatch: 9, identity: 0.7

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gaccacgttcggctccggccgcgctcgcgt	Protospacer
  .  .************* ***** *** 

1178. spacer 5.17|930876|36|NC_022350|CRT matches to MF140398 (Mycobacterium phage Amohnition, complete genome) position: , mismatch: 9, identity: 0.75

gctgatcggcaacggcggtaacggcggggccggcgg	CRISPR spacer
gcagatcggcaccggcggtaacggcggcggtacggc	Protospacer
** ******** *************** * ..  * 

1179. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
caacggcggcaacggcggcaacggcggcaacggc--	Protospacer
 . ****************. ******  ..***  

1180. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcg--ggtggcta	CRISPR spacer
cagcggcggcaacggcggccgcggcggcgacggc--	Protospacer
 . ****************  *****  *..***  

1181. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
cgccggcggcaactgcggcgccggcgcccaccgc	Protospacer
 ************ ************  .. *  

1182. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcg--ggtggcta	CRISPR spacer
cagcggcagcaatggcggcgccggcggcgccggc--	Protospacer
 . ****.****.*************  * .***  

1183. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
cggcggcgggaccggcggcgccggcggcagtatc	Protospacer
 * ****** * ***************  *  * 

1184. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to EF602154 (Burkholderia phage BcepNY3, complete genome) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ggccggcggcaacggcggtgccggtgcgccagcc	Protospacer
******************.*****.* *. . . 

1185. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to AY369265 (Burkholderia cenocepacia phage Bcep1, complete genome) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ggccggcggcaacggcggtgccggtgcgccagcc	Protospacer
******************.*****.* *. . . 

1186. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NC_005263 (Burkholderia phage Bcep1, complete genome) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ggccggcggcaacggcggtgccggtgcgccagcc	Protospacer
******************.*****.* *. . . 

1187. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
agccggcggcataggcggcgccggcggcattttc	Protospacer
.**********  **************    .* 

1188. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
agccggcggcataggcggcgccggcggcattttc	Protospacer
.**********  **************    .* 

1189. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
cgtcggcggccacggcggcgtcggcggtcaggaa	Protospacer
 *.******* *********.****** ..*  *

1190. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP053906 (Hymenobacter sp. BRD67 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caccggcggcaccggcggcggcggcgggggcacc	Protospacer
 .********* ******** ******* *  . 

1191. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to KC170279 (Uncultured bacterium plasmid pMBUI8, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggcgccggcgtctaccag	Protospacer
  ********** *************  *. * .

1192. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

1193. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP015867 (Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gaccggcggcaccggcggcgccgccggccatcat	Protospacer
*.********* *********** *** .. *  

1194. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

1195. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

1196. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

1197. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

1198. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
cggcggcggcaatggcggcaccggcggcacggtc	Protospacer
 * *********.******.*******   * * 

1199. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

1200. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

1201. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ctccggcggcaacggcggcggcagcggtggtgga	Protospacer
  ****************** *.****  *   *

1202. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

1203. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

1204. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

1205. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

1206. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

1207. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

1208. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

1209. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

1210. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

1211. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

1212. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

1213. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

1214. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

1215. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

1216. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to MH001451 (Mycobacterium phage Nairb, complete genome) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc	Protospacer
 .*****************. ****** *. *. 

1217. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to MF155936 (Mycobacterium phage ZenTime222, complete genome) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc	Protospacer
 .*****************. ****** *. *. 

1218. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to MH588544 (Caulobacter phage CcrBL10, complete genome) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gaccggcggcaacggcggcggcggtggctcctcg	Protospacer
*.****************** ***.** *  ...

1219. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to MK494089 (Mycobacterium phage Ibrahim, complete genome) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc	Protospacer
 .*****************. ****** *. *. 

1220. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NC_024135 (Mycobacterium phage Bernal13, complete genome) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc	Protospacer
 .*****************. ****** *. *. 

1221. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to KM591905 (Mycobacterium phage RonRayGun, complete genome) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc	Protospacer
 .*****************. ****** *. *. 

1222. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to MN735432 (Mycobacteriophage Whitty, complete genome) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc	Protospacer
 .*****************. ****** *. *. 

1223. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_KX443399 (Rhodococcus hoagii strain PAM1354 plasmid pVAPA1354, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta-----	CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga	Protospacer
*************** ** *****     .**.*     

1224. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_KX443400 (Rhodococcus hoagii strain PAM1557 plasmid pVAPN1557, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta-----	CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga	Protospacer
*************** ** *****     .**.*     

1225. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_KX443398 (Rhodococcus hoagii strain PAM1204 plasmid pVAPN1204, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta-----	CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga	Protospacer
*************** ** *****     .**.*     

1226. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to CP054922 (Streptomyces sp. NA03103 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
tgccggcggccccggcggcgccggccagctgcac	Protospacer
 *********  ************* .*. **  

1227. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_KP851975 (Rhodococcus hoagii strain PAM2012 plasmid pVAPN2012, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta-----	CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga	Protospacer
*************** ** *****     .**.*     

1228. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NC_015314 (Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcg--ggtggcta	CRISPR spacer
ctgcggcggcgacggcggcaccggcggaggcagc--	Protospacer
   *******.********.******  **..**  

1229. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gttcggcggcgagggcggcgccggcggcaagcgt	Protospacer
* .*******.* **************  .**  

1230. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_KF439868 (Rhodococcus hoagii strain PAM1571 plasmid pVAPN1571, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta-----	CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga	Protospacer
*************** ** *****     .**.*     

1231. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_LR134452 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
cgacggcggcaacggcggccgcggcggctccgtg	Protospacer
 * ****************  ****** *   *.

1232. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP021025 (Rhizobium sp. TAL182 plasmid pRetTAL182a, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc	Protospacer
.**********  ************.*    ** 

1233. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gcgcggcggcgccggcggcgccggcggcgaggga	Protospacer
*  *******. ***************  .*  *

1234. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat	Protospacer
********.* *************.* *.  *  

1235. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP013600 (Rhizobium sp. N741 plasmid pRspN741e, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc	Protospacer
.**********  ************.*    ** 

1236. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NC_019789 (Deinococcus peraridilitoris DSM 19664 plasmid pDEIPE01, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcg--ggtggcta	CRISPR spacer
caccggcggcaacggcggcaccgccgacaacggc--	Protospacer
 .*****************.*** **  ...***  

1237. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP013504 (Rhizobium esperanzae strain N561 plasmid pRspN561d, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc	Protospacer
.**********  ************.*    ** 

1238. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP013510 (Rhizobium sp. N1341 plasmid pRspN1341e, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc	Protospacer
.**********  ************.*    ** 

1239. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP013521 (Rhizobium sp. N113 plasmid pRspN113d, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc	Protospacer
.**********  ************.*    ** 

1240. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP013494 (Rhizobium sp. N6212 plasmid pRspN6212d, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc	Protospacer
.**********  ************.*    ** 

1241. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP013512 (Rhizobium sp. N1314 plasmid pRspN1314a, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc	Protospacer
.**********  ************.*    ** 

1242. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP013594 (Rhizobium sp. N871 plasmid pRspN871d, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc	Protospacer
.**********  ************.*    ** 

1243. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat	Protospacer
********.* *************.* *.  *  

1244. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to KC736071 (Mycobacterium phage WIVsmall, complete genome) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcg--ggtggcta	CRISPR spacer
caacggcggcaacggcggcaacggcggcggcagc--	Protospacer
 . ****************. *****  **..**  

1245. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat	Protospacer
********.* *************.* *.  *  

1246. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_LR134446 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 4, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gagcggcggcaacggcggcaacggcggcttcccc	Protospacer
*. ****************. ****** *  *. 

1247. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP041653 (Streptomyces sp. RLB1-9 plasmid pRLB1-9.1, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
cgacggccgcaacggcggctccggcggcgggaac	Protospacer
 * **** *********** *******  **   

1248. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat	Protospacer
********.* *************.* *.  *  

1249. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat	Protospacer
********.* *************.* *.  *  

1250. spacer 6.9|1217578|37|NC_022350|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 9, identity: 0.757

tgtcggcggtgccggcggcaccggcgggttaggcaac	CRISPR spacer
ggtgggcggtgccggcggcagcggcggcatggccttc	Protospacer
 ** **************** ******  *.* *  *

1251. spacer 7.10|1573453|31|NC_022350|CRISPRCasFinder matches to NZ_CP039697 (Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence) position: , mismatch: 9, identity: 0.71

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggcctcgccctgcccgccgttgccgcccacg	Protospacer
.... ****.***************** .*.

1252. spacer 7.10|1573453|31|NC_022350|CRISPRCasFinder matches to NZ_CP049244 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.71

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
tggcccgccttgccctccattgccgccggac	Protospacer
 . . ********** **.**********  

1253. spacer 7.10|1573453|31|NC_022350|CRISPRCasFinder matches to NC_022049 (Paracoccus aminophilus JCM 7686 plasmid pAMI4, complete sequence) position: , mismatch: 9, identity: 0.71

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
atccttgccttgaccgccgttgccgccgctg	Protospacer
* .. .****** *************** ..

1254. spacer 7.10|1573453|31|NC_022350|CRISPRCasFinder matches to MN234199 (Mycobacterium phage Ekdilam, complete genome) position: , mismatch: 9, identity: 0.71

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
accccagccctgcccgccgttgccgccgctc	Protospacer
* ..  ***.****************** . 

1255. spacer 7.10|1573453|31|NC_022350|CRISPRCasFinder matches to NZ_CP023000 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence) position: , mismatch: 9, identity: 0.71

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
gcttgcgcctggcccgccgtagccggacacc	Protospacer
. ******** ********* ****   .* 

1256. spacer 7.10|1573453|31|NC_022350|CRISPRCasFinder matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 9, identity: 0.71

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
accggcaccttgcccgccattgccgccatgt	Protospacer
* . **.***********.********.   

1257. spacer 7.10|1573453|31|NC_022350|CRISPRCasFinder matches to NZ_CP013740 (Streptomyces globisporus C-1027 plasmid pSGL1, complete sequence) position: , mismatch: 9, identity: 0.71

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
cgggccgccttgtccgccgtggccgccgacc	Protospacer
 .   *******.******* *******.* 

1258. spacer 7.10|1573453|31|NC_022350|CRISPRCasFinder matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 9, identity: 0.71

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
agcgtggccttggccgccgttgccggcggtc	Protospacer
*..   ****** ************ ***. 

1259. spacer 13.5|3736009|34|NC_022350|CRT matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.735

gttttctcccgcgacggtgggggtggcgccggca	CRISPR spacer
attgagatccgcgacgatgggtgtggcgccggcg	Protospacer
.**    .********.**** ***********.

1260. spacer 13.5|3736009|34|NC_022350|CRT matches to MG812496 (Gordonia phage SallySpecial, complete genome) position: , mismatch: 9, identity: 0.735

gttttctcccgcgacggtgggggtggcgccggca	CRISPR spacer
gcgcaccaccgcggcggtgcgggtggcgccggcg	Protospacer
*. . *. *****.***** *************.

1261. spacer 13.9|3736282|37|NC_022350|CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.757

cttgccggcggtgccggcgaccgcggtgccgccggcg	CRISPR spacer
ggagacggcggtgccggagaccgcggtgtcgctgccc	Protospacer
   * ************ **********.***.* * 

1262. spacer 14.9|3929877|39|NC_022350|CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 9, identity: 0.769

gccggt-ggcgccggcggggccggcgggcagggcggtagc	CRISPR spacer
-ctgatcggcgccggcggggccgccggccagggcgacgcc	Protospacer
 *.*.* **************** *** *******... *

1263. spacer 14.9|3929877|39|NC_022350|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 9, identity: 0.769

gccggt-ggcgccggcggggccggcgggcagggcggtagc	CRISPR spacer
-ctgatcggcgccggcggggccgccggccagggcgacgcc	Protospacer
 *.*.* **************** *** *******... *

1264. spacer 14.9|3929877|39|NC_022350|CRT matches to NZ_CP034351 (Streptomyces sp. W1SF4 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.769

gccggtggcgccggcggggccggcgggcagggcggtagc	CRISPR spacer
ggcccgggcgacggcggggccgtcgggcagggcgctccc	Protospacer
* *   **** *********** *********** *  *

1265. spacer 14.12|3930108|30|NC_022350|CRT matches to NC_012725 (Burkholderia glumae BGR1 plasmid bglu_4p, complete sequence) position: , mismatch: 9, identity: 0.7

gcggtgggcagcgtcggtaacgccgggatc	CRISPR spacer
gatttgggcagagtcggtaacgccgaatgg	Protospacer
*   ******* *************..   

1266. spacer 15.3|3945994|35|NC_022350|CRT matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 9, identity: 0.743

agcggcggggccggcggtagcggcggggccaactt	CRISPR spacer
gccggcggggccggcgggaccggcggggccggggg	Protospacer
. *************** * **********..   

1267. spacer 15.3|3945994|35|NC_022350|CRT matches to NZ_CP046906 (Streptomyces sp. QHH-9511 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.743

agcggcggggccggcggtagcggcggggccaactt	CRISPR spacer
agcggcggggacggcggcagcggcgtgcagcgctg	Protospacer
********** ******.******* *    .** 

1268. spacer 15.3|3945994|35|NC_022350|CRT matches to NC_028791 (Mycobacterium phage MOOREtheMARYer, complete genome) position: , mismatch: 9, identity: 0.743

agcggcggggccggcggtagcggcggggccaactt	CRISPR spacer
ggcggcggcgccggcggtaacggcggcgtgggcat	Protospacer
.******* **********.****** *. ..* *

1269. spacer 15.5|3946147|32|NC_022350|CRT matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719

aaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
ggccgcggcaccggcggggccgccgccgatca	Protospacer
..  ****************** ** ***.. 

1270. spacer 15.5|3946147|32|NC_022350|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

aaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
caaggcggcaccggcggtgacggcggaaccgg	Protospacer
 **************** * *****. . *  

1271. spacer 15.5|3946147|32|NC_022350|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 9, identity: 0.719

aaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
caaggcggcaccggcggtgacggcggaaccgg	Protospacer
 **************** * *****. . *  

1272. spacer 15.5|3946147|32|NC_022350|CRT matches to NZ_LR594668 (Variovorax sp. SRS16 plasmid 3) position: , mismatch: 9, identity: 0.719

aaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
acgcgcggcaccggctggtccggcgacgcgcg	Protospacer
* . *********** ** *********  . 

1273. spacer 15.5|3946147|32|NC_022350|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

aaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
caaggcggcaccggcggtgacggcggaaccgg	Protospacer
 **************** * *****. . *  

1274. spacer 15.5|3946147|32|NC_022350|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

aaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
caaggcggcaccggcggtgacggcggaaccgg	Protospacer
 **************** * *****. . *  

1275. spacer 15.5|3946147|32|NC_022350|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 9, identity: 0.719

aaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
caaggcggcaccggcggtgacggcggaaccgg	Protospacer
 **************** * *****. . *  

1276. spacer 15.5|3946147|32|NC_022350|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

aaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
gaaggcggcaccggcggtgacggcggaaccgg	Protospacer
.**************** * *****. . *  

1277. spacer 15.5|3946147|32|NC_022350|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

aaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
gaaggcggcaccggcggtgacggcggaaccgg	Protospacer
.**************** * *****. . *  

1278. spacer 15.5|3946147|32|NC_022350|CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 9, identity: 0.719

aaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
gcaggcggcgccggcgaggccggcgaggggca	Protospacer
. *******.******.********* *. . 

1279. spacer 15.5|3946147|32|NC_022350|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

aaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
caaggcggcaccggcggtgacggcggaaccgg	Protospacer
 **************** * *****. . *  

1280. spacer 15.5|3946147|32|NC_022350|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

aaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
caaggcggcaccggcggtgacggcggaaccgg	Protospacer
 **************** * *****. . *  

1281. spacer 15.5|3946147|32|NC_022350|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

aaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
caaggcggcaccggcggtgacggcggaaccgg	Protospacer
 **************** * *****. . *  

1282. spacer 15.5|3946147|32|NC_022350|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

aaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
caaggcggcaccggcggtgacggcggaaccgg	Protospacer
 **************** * *****. . *  

1283. spacer 15.5|3946147|32|NC_022350|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

aaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
caaggcggcaccggcggtgacggcggaaccgg	Protospacer
 **************** * *****. . *  

1284. spacer 15.5|3946147|32|NC_022350|CRT matches to NZ_AP022611 (Mycolicibacterium madagascariense strain JCM 13574 plasmid pJCM13574) position: , mismatch: 9, identity: 0.719

aaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
atgaccggcaccggcagggctggcgacgagca	Protospacer
* .. **********.****.******** . 

1285. spacer 15.5|3946147|32|NC_022350|CRT matches to NZ_AP022611 (Mycolicibacterium madagascariense strain JCM 13574 plasmid pJCM13574) position: , mismatch: 9, identity: 0.719

aaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
atgaccggcaccggcagggctggcgacgagca	Protospacer
* .. **********.****.******** . 

1286. spacer 15.5|3946147|32|NC_022350|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

aaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
caaggcggcaccggcggtgacggcggaaccgg	Protospacer
 **************** * *****. . *  

1287. spacer 15.5|3946147|32|NC_022350|CRT matches to NZ_LR134465 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence) position: , mismatch: 9, identity: 0.719

aaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
ggggaccgccccggcgggaccggcgacgacga	Protospacer
...*.* ** ********.***********  

1288. spacer 15.5|3946147|32|NC_022350|CRT matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

aaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
cacgtcggccccgtcggggccggcgacgcgga	Protospacer
 * * **** *** **************    

1289. spacer 15.5|3946147|32|NC_022350|CRT matches to NZ_CP023524 (Burkholderia gladioli pv. gladioli strain FDAARGOS_389 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

aaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
atcggcggcaccagcggtgccggcgaggcgcg	Protospacer
*  *********.**** ******** *  . 

1290. spacer 15.5|3946147|32|NC_022350|CRT matches to NZ_CP040761 (Paracoccus sp. 2251 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.719

aaaggcggcaccggcggggccggcgac---gactc	CRISPR spacer
gcgcgcggcaccggcgaggccgtcgacctgga---	Protospacer
. . ************.***** ****   **   

1291. spacer 15.5|3946147|32|NC_022350|CRT matches to NZ_CP030763 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719

aaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
gctgcgggcaccggcgcggccggcgccgaatt	Protospacer
.  *  ********** ******** *** *.

1292. spacer 15.5|3946147|32|NC_022350|CRT matches to NZ_CP017564 (Paraburkholderia sprentiae WSM5005 plasmid pl3WSM5005, complete sequence) position: , mismatch: 9, identity: 0.719

aaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
ggcggcggaaccggcgcggccggcgaagccgg	Protospacer
.. ***** ******* ********* * *  

1293. spacer 15.5|3946147|32|NC_022350|CRT matches to NZ_CP033429 (Burkholderia gladioli strain Burkholderia gladioli Co14 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719

aaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
atcggcggcaccagcggtgccggcgaggcgcg	Protospacer
*  *********.**** ******** *  . 

1294. spacer 15.5|3946147|32|NC_022350|CRT matches to NZ_CP023068 (Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence) position: , mismatch: 9, identity: 0.719

aaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
accggcggcaccggcggtggcggcgaggcact	Protospacer
*  ************** * ****** *  ..

1295. spacer 15.5|3946147|32|NC_022350|CRT matches to NZ_CP050088 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence) position: , mismatch: 9, identity: 0.719

aaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
gttgcgggcaccggcgcggccggcgccgaatt	Protospacer
.  *  ********** ******** *** *.

1296. spacer 15.5|3946147|32|NC_022350|CRT matches to MN234219 (Mycobacterium phage Mercurio, complete genome) position: , mismatch: 9, identity: 0.719

aaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
gacgtcggcaccggcggcgccggcggcgcgaa	Protospacer
.* * ************ *******.**    

1297. spacer 15.10|3946600|35|NC_022350|CRT matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 9, identity: 0.743

agcggcggggccggcggtagcggcggggccaactt	CRISPR spacer
gccggcggggccggcgggaccggcggggccggggg	Protospacer
. *************** * **********..   

1298. spacer 15.10|3946600|35|NC_022350|CRT matches to NZ_CP046906 (Streptomyces sp. QHH-9511 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.743

agcggcggggccggcggtagcggcggggccaactt	CRISPR spacer
agcggcggggacggcggcagcggcgtgcagcgctg	Protospacer
********** ******.******* *    .** 

1299. spacer 15.10|3946600|35|NC_022350|CRT matches to NC_028791 (Mycobacterium phage MOOREtheMARYer, complete genome) position: , mismatch: 9, identity: 0.743

agcggcggggccggcggtagcggcggggccaactt	CRISPR spacer
ggcggcggcgccggcggtaacggcggcgtgggcat	Protospacer
.******* **********.****** *. ..* *

1300. spacer 2.11|341549|36|NC_022350|CRT matches to AP021851 (Deinococcus grandis ATCC 43672 plasmid: pDEGR-2 DNA, complete genome) position: , mismatch: 10, identity: 0.722

accccgccgtcggcgaacagcccgccgtttccgccg	CRISPR spacer
tccccgccgtcggcgagcagcccggcgagctgcgcg	Protospacer
 ***************.******* **  ..   **

1301. spacer 2.11|341549|36|NC_022350|CRT matches to NC_020159 (Halovirus HSTV-2, complete genome) position: , mismatch: 10, identity: 0.722

accccgccgtcggcgaacagcccgccgtttccgccg	CRISPR spacer
ttcccgccgtccgcgaacagcccgcggtcactcgct	Protospacer
 .********* ************* **. *.  * 

1302. spacer 2.13|341690|33|NC_022350|CRT matches to NZ_KM017071 (Sphingomonas sp. JE1 plasmid pJE1, complete sequence) position: , mismatch: 10, identity: 0.697

gcgccgccggtccccgtgctggccctcccgccg	CRISPR spacer
gtcaatccggtccccgtgctggcgatcccgaat	Protospacer
*.    *****************  *****   

1303. spacer 3.6|369987|33|NC_022350|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.697

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
ttgtactcgatgccgatctggccgtcgccggcc	Protospacer
  *.  .**** *************.*****. 

1304. spacer 3.6|369987|33|NC_022350|CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.697

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
ttgtactcgatgccgatctggccgtcgccggcc	Protospacer
  *.  .**** *************.*****. 

1305. spacer 3.6|369987|33|NC_022350|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 10, identity: 0.697

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
ttgtattcgatgccgatctggccgtcgccggcc	Protospacer
  *.  .**** *************.*****. 

1306. spacer 5.2|930186|39|NC_022350|CRT matches to NZ_CP044080 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.744

cggcgcgggcggggccgtcacgggaaccggcgccaccgg	CRISPR spacer
cacgggggccggggccgccacgggaaccggcgccccgcc	Protospacer
*.  * ** ********.**************** *   

1307. spacer 5.5|930339|36|NC_022350|CRT matches to KX683875 (Mycobacterium phage Baehexic, complete genome) position: , mismatch: 10, identity: 0.722

aggggccggtgggctgttcaacggcggcggggccgg	CRISPR spacer
ccttgccggtgggctgttcagcggcgggggtggcct	Protospacer
    ****************.****** ** * *  

1308. spacer 5.5|930339|36|NC_022350|CRT matches to KM197169 (Mycobacterium phage Piro94, complete genome) position: , mismatch: 10, identity: 0.722

aggggccggtgggctgttcaacggcggcggggccgg	CRISPR spacer
ccttgccggtgggctgttcagcggcgggggtggcct	Protospacer
    ****************.****** ** * *  

1309. spacer 5.5|930339|36|NC_022350|CRT matches to MF668269 (Mycobacterium phage Drake55, complete genome) position: , mismatch: 10, identity: 0.722

aggggccggtgggctgttcaacggcggcggggccgg	CRISPR spacer
ccttgccggtgggctgttcagcggcgggggtggcct	Protospacer
    ****************.****** ** * *  

1310. spacer 5.5|930339|36|NC_022350|CRT matches to MK284522 (Mycobacterium phage Malec, complete genome) position: , mismatch: 10, identity: 0.722

aggggccggtgggctgttcaacggcggcggggccgg	CRISPR spacer
ccttgccggtgggctgttcagcggcgggggtggcct	Protospacer
    ****************.****** ** * *  

1311. spacer 5.5|930339|36|NC_022350|CRT matches to KM677210 (Mycobacterium phage Larenn, complete genome) position: , mismatch: 10, identity: 0.722

aggggccggtgggctgttcaacggcggcggggccgg	CRISPR spacer
ccttgccggtgggctgttcagcggcgggggtggcct	Protospacer
    ****************.****** ** * *  

1312. spacer 5.17|930876|36|NC_022350|CRT matches to MN369764 (Mycobacterium phage Rahalelujah, complete genome) position: , mismatch: 10, identity: 0.722

gctgatcggcaacggcggtaacggcggggccggcgg	CRISPR spacer
atctggaggcaacggcggtaacggcggggccagcac	Protospacer
... .  ************************.**. 

1313. spacer 5.17|930876|36|NC_022350|CRT matches to NZ_CP025548 (Mycobacterium paragordonae strain 49061 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.722

gctgatcggcaacggcggtaacggcggggccggcgg	CRISPR spacer
gaccggcggcaacggcggaaacggcggcgccgcagc	Protospacer
* . . ************ ******** ****  * 

1314. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcg-----ggtggcta	CRISPR spacer
ccgcggcggcgacggcggcgcgggcggcaccggt-----	Protospacer
   *******.********** ****     ***     

1315. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gagcggcggcaacggcggtaccggcggtgacgtc	Protospacer
*. ***************..*******  .  * 

1316. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP034352 (Streptomyces sp. W1SF4 plasmid p2, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
acccggcggcaccggcggcgcgggcggtccggcc	Protospacer
. ********* ********* ***** . * . 

1317. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to CP000620 (Burkholderia vietnamiensis G4 plasmid pBVIE04, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
tgccggcggcatcggcgccgccggcgcggcatcg	Protospacer
 ********** ***** ******** *  ....

1318. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP020810 (Mycobacterium dioxanotrophicus strain PH-06 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ctccggcggcaccggaggcgccggcggaggcacc	Protospacer
  ********* *** ***********. *  . 

1319. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NC_016588 (Azospirillum lipoferum 4B plasmid AZO_p6, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
atccggcggcgccggcggcgccggcggcggaact	Protospacer
. ********. ***************  *. . 

1320. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to MK524490 (Mycobacterium phage Donny, complete genome) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ctccggcggcaacggcggcaacggcggctccacg	Protospacer
  *****************. ****** *   ..

1321. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to MK494095 (Mycobacterium phage Daegal, complete genome) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caccggcggcaccggcggcaccggcggcaccgga	Protospacer
 .********* *******.*******      *

1322. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to JN699007 (Mycobacterium phage Acadian, complete genome) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ctccggcggcaacggcggcaacggcggctccacg	Protospacer
  *****************. ****** *   ..

1323. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to MT889381 (Mycobacterium phage Suigeneris, complete genome) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ctccggcggcaacggcggcaacggcggctccacg	Protospacer
  *****************. ****** *   ..

1324. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP015373 (Pandoraea pnomenusa strain MCB032 plasmid unnamed 2, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1325. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to AP018709 (Uncultured bacterium plasmid pSN1104-59 DNA, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1326. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP013744 (Streptomyces sp. CdTB01 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta-------	CRISPR spacer
ggccgacggcaagggcggcgcc-------ggttacgcctcc	Protospacer
*****.****** *********       **.**       

1327. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcatcggcggcgcgggcgaggcccag	Protospacer
  ********* ********* ****.*   * .

1328. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NC_008766 (Acidovorax sp. JS42 plasmid pAOVO02, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1329. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
tgacggcggcaacagcggcaccggcggagcgaag	Protospacer
 * **********.*****.*******.  *  .

1330. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP019238 (Rhodoferax koreense strain DCY-110 plasmid unnamed2) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1331. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP019238 (Rhodoferax koreense strain DCY-110 plasmid unnamed2) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1332. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcatcggcggcgcgggcgaggcccag	Protospacer
  ********* ********* ****.*   * .

1333. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NC_021077 (Comamonas sp. 7D-2 plasmid pBHB, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1334. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NC_024998 (Acidovorax avenae subsp. avenae plasmid pAAA83 DNA, complete sequence, strain: 83) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1335. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NC_008385 (Burkholderia ambifaria AMMD plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1336. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP018471 (Xanthomonas vesicatoria strain LM159 plasmid pLM159.2, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1337. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_KJ588780 (Achromobacter xylosoxidans strain A22732 plasmid pA22732-IMP, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1338. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_MN366359 (Bacterium plasmid pALTS31, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1339. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP027024 (Streptomyces sp. WAC00288 plasmid p2, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caccggcaacaacggcggcgccggcgccttcttc	Protospacer
 .*****..*****************  *  .* 

1340. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NC_001735 (Enterobacter aerogenes plasmid R751, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1341. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to AGRM01000006 (Salmonella enterica subsp. houtenae str. ATCC BAA-1581 plasmid pSEHO0A1, complete sequence, whole genome shotgun sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1342. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to AJ863570 (Uncultured bacterium IncP-1beta multiresistance plasmid pB8) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1343. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP034651 (Xanthomonas vasicola strain NCPPB 1060 plasmid pXVH45, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1344. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gcgtctgggccacggcggcgctggcgggtgggtg	Protospacer
*  .   *** **********.********* *.

1345. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gcgtctgggccacggcggcgctggcgggtgggtg	Protospacer
*  .   *** **********.********* *.

1346. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NC_021492 (Enterobacter sp. R4-368 plasmid pENT01, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1347. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to JX469828 (Uncultured bacterium plasmid pRSB223, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
tcccggcggcaagggcggtgccggcgtctatcag	Protospacer
  ********** *****.*******  *. * .

1348. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to JX469829 (Uncultured bacterium plasmid pB1, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
tcccggcggcaagggcggtgccggcgtctatcag	Protospacer
  ********** *****.*******  *. * .

1349. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to JX469831 (Uncultured bacterium plasmid pKSP212, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1350. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to JN106172 (Uncultured bacterium plasmid pAKD29, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1351. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to JN106173 (Uncultured bacterium plasmid pAKD31, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1352. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to JN106174 (Uncultured bacterium plasmid pAKD33, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1353. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to JN106164 (Uncultured bacterium plasmid pAKD1, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1354. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to JN106165 (Uncultured bacterium plasmid pAKD14, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1355. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to JN106166 (Uncultured bacterium plasmid pAKD15, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1356. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to JN106168 (Uncultured bacterium plasmid pAKD17, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1357. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to JN106169 (Uncultured bacterium plasmid pAKD18, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1358. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to MN386974 (Pseudomonas aeruginosa strain 1943 plasmid pPaeBURNS1, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1359. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NC_001381 (Mycobacterium fortuitum plasmid pAL5000, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gcgcggcggcagcggcggcgctggcggcggcacg	Protospacer
*  ********.*********.*****  *  ..

1360. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to MG879028 (Uncultured bacterium plasmid pEG1-1, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1361. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP021650 (Acidovorax sp. T1 plasmid p2-T1, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1362. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to JX486125 (Uncultured bacterium plasmid pRWC72a, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1363. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP038640 (Cupriavidus oxalaticus strain X32 plasmid unnamed5, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1364. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to AJ639924 (Uncultured bacterium plasmid pB3 complete genome) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1365. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to KU356987 (Variovorax paradoxus plasmid pBS64, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1366. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to KU356988 (Variovorax paradoxus plasmid pHB44, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1367. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to CP042595 (Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcgacggcggcgacggcgccccgcgc	Protospacer
  ********.********* *****  . **  

1368. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP009797 (Burkholderia ambifaria AMMD plasmid pBII_1, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1369. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NC_013176 (Pseudomonas putida plasmid pW2, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1370. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NC_019320 (Variovorax sp. DB1 plasmid pDB1, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1371. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP017455 (Dickeya solani strain PPO 9019 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1372. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NC_007337 (Cupriavidus pinatubonensis JMP134 plasmid 1, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1373. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_MN366358 (Bacterium plasmid pALTS29, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1374. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to MN234219 (Mycobacterium phage Mercurio, complete genome) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
cgacgtcggcaccggcggcgccggcggcgcgaag	Protospacer
 * ** ***** ***************   *  .

1375. spacer 6.9|1217578|37|NC_022350|CRISPRCasFinder matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 10, identity: 0.73

tgtcggcggtgccggcggcaccggcgggttaggcaac	CRISPR spacer
cctcgacggtgccggcggcatcggcgggcgctggacc	Protospacer
. ***.**************.*******.   * * *

1376. spacer 6.9|1217578|37|NC_022350|CRISPRCasFinder matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 10, identity: 0.73

tgtcggcggtgccggcggcaccggcgggttaggcaac	CRISPR spacer
cctcgacggtgccggcggcatcggcgggcgctggacc	Protospacer
. ***.**************.*******.   * * *

1377. spacer 7.10|1573453|31|NC_022350|CRISPRCasFinder matches to NC_017273 (Thermus thermophilus SG0.5JP17-16 plasmid pTHTHE1601, complete sequence) position: , mismatch: 10, identity: 0.677

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
gggctcgcctcgcccgccgttcccgccgctc	Protospacer
.. . *****.********** ****** . 

1378. spacer 7.10|1573453|31|NC_022350|CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.677

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ttcctcgccttccccgccgctgccgccgcgg	Protospacer
  .. ****** *******.********  .

1379. spacer 7.10|1573453|31|NC_022350|CRISPRCasFinder matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 10, identity: 0.677

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggccagaacttccccgctgttgccgccggca	Protospacer
..... . *** *****.*************

1380. spacer 7.10|1573453|31|NC_022350|CRISPRCasFinder matches to NC_017590 (Thermus thermophilus JL-18 plasmid pTTJL1802, complete sequence) position: , mismatch: 10, identity: 0.677

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
gggctcgcctcgcccgccgttcccgccgctc	Protospacer
.. . *****.********** ****** . 

1381. spacer 7.10|1573453|31|NC_022350|CRISPRCasFinder matches to NZ_AP014581 (Burkholderia sp. RPE67 plasmid p3, complete sequence) position: , mismatch: 10, identity: 0.677

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggcgtggccttggccgccgttgccggcggtc	Protospacer
...   ****** ************ ***. 

1382. spacer 7.13|1573702|34|NC_022350|CRISPRCasFinder matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 10, identity: 0.706

gtcgccgtgcagccagccaccaccgccaccggcg	CRISPR spacer
ccgatgatgcagccggccaccaccgccaccagca	Protospacer
 . .. .*******.***************.**.

1383. spacer 10.8|3113802|35|NC_022350|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 10, identity: 0.714

acttgcgcgcacaacgcatccgccatccacggggc	CRISPR spacer
gtcaccgcgcacaacacattcgccatccacacggt	Protospacer
...  **********.***.**********. **.

1384. spacer 12.21|3118782|34|NC_022350|CRISPRCasFinder,CRT matches to NZ_AP022335 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49c, complete sequence) position: , mismatch: 10, identity: 0.706

tagaaggcgatcactggaagcacggcgcttgcga	CRISPR spacer
ggcaaggcgatcagtggaagctcggcggcggcac	Protospacer
 . ********** ******* ***** . **. 

1385. spacer 12.36|3118786|34|NC_022350|PILER-CR matches to NZ_AP022335 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49c, complete sequence) position: , mismatch: 10, identity: 0.706

tagaaggcgatcactggaagcacggcgcttgcga	CRISPR spacer
ggcaaggcgatcagtggaagctcggcggcggcac	Protospacer
 . ********** ******* ***** . **. 

1386. spacer 13.5|3736009|34|NC_022350|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 10, identity: 0.706

gttttctcccgcgacggtgggggtggcgccggca	CRISPR spacer
cagcgcggccgcgtcggtgggggtggcgcccgcc	Protospacer
   . *  ***** **************** ** 

1387. spacer 13.5|3736009|34|NC_022350|CRT matches to NZ_CP024986 (Streptomyces lavendulae subsp. lavendulae strain CCM 3239 plasmid pSA3239, complete sequence) position: , mismatch: 10, identity: 0.706

gttttctcccgcgacggtgggggtggcgccggca	CRISPR spacer
gagaccgcccgcgatggagggggtggcgccgagc	Protospacer
*   .* *******.** *************.  

1388. spacer 13.5|3736009|34|NC_022350|CRT matches to NC_024970 (Streptomyces aureofaciens strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 10, identity: 0.706

gttttctcccgcgacggtgggggtggcgccggca	CRISPR spacer
gagaccgcccgcgatggagggggtggcgccgagc	Protospacer
*   .* *******.** *************.  

1389. spacer 13.5|3736009|34|NC_022350|CRT matches to NZ_KJ396772 (Streptomyces lavendulae subsp. lavendulae strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 10, identity: 0.706

gttttctcccgcgacggtgggggtggcgccggca	CRISPR spacer
gagaccgcccgcgatggagggggtggcgccgagc	Protospacer
*   .* *******.** *************.  

1390. spacer 15.3|3945994|35|NC_022350|CRT matches to MN908687 (Gordonia phage Skog, complete genome) position: , mismatch: 10, identity: 0.714

agcggcggggccggcggtagcggcggggccaactt	CRISPR spacer
ggcggcgggtccggcggtaacggcggtttcttcac	Protospacer
.******** *********.******  .*  * .

1391. spacer 15.3|3945994|35|NC_022350|CRT matches to NC_019917 (Burkholderia phage BcepMigl, complete genome) position: , mismatch: 10, identity: 0.714

agcggcggggccggcggtagcggcggggccaactt	CRISPR spacer
atcggcgcggccggcggtaccggcgggaagtatgg	Protospacer
* ***** *********** *******.   *.  

1392. spacer 15.5|3946147|32|NC_022350|CRT matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 10, identity: 0.688

aaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
gtcatccgcagcggcggggccggcgaggaccg	Protospacer
.  . * *** *************** ***. 

1393. spacer 15.5|3946147|32|NC_022350|CRT matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 10, identity: 0.688

aaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
cccggccgcaccggcggtgccggcgaccgagg	Protospacer
   *** ********** ********* .   

1394. spacer 15.5|3946147|32|NC_022350|CRT matches to NZ_CP027239 (Dietzia sp. oral taxon 368 strain W5195 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

aaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
ggttcccgcacccgcggggcccgcgacgaccg	Protospacer
..   * ***** ******** ********. 

1395. spacer 15.5|3946147|32|NC_022350|CRT matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 10, identity: 0.688

aaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
tggtccggccccggcggggccggagacgggtt	Protospacer
 ..  **** ************* ****. *.

1396. spacer 15.5|3946147|32|NC_022350|CRT matches to NC_008381 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL10, complete sequence) position: , mismatch: 10, identity: 0.688

aaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
gctgcgggcaccggcgcggccggcgccgaact	Protospacer
.  *  ********** ******** *** ..

1397. spacer 15.5|3946147|32|NC_022350|CRT matches to NZ_CP010990 (Pseudonocardia sp. EC080625-04 plasmid pFRP1-1, complete sequence) position: , mismatch: 10, identity: 0.688

aaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
caaggcggcaccggcgcgtccggccagcgtga	Protospacer
 *************** * ***** *  ..  

1398. spacer 15.5|3946147|32|NC_022350|CRT matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 10, identity: 0.688

aaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
agtacgggcaccggcggggcgggcgccgaaag	Protospacer
*. .  ************** **** ***   

1399. spacer 15.5|3946147|32|NC_022350|CRT matches to NZ_CP054026 (Rhizobium sp. JKLM12A2 plasmid pPR12A205, complete sequence) position: , mismatch: 10, identity: 0.688

aaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
gccgcgggcaccggcgcggccggcgccgaact	Protospacer
.  *  ********** ******** *** ..

1400. spacer 15.5|3946147|32|NC_022350|CRT matches to NZ_CP054036 (Rhizobium sp. JKLM13E plasmid pPR13E05, complete sequence) position: , mismatch: 10, identity: 0.688

aaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
gctgcgggcaccggcgcggccggcgccgaact	Protospacer
.  *  ********** ******** *** ..

1401. spacer 15.5|3946147|32|NC_022350|CRT matches to MK279887 (Mycobacterium phage Timmi, complete genome) position: , mismatch: 10, identity: 0.688

aaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
cgaggcggcaccggcggcggcggcggtgcggt	Protospacer
 .*************** * *****..*   .

1402. spacer 15.5|3946147|32|NC_022350|CRT matches to KX683293 (Mycobacterium phage Daffy, complete genome) position: , mismatch: 10, identity: 0.688

aaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
cgaggcggcaccggcggcggcggcggtgcggt	Protospacer
 .*************** * *****..*   .

1403. spacer 15.5|3946147|32|NC_022350|CRT matches to JN006063 (Mycobacterium phage Serendipity, complete genome) position: , mismatch: 10, identity: 0.688

aaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
cgaggcggcaccggcggcggcggcggtgcggt	Protospacer
 .*************** * *****..*   .

1404. spacer 15.5|3946147|32|NC_022350|CRT matches to MH576970 (Mycobacterium phage DonSanchon, complete genome) position: , mismatch: 10, identity: 0.688

aaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
cgaggcggcaccggcggcggcggcggtgcggt	Protospacer
 .*************** * *****..*   .

1405. spacer 15.5|3946147|32|NC_022350|CRT matches to MK279881 (Mycobacterium phage Solosis, complete genome) position: , mismatch: 10, identity: 0.688

aaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
cgaggcggcaccggcggcggcggcggtgcggt	Protospacer
 .*************** * *****..*   .

1406. spacer 15.5|3946147|32|NC_022350|CRT matches to JN638753 (Mycobacterium phage Morgushi, complete genome) position: , mismatch: 10, identity: 0.688

aaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
cgaggcggcaccggcggcggcggcggtgcggt	Protospacer
 .*************** * *****..*   .

1407. spacer 15.5|3946147|32|NC_022350|CRT matches to JF704103 (Mycobacterium phage Vortex, complete sequence) position: , mismatch: 10, identity: 0.688

aaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
cgaggcggcaccggcggcggcggcggtgcggt	Protospacer
 .*************** * *****..*   .

1408. spacer 15.5|3946147|32|NC_022350|CRT matches to MK112536 (Mycobacterium phage Cannibal, complete genome) position: , mismatch: 10, identity: 0.688

aaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
cgaggcggcaccggcggcggcggcggtgcggt	Protospacer
 .*************** * *****..*   .

1409. spacer 15.5|3946147|32|NC_022350|CRT matches to JN699010 (Mycobacterium phage TallGrassMM, complete genome) position: , mismatch: 10, identity: 0.688

aaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
cgaggcggcaccggcggcggcggcggtgcggt	Protospacer
 .*************** * *****..*   .

1410. spacer 15.5|3946147|32|NC_022350|CRT matches to MT952849 (Mycobacterium phage Windsor, complete genome) position: , mismatch: 10, identity: 0.688

aaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
cgaggcggcaccggcggcggcggcggtgcggt	Protospacer
 .*************** * *****..*   .

1411. spacer 15.5|3946147|32|NC_022350|CRT matches to NC_028803 (Mycobacterium phage OSmaximus, complete genome) position: , mismatch: 10, identity: 0.688

aaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
cgaggcggcaccggcggcggcggcggtgcggt	Protospacer
 .*************** * *****..*   .

1412. spacer 15.5|3946147|32|NC_022350|CRT matches to MH450122 (Mycobacterium phage KingTut, complete genome) position: , mismatch: 10, identity: 0.688

aaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
cgaggcggcaccggcggcggcggcggtgcggt	Protospacer
 .*************** * *****..*   .

1413. spacer 15.5|3946147|32|NC_022350|CRT matches to MK112544 (Mycobacterium phage Keitherie, complete genome) position: , mismatch: 10, identity: 0.688

aaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
cgaggcggcaccggcggcggcggcggtgcggt	Protospacer
 .*************** * *****..*   .

1414. spacer 15.5|3946147|32|NC_022350|CRT matches to MT310867 (Mycobacterium phage Chaelin, complete genome) position: , mismatch: 10, identity: 0.688

aaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
cgaggcggcaccggcggcggcggcggtgcggt	Protospacer
 .*************** * *****..*   .

1415. spacer 15.5|3946147|32|NC_022350|CRT matches to MH590594 (Mycobacterium phage PinheadLarry, complete genome) position: , mismatch: 10, identity: 0.688

aaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
cgaggcggcaccggcggcggcggcggtgcggt	Protospacer
 .*************** * *****..*   .

1416. spacer 15.10|3946600|35|NC_022350|CRT matches to MN908687 (Gordonia phage Skog, complete genome) position: , mismatch: 10, identity: 0.714

agcggcggggccggcggtagcggcggggccaactt	CRISPR spacer
ggcggcgggtccggcggtaacggcggtttcttcac	Protospacer
.******** *********.******  .*  * .

1417. spacer 15.10|3946600|35|NC_022350|CRT matches to NC_019917 (Burkholderia phage BcepMigl, complete genome) position: , mismatch: 10, identity: 0.714

agcggcggggccggcggtagcggcggggccaactt	CRISPR spacer
atcggcgcggccggcggtaccggcgggaagtatgg	Protospacer
* ***** *********** *******.   *.  

1418. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 11, identity: 0.676

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caacggcggcaacggcggcaacggcggcacgtcg	Protospacer
 . ****************. ******   *...

1419. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP041045 (Paracoccus sp. AK26 plasmid pAK1, complete sequence) position: , mismatch: 11, identity: 0.676

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
tttcggcggcagcggcggcggcggcggaaccccg	Protospacer
  .********.******** ******.   *..

1420. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to MH051334 (Escherichia phage vB_EcoS-Ro145c2YLVW, complete genome) position: , mismatch: 11, identity: 0.676

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggcggctacggcggcggcggcggcaattgg	Protospacer
 .******** ********* ******  . . .

1421. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to MG852086 (Escherichia phage vB_EcoS-Ro145clw, complete genome) position: , mismatch: 11, identity: 0.676

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggcggctacggcggcggcggcggcaattgg	Protospacer
 .******** ********* ******  . . .

1422. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.676

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caccggcggccacggcggggccggcggcgacgcg	Protospacer
 .******** ******* ********  .  ..

1423. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 11, identity: 0.676

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
tttcggcggcaagggcggcgccgccggcgatcag	Protospacer
  .********* ********** ***  . * .

1424. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP020372 (Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs485, complete sequence) position: , mismatch: 11, identity: 0.676

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caggggcggcaacggcggccccggcaggacggcg	Protospacer
 .  *************** *****.**  * ..

1425. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 11, identity: 0.676

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
cataggcggcgatggcggcgccggcgggatggcg	Protospacer
 .. ******.*.***************  * ..

1426. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to ASHF01000034 (Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence) position: , mismatch: 11, identity: 0.676

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ggccgacggcaagggcggcgccggatacgccccc	Protospacer
*****.****** ***********  .    *. 

1427. spacer 6.5|1217362|40|NC_022350|CRISPRCasFinder matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.725

tgccggcggcgccggcggtgtcggcggacccgccgggttg	CRISPR spacer
ggttggcggcaccggcggtgtcggcggagccggtgacatc	Protospacer
 *..******.***************** *** .*.  * 

1428. spacer 13.5|3736009|34|NC_022350|CRT matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 11, identity: 0.676

gttttctcccgcgacggtgggggtggcgccggca	CRISPR spacer
cgcccccggcgtgacggtggaggtggcgccggcc	Protospacer
  ...*.  **.********.************ 

1429. spacer 13.9|3736282|37|NC_022350|CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 11, identity: 0.703

cttgccggcggtgccggcgaccgcggtgccgccggcg	CRISPR spacer
gccgtgcacggcgccggcggccgcggtgccgccgctg	Protospacer
 ..*.  .***.*******.************** .*

1430. spacer 15.3|3945994|35|NC_022350|CRT matches to MT498048 (Mycobacterium phage Raymond7, complete genome) position: , mismatch: 11, identity: 0.686

agcggcggggccggcggtagcggcggggccaactt	CRISPR spacer
gctggcggggccggcggtagcggtggcgcgtcacc	Protospacer
. .********************.** **    ..

1431. spacer 15.3|3945994|35|NC_022350|CRT matches to KF986246 (Mycobacterium phage MichelleMyBell, complete genome) position: , mismatch: 11, identity: 0.686

agcggcggggccggcggtagcggcggggccaactt	CRISPR spacer
gctggcggggccggcggtagcggtggcgcgtcacc	Protospacer
. .********************.** **    ..

1432. spacer 15.5|3946147|32|NC_022350|CRT matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 11, identity: 0.656

aaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
ggcttcggcaccggcgggccgggcgacgcgct	Protospacer
..   ************* * *******  ..

1433. spacer 15.5|3946147|32|NC_022350|CRT matches to NZ_CP022194 (Yangia pacifica strain YSBP01 plasmid unnamed4, complete sequence) position: , mismatch: 11, identity: 0.656

-----aaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
agttcaaggccggcaccgccggggccgccttc-----	Protospacer
     **.* ******** ******** *  *     

1434. spacer 15.10|3946600|35|NC_022350|CRT matches to MT498048 (Mycobacterium phage Raymond7, complete genome) position: , mismatch: 11, identity: 0.686

agcggcggggccggcggtagcggcggggccaactt	CRISPR spacer
gctggcggggccggcggtagcggtggcgcgtcacc	Protospacer
. .********************.** **    ..

1435. spacer 15.10|3946600|35|NC_022350|CRT matches to KF986246 (Mycobacterium phage MichelleMyBell, complete genome) position: , mismatch: 11, identity: 0.686

agcggcggggccggcggtagcggcggggccaactt	CRISPR spacer
gctggcggggccggcggtagcggtggcgcgtcacc	Protospacer
. .********************.** **    ..

1436. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_AP022333 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence) position: , mismatch: 12, identity: 0.647

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
aaccggcggcgacggcgtcgccggcgccaattcg	Protospacer
..********.****** ********   . ...

1437. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_CP026703 (Serratia marcescens strain AR_0027 plasmid unitig_1_pilon, complete sequence) position: , mismatch: 12, identity: 0.647

ggccggcggcaacggcggcgc-----cggcgggtggcta	CRISPR spacer
-gccggaaacgccggcgccgctgttgcggccggtg----	Protospacer
 ***** ..*. ***** ***     **** ****    

1438. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 14, identity: 0.588

-----ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
acggcggccgccggcgccggcgtttccgccgaga-----	Protospacer
     ***** ****. ***** . *** **.*      

1439. spacer 6.3|1217257|34|NC_022350|CRISPRCasFinder matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 15, identity: 0.559

-----ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
acggcggccgccggcgccgacgtttccgccgaga-----	Protospacer
     ***** ****. **.** . *** **.*      

1440. spacer 2.14|341741|27|NC_022350|CRT matches to MK433264 (Gordonia phage Tiamoceli, complete genome) position: , mismatch: 16, identity: 0.407

ttgccgatgagcccgccggcgccgccg----------------	CRISPR spacer
----------------cggcgccgccggcgtgctcatcgtggg	Protospacer
                ***********                

1441. spacer 2.14|341741|27|NC_022350|CRT matches to KR053200 (Gordonia phage GTE6, complete genome) position: , mismatch: 16, identity: 0.407

ttgccgatgagcccgccggcgccgccg----------------	CRISPR spacer
----------------cggcgccgccggcgtgctcatcgtggg	Protospacer
                ***********                

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2936448 : 2974720 46 Mycobacterium_phage(33.33%) protease,capsid,integrase,head,tRNA,terminase attL 2965249:2965276|attR 2974873:2974900
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NC_022350.1|WP_009938544.1|2955364_2957701_-|PE-family-protein 2955364_2957701_- 778 aa aa NA NA NA 2936448-2974720 yes