Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_014643 Rothia dentocariosa ATCC 17931, complete sequence 6 crisprs csa3,cas3,DinG,DEDDh,WYL,csb3,csb2gr5,csb1gr7 0 2 190 0

Results visualization

1. NC_014643
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014643_1 916336-916463 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014643_2 1308815-1308924 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014643_3 1585906-1586182 Orphan NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014643_4 1649328-1649424 Orphan NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014643_5 2360567-2360891 Unclear NA
4 spacers
csb3,cas3,csb2gr5,csb1gr7

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014643_6 2368430-2369637 Unclear NA
16 spacers
csb1gr7,csb2gr5,cas3,csb3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_014643_1 1.1|916359|19|NC_014643|CRISPRCasFinder 916359-916377 19 NZ_CP044383 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-3_MCR3, complete sequence 21386-21404 0 1.0
NC_014643_6 6.6|2368838|36|NC_014643|CRISPRCasFinder,CRT,PILER-CR 2368838-2368873 36 MK061416 Rothia phage Spartoi, complete genome 26370-26405 2 0.944

1. spacer 1.1|916359|19|NC_014643|CRISPRCasFinder matches to NZ_CP044383 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-3_MCR3, complete sequence) position: , mismatch: 0, identity: 1.0

atccagttgcttctggccg	CRISPR spacer
atccagttgcttctggccg	Protospacer
*******************

2. spacer 6.6|2368838|36|NC_014643|CRISPRCasFinder,CRT,PILER-CR matches to MK061416 (Rothia phage Spartoi, complete genome) position: , mismatch: 2, identity: 0.944

gcaagacctccttgatacatctctattggctactgc	CRISPR spacer
gcaagaccttcttgatacttctctattggctactgc	Protospacer
*********.******** *****************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 7829 4 Mycoplasma_phage(50.0%) NA NA
DBSCAN-SWA_2 24387 : 25374 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_3 42891 : 43386 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_4 49579 : 60355 8 Staphylococcus_phage(25.0%) NA NA
DBSCAN-SWA_5 73820 : 76319 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_6 79360 : 80590 1 unidentified_phage(100.0%) NA NA
DBSCAN-SWA_7 83894 : 85229 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_8 90110 : 91466 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_9 94564 : 95413 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_10 102907 : 110540 3 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_11 114368 : 115061 1 Saccharomonospora_phage(100.0%) NA NA
DBSCAN-SWA_12 126444 : 129297 1 Leptospira_phage(100.0%) NA NA
DBSCAN-SWA_13 140093 : 143085 2 Diachasmimorpha_longicaudata_entomopoxvirus(50.0%) NA NA
DBSCAN-SWA_14 157411 : 159535 2 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_15 174385 : 174931 1 Enterococcus_phage(100.0%) NA NA
DBSCAN-SWA_16 199372 : 199573 1 Enterococcus_phage(100.0%) NA NA
DBSCAN-SWA_17 212297 : 213233 1 Anomala_cuprea_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_18 218560 : 219871 1 Gordonia_phage(100.0%) NA NA
DBSCAN-SWA_19 227757 : 228663 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_20 242637 : 243483 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_21 256968 : 259203 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_22 263307 : 267101 3 uncultured_virus(66.67%) NA NA
DBSCAN-SWA_23 270191 : 274800 5 Moraxella_phage(50.0%) tRNA NA
DBSCAN-SWA_24 281393 : 284419 2 Paramecium_bursaria_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_25 316753 : 332144 9 Hokovirus(16.67%) NA NA
DBSCAN-SWA_26 335397 : 338250 1 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_27 341629 : 343243 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_28 364734 : 365862 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_29 368963 : 369509 1 Propionibacterium_phage(100.0%) NA NA
DBSCAN-SWA_30 373118 : 374150 1 Ostreococcus_tauri_virus(100.0%) NA NA
DBSCAN-SWA_31 381334 : 382333 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_32 398222 : 399826 2 Geobacillus_virus(50.0%) NA NA
DBSCAN-SWA_33 412345 : 414433 1 Diachasmimorpha_longicaudata_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_34 418112 : 418478 1 Streptomyces_phage(100.0%) NA NA
DBSCAN-SWA_35 421868 : 425598 3 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_36 437779 : 438583 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_37 472651 : 473500 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_38 486729 : 489531 1 Acanthamoeba_polyphaga_lentillevirus(100.0%) NA NA
DBSCAN-SWA_39 504517 : 509154 2 Hokovirus(50.0%) NA NA
DBSCAN-SWA_40 512540 : 513734 1 uncultured_Mediterranean_phage(100.0%) protease NA
DBSCAN-SWA_41 518020 : 518503 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_42 524080 : 528072 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_43 555549 : 556476 1 Mollivirus(100.0%) NA NA
DBSCAN-SWA_44 561511 : 567162 3 uncultured_Mediterranean_phage(33.33%) NA NA
DBSCAN-SWA_45 580103 : 586128 5 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_46 595846 : 598720 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_47 608832 : 613089 4 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_48 617050 : 619109 2 Erysipelothrix_phage(50.0%) NA NA
DBSCAN-SWA_49 624199 : 629892 6 Erysipelothrix_phage(33.33%) NA NA
DBSCAN-SWA_50 642089 : 643136 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_51 648279 : 654039 3 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_52 670179 : 672473 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_53 679746 : 680880 1 Faustovirus(100.0%) NA NA
DBSCAN-SWA_54 684220 : 685660 1 Bodo_saltans_virus(100.0%) NA NA
DBSCAN-SWA_55 701002 : 701770 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_56 721400 : 723533 1 Diadromus_pulchellus_ascovirus(100.0%) NA NA
DBSCAN-SWA_57 760247 : 765789 4 Cronobacter_phage(33.33%) protease,tRNA NA
DBSCAN-SWA_58 771801 : 777921 6 Pandoravirus(25.0%) protease NA
DBSCAN-SWA_59 783528 : 784014 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_60 792800 : 793577 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_61 806240 : 809793 3 Anomala_cuprea_entomopoxvirus(50.0%) tRNA NA
DBSCAN-SWA_62 817966 : 820366 1 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_63 829567 : 830215 1 Sinorhizobium_phage(100.0%) NA NA
DBSCAN-SWA_64 846449 : 859657 12 Klosneuvirus(16.67%) NA NA
DBSCAN-SWA_65 884247 : 885474 1 Burkholderia_phage(100.0%) NA NA
DBSCAN-SWA_66 895612 : 896581 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_67 910151 : 911876 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_68 917642 : 919208 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_69 940330 : 940858 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_70 947531 : 955625 5 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_71 962185 : 966689 4 Natrialba_phage(25.0%) NA NA
DBSCAN-SWA_72 970581 : 974385 5 Mycobacterium_phage(50.0%) tRNA NA
DBSCAN-SWA_73 982888 : 984247 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_74 996399 : 1001141 3 Acinetobacter_phage(33.33%) NA NA
DBSCAN-SWA_75 1009758 : 1014813 2 Tupanvirus(50.0%) tRNA NA
DBSCAN-SWA_76 1018024 : 1037150 15 Bacillus_phage(25.0%) NA NA
DBSCAN-SWA_77 1054084 : 1055005 1 Anomala_cuprea_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_78 1063346 : 1065278 1 Cedratvirus(100.0%) NA NA
DBSCAN-SWA_79 1070064 : 1074396 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_80 1099900 : 1100929 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_81 1104101 : 1106534 3 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_82 1118985 : 1120977 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_83 1140929 : 1143095 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_84 1147384 : 1157446 8 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_85 1161188 : 1161947 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_86 1198776 : 1199607 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_87 1210856 : 1212143 1 Megavirus(100.0%) NA NA
DBSCAN-SWA_88 1218976 : 1220182 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_89 1228598 : 1229792 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_90 1237630 : 1239775 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_91 1244738 : 1247734 3 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_92 1253599 : 1255063 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_93 1264951 : 1269197 6 Faustovirus(50.0%) NA NA
DBSCAN-SWA_94 1282758 : 1288424 4 Only_Syngen_Nebraska_virus(50.0%) NA NA
DBSCAN-SWA_95 1300940 : 1304510 2 Paramecium_bursaria_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_96 1309808 : 1314677 3 Cyanophage(50.0%) NA NA
DBSCAN-SWA_97 1320420 : 1323294 1 Bacteriophage(100.0%) NA NA
DBSCAN-SWA_98 1326677 : 1327403 1 Streptococcus_virus(100.0%) NA NA
DBSCAN-SWA_99 1337287 : 1338589 1 uncultured_Mediterranean_phage(100.0%) tRNA NA
DBSCAN-SWA_100 1343484 : 1349091 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_101 1365561 : 1368021 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_102 1371072 : 1376493 6 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_103 1390341 : 1396226 7 Pseudomonas_phage(33.33%) NA NA
DBSCAN-SWA_104 1427818 : 1428415 1 Saccharomonospora_phage(100.0%) NA NA
DBSCAN-SWA_105 1432764 : 1434423 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_106 1445060 : 1448725 3 Micromonas_pusilla_virus(50.0%) NA NA
DBSCAN-SWA_107 1459056 : 1464040 2 Indivirus(50.0%) NA NA
DBSCAN-SWA_108 1470012 : 1477228 7 Prochlorococcus_phage(25.0%) NA NA
DBSCAN-SWA_109 1492155 : 1493439 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_110 1496490 : 1499112 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_111 1513169 : 1515091 3 Flavobacterium_phage(50.0%) NA NA
DBSCAN-SWA_112 1523300 : 1523945 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_113 1527806 : 1528073 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_114 1531791 : 1532664 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_115 1540786 : 1545491 3 Streptococcus_phage(33.33%) NA NA
DBSCAN-SWA_116 1549728 : 1554885 4 Escherichia_phage(33.33%) NA NA
DBSCAN-SWA_117 1558198 : 1562355 3 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_118 1571086 : 1574456 3 Enterobacteria_phage(66.67%) NA NA
DBSCAN-SWA_119 1580440 : 1582244 2 environmental_halophage(50.0%) NA NA
DBSCAN-SWA_120 1603728 : 1604268 1 uncultured_marine_virus(100.0%) NA NA
DBSCAN-SWA_121 1623720 : 1625130 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_122 1632207 : 1633461 1 Ralstonia_phage(100.0%) NA NA
DBSCAN-SWA_123 1645877 : 1649603 2 Ralstonia_phage(50.0%) NA NA
DBSCAN-SWA_124 1655370 : 1657572 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_125 1663040 : 1666192 2 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_126 1669927 : 1671307 1 Orpheovirus(100.0%) tRNA NA
DBSCAN-SWA_127 1675333 : 1677364 1 Helicobacter_phage(100.0%) NA NA
DBSCAN-SWA_128 1702037 : 1704827 1 Cafeteria_roenbergensis_virus(100.0%) NA NA
DBSCAN-SWA_129 1708260 : 1709226 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_130 1717456 : 1718788 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_131 1723043 : 1724987 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_132 1730038 : 1737078 6 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_133 1746802 : 1750123 3 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_134 1754916 : 1755618 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_135 1764257 : 1765385 1 Orpheovirus(100.0%) tRNA NA
DBSCAN-SWA_136 1770465 : 1776618 4 Catovirus(33.33%) tRNA NA
DBSCAN-SWA_137 1789253 : 1795900 5 Only_Syngen_Nebraska_virus(33.33%) NA NA
DBSCAN-SWA_138 1807594 : 1808188 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_139 1825780 : 1829398 2 Erysipelothrix_phage(50.0%) NA NA
DBSCAN-SWA_140 1832939 : 1834604 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_141 1863008 : 1866551 1 Streptomyces_phage(100.0%) NA NA
DBSCAN-SWA_142 1882974 : 1887414 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_143 1906613 : 1908524 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_144 1922809 : 1929770 6 Staphylococcus_phage(20.0%) NA NA
DBSCAN-SWA_145 1936380 : 1938483 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_146 1941942 : 1945617 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_147 1952213 : 1954742 1 Geobacillus_virus(100.0%) NA NA
DBSCAN-SWA_148 1959276 : 1959744 1 Streptomyces_phage(100.0%) NA NA
DBSCAN-SWA_149 1968037 : 1969672 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_150 1987765 : 1990526 3 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_151 1994065 : 1998141 5 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_152 2002391 : 2003411 1 Mycobacterium_virus(100.0%) NA NA
DBSCAN-SWA_153 2007687 : 2018410 10 Geobacillus_phage(20.0%) NA NA
DBSCAN-SWA_154 2028820 : 2031766 1 Listeria_phage(100.0%) NA NA
DBSCAN-SWA_155 2047690 : 2050297 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_156 2053298 : 2055035 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_157 2059220 : 2069665 8 Enterococcus_phage(33.33%) NA NA
DBSCAN-SWA_158 2076360 : 2078321 2 Thermobifida_phage(50.0%) NA NA
DBSCAN-SWA_159 2085659 : 2087282 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_160 2099914 : 2101468 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_161 2108545 : 2109610 1 Anomala_cuprea_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_162 2114784 : 2121480 7 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_163 2125041 : 2127440 3 Trichoplusia_ni_ascovirus(50.0%) NA NA
DBSCAN-SWA_164 2131647 : 2134320 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_165 2138685 : 2139468 1 Flavobacterium_phage(100.0%) NA NA
DBSCAN-SWA_166 2142963 : 2143317 1 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_167 2153789 : 2158564 4 Catovirus(50.0%) NA NA
DBSCAN-SWA_168 2165197 : 2170112 3 Sulfolobales_Virus_YNP2(50.0%) NA NA
DBSCAN-SWA_169 2179299 : 2183727 3 Hokovirus(33.33%) tRNA NA
DBSCAN-SWA_170 2191409 : 2194560 3 Pseudomonas_phage(50.0%) NA NA
DBSCAN-SWA_171 2199169 : 2201029 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_172 2207643 : 2221223 9 Staphylococcus_phage(33.33%) tRNA NA
DBSCAN-SWA_173 2239738 : 2246410 5 Tupanvirus(50.0%) tRNA NA
DBSCAN-SWA_174 2249506 : 2256331 4 Tupanvirus(33.33%) tRNA NA
DBSCAN-SWA_175 2273336 : 2275373 1 Tupanvirus(100.0%) tRNA NA
DBSCAN-SWA_176 2286359 : 2301918 12 Mycobacterium_phage(25.0%) NA NA
DBSCAN-SWA_177 2322648 : 2323062 1 Anguillid_herpesvirus(100.0%) NA NA
DBSCAN-SWA_178 2326249 : 2329597 1 Tupanvirus(100.0%) tRNA NA
DBSCAN-SWA_179 2341842 : 2357056 10 Agrobacterium_phage(33.33%) protease,tRNA NA
DBSCAN-SWA_180 2369896 : 2371576 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_181 2381194 : 2382298 1 uncultured_phage(100.0%) NA NA
DBSCAN-SWA_182 2393742 : 2396989 5 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_183 2424269 : 2427823 3 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_184 2431538 : 2439176 3 Acidithiobacillus_phage(50.0%) NA NA
DBSCAN-SWA_185 2442818 : 2443622 1 Anomala_cuprea_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_186 2454529 : 2456134 2 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_187 2470621 : 2471383 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_188 2474538 : 2484496 7 Planktothrix_phage(33.33%) tRNA NA
DBSCAN-SWA_189 2493612 : 2494704 1 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_190 2500274 : 2501462 1 Bacillus_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage