Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_017161 Hydrogenobacter thermophilus TK-6, complete sequence 1 crisprs csa3,TnpB_regular.1,cas3,DinG,Cas14u_CAS-V,cas2,cas1,cas4,cas5,cas7,cas8b1,cas6,DEDDh,Cas14b_CAS-V-F,cas14k 1 0 3 0

Results visualization

1. NC_017161
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017161_1 1122535-1124777 TypeI-B NA
33 spacers
cas2,cas1,cas4,cas3,cas5,cas7,cas8b1,cas6

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_017161_1 1.25|1124176|37|NC_017161|CRISPRCasFinder,CRT,PILER-CR 1124176-1124212 37 NC_017161.1 568034-568070 0 1.0

1. spacer 1.25|1124176|37|NC_017161|CRISPRCasFinder,CRT,PILER-CR matches to position: 568034-568070, mismatch: 0, identity: 1.0

cataggcattgacgaaggggatatctactttaccgcc	CRISPR spacer
cataggcattgacgaaggggatatctactttaccgcc	Protospacer
*************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 773709 : 784863 8 Bacillus_phage(16.67%) tRNA NA
DBSCAN-SWA_2 1150594 : 1160021 9 uncultured_Caudovirales_phage(33.33%) NA NA
DBSCAN-SWA_3 1452831 : 1459020 8 Bacillus_virus(28.57%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage