Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_017451 Haemophilus influenzae R2866, complete genome 4 crisprs DinG,cas14j,DEDDh,cas3,WYL 0 2 4 0

Results visualization

1. NC_017451
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017451_1 602240-602411 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017451_2 741215-741363 Orphan NA
1 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017451_3 1433758-1433910 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017451_4 1852404-1852495 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_017451_1 1.2|602340|44|NC_017451|CRISPRCasFinder 602340-602383 44 NC_011409 Haemophilus influenzae plasmid ICEhin1056, complete sequence 6039-6082 5 0.886
NC_017451_1 1.1|602268|44|NC_017451|CRISPRCasFinder 602268-602311 44 NC_011409 Haemophilus influenzae plasmid ICEhin1056, complete sequence 6075-6118 6 0.864
NC_017451_1 1.2|602340|44|NC_017451|CRISPRCasFinder 602340-602383 44 NC_011409 Haemophilus influenzae plasmid ICEhin1056, complete sequence 6111-6154 13 0.705

1. spacer 1.2|602340|44|NC_017451|CRISPRCasFinder matches to NC_011409 (Haemophilus influenzae plasmid ICEhin1056, complete sequence) position: , mismatch: 5, identity: 0.886

gtccccgcacactggttaaaatttgtactttgtaaagtcccttt	CRISPR spacer
accctagcacactggttaaaatttgtactttgtaaagccccttt	Protospacer
..**. *******************************.******

2. spacer 1.1|602268|44|NC_017451|CRISPRCasFinder matches to NC_011409 (Haemophilus influenzae plasmid ICEhin1056, complete sequence) position: , mismatch: 6, identity: 0.864

accctagcacagtggttaatttttgttcactgtgcaaccctagc	CRISPR spacer
gcccctttacagtggttaatttttgttcaccgtgcaaccctagc	Protospacer
.***.  .**********************.*************

3. spacer 1.2|602340|44|NC_017451|CRISPRCasFinder matches to NC_011409 (Haemophilus influenzae plasmid ICEhin1056, complete sequence) position: , mismatch: 13, identity: 0.705

gtccccgcacactggttaaaatttgtactttgtaaagtcccttt	CRISPR spacer
ccttttatcatttggttaaaatttgtactttgtaaagccccttt	Protospacer
 .......   .*************************.******

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 473002 : 575672 95 Haemophilus_virus(61.11%) tail,head,transposase,tRNA,integrase,holin,portal,capsid,terminase attL 488960:488978|attR 575875:575893
DBSCAN-SWA_2 987863 : 1003760 22 Haemophilus_phage(38.89%) terminase,holin NA
DBSCAN-SWA_3 1234783 : 1243297 8 Bacillus_virus(33.33%) NA NA
DBSCAN-SWA_4 1702534 : 1798810 88 Mannheimia_phage(43.9%) tail,head,tRNA,protease,plate,integrase,portal,capsid,terminase attL 1727564:1727584|attR 1785296:1785316
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage