Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_017507 Marinobacter adhaerens HP15 plasmid pHP-187, complete sequence 0 crisprs NA 0 0 0 0
NC_017506 Marinobacter adhaerens HP15, complete sequence 1 crisprs DEDDh,DinG,cas3,csa3,WYL 0 1 4 1
NC_017508 Marinobacter adhaerens HP15 plasmid pHP-42, complete sequence 0 crisprs DEDDh 0 0 0 0

Results visualization

1. NC_017506
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017506_1 698921-699081 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_017506_1 1.3|699034|26|NC_017506|CRT 699034-699059 26 NZ_CP029537 Lactobacillus paracasei strain LC355 plasmid unnamed1, complete sequence 12480-12505 5 0.808
NC_017506_1 1.3|699034|26|NC_017506|CRT 699034-699059 26 NZ_CP029547 Lactobacillus paracasei strain EG9 plasmid pEG9A, complete sequence 20208-20233 5 0.808
NC_017506_1 1.3|699034|26|NC_017506|CRT 699034-699059 26 NZ_AP018394 Lactobacillus paracasei strain IJH-SONE68 plasmid pLPS-2 21653-21678 5 0.808
NC_017506_1 1.3|699034|26|NC_017506|CRT 699034-699059 26 NZ_CP014988 Lactobacillus paracasei strain IIA plasmid unnamed3, complete sequence 65445-65470 5 0.808
NC_017506_1 1.3|699034|26|NC_017506|CRT 699034-699059 26 NZ_CP012188 Lactobacillus paracasei strain CAUH35 plasmid unnamed1, complete sequence 10006-10031 5 0.808

1. spacer 1.3|699034|26|NC_017506|CRT matches to NZ_CP029537 (Lactobacillus paracasei strain LC355 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808

aactgttgtttttgttggctgtacac	CRISPR spacer
gactgatgtttttgttggctgtattg	Protospacer
.**** *****************.  

2. spacer 1.3|699034|26|NC_017506|CRT matches to NZ_CP029547 (Lactobacillus paracasei strain EG9 plasmid pEG9A, complete sequence) position: , mismatch: 5, identity: 0.808

aactgttgtttttgttggctgtacac	CRISPR spacer
gactgatgtttttgttggctgtattg	Protospacer
.**** *****************.  

3. spacer 1.3|699034|26|NC_017506|CRT matches to NZ_AP018394 (Lactobacillus paracasei strain IJH-SONE68 plasmid pLPS-2) position: , mismatch: 5, identity: 0.808

aactgttgtttttgttggctgtacac	CRISPR spacer
gactgatgtttttgttggctgtatcg	Protospacer
.**** *****************.  

4. spacer 1.3|699034|26|NC_017506|CRT matches to NZ_CP014988 (Lactobacillus paracasei strain IIA plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.808

aactgttgtttttgttggctgtacac	CRISPR spacer
gactgatgtttttgttggctgtattg	Protospacer
.**** *****************.  

5. spacer 1.3|699034|26|NC_017506|CRT matches to NZ_CP012188 (Lactobacillus paracasei strain CAUH35 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808

aactgttgtttttgttggctgtacac	CRISPR spacer
gactgatgtttttgttggctgtattg	Protospacer
.**** *****************.  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 671088 : 721080 66 Escherichia_phage(28.21%) capsid,integrase,plate,terminase,tRNA,tail,portal attL 670740:670788|attR 712476:712524
DBSCAN-SWA_2 2068040 : 2111972 59 Marinobacter_phage(84.09%) capsid,integrase,head,terminase,tail,portal attL 2066541:2066587|attR 2110037:2110083
DBSCAN-SWA_3 2142347 : 2155018 10 Hokovirus(25.0%) tRNA NA
DBSCAN-SWA_4 3592299 : 3666452 60 Bacillus_phage(25.0%) plate,protease,tRNA,integrase attL 3622425:3622440|attR 3669230:3669245
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NC_017506.1|WP_014575787.1|155679_155997_+|hypothetical-protein 155679_155997_+ 105 aa aa 93 NA NA No NA