1. spacer 5.3|421706|27|NC_014656|CRISPRCasFinder matches to NZ_CP050093 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence) position: , mismatch: 5, identity: 0.815
ggcggtgccgtcggttttcgaatccga CRISPR spacer
ggcggtgccgtcggctttcgaaatggg Protospacer
**************.******* . *.
2. spacer 5.3|421706|27|NC_014656|CRISPRCasFinder matches to NZ_CP050082 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b4, complete sequence) position: , mismatch: 5, identity: 0.815
ggcggtgccgtcggttttcgaatccga CRISPR spacer
ggcggtgccgtcggctttcgaaatggg Protospacer
**************.******* . *.
3. spacer 5.3|421706|27|NC_014656|CRISPRCasFinder matches to NZ_CP050105 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b6, complete sequence) position: , mismatch: 5, identity: 0.815
ggcggtgccgtcggttttcgaatccga CRISPR spacer
ggcggtgccgtcggctttcgaaatggg Protospacer
**************.******* . *.
4. spacer 5.3|421706|27|NC_014656|CRISPRCasFinder matches to NC_008384 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence) position: , mismatch: 5, identity: 0.815
ggcggtgccgtcggttttcgaatccga CRISPR spacer
ggcggtgccgtcggctttcgaaatggg Protospacer
**************.******* . *.
5. spacer 5.3|421706|27|NC_014656|CRISPRCasFinder matches to NZ_CP021032 (Rhizobium sp. NXC14 plasmid pRspNXC14b, complete sequence) position: , mismatch: 5, identity: 0.815
ggcggtgccgtcggttttcgaatccga CRISPR spacer
ggcggtgccgtcggctttcgaaatggg Protospacer
**************.******* . *.
6. spacer 5.3|421706|27|NC_014656|CRISPRCasFinder matches to NZ_CP049732 (Rhizobium leguminosarum strain A1 plasmid pRL11, complete sequence) position: , mismatch: 5, identity: 0.815
ggcggtgccgtcggttttcgaatccga CRISPR spacer
ggcggtgccgtcggctttcgaaatggg Protospacer
**************.******* . *.
7. spacer 5.3|421706|27|NC_014656|CRISPRCasFinder matches to NZ_CP020951 (Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence) position: , mismatch: 5, identity: 0.815
ggcggtgccgtcggttttcgaatccga CRISPR spacer
ggcggtgccgtcggctttcgaaatggg Protospacer
**************.******* . *.
8. spacer 5.3|421706|27|NC_014656|CRISPRCasFinder matches to NZ_CP025508 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvB, complete sequence) position: , mismatch: 5, identity: 0.815
ggcggtgccgtcggttttcgaatccga CRISPR spacer
ggcggtgccgtcggctttcgaaatggg Protospacer
**************.******* . *.
9. spacer 5.3|421706|27|NC_014656|CRISPRCasFinder matches to NZ_CP016289 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.815
ggcggtgccgtcggttttcgaatccga CRISPR spacer
ggcggtgccgtcggctttcgaaatggg Protospacer
**************.******* . *.
10. spacer 5.3|421706|27|NC_014656|CRISPRCasFinder matches to NC_012858 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132502, complete sequence) position: , mismatch: 5, identity: 0.815
ggcggtgccgtcggttttcgaatccga CRISPR spacer
ggcggtgccgtcggctttcgaaatggg Protospacer
**************.******* . *.
11. spacer 5.3|421706|27|NC_014656|CRISPRCasFinder matches to NZ_CP050110 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b4, complete sequence) position: , mismatch: 5, identity: 0.815
ggcggtgccgtcggttttcgaatccga CRISPR spacer
ggcggtgccgtcggctttcgaaatggg Protospacer
**************.******* . *.
12. spacer 5.3|421706|27|NC_014656|CRISPRCasFinder matches to NZ_CP048282 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248d, complete sequence) position: , mismatch: 5, identity: 0.815
ggcggtgccgtcggttttcgaatccga CRISPR spacer
ggcggtgccgtcggctttcgaaatggg Protospacer
**************.******* . *.
13. spacer 5.3|421706|27|NC_014656|CRISPRCasFinder matches to NZ_CP030764 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.815
ggcggtgccgtcggttttcgaatccga CRISPR spacer
ggcggtgccgtcggctttcgaaatggg Protospacer
**************.******* . *.
14. spacer 5.3|421706|27|NC_014656|CRISPRCasFinder matches to NZ_CP054023 (Rhizobium sp. JKLM12A2 plasmid pPR12A202, complete sequence) position: , mismatch: 5, identity: 0.815
ggcggtgccgtcggttttcgaatccga CRISPR spacer
ggcggtgccgtcggctttcgaaatggg Protospacer
**************.******* . *.
15. spacer 5.3|421706|27|NC_014656|CRISPRCasFinder matches to NZ_CP054029 (Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence) position: , mismatch: 5, identity: 0.815
ggcggtgccgtcggttttcgaatccga CRISPR spacer
ggcggtgccgtcggctttcgaaatggg Protospacer
**************.******* . *.
16. spacer 5.3|421706|27|NC_014656|CRISPRCasFinder matches to NZ_CP022667 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR2, complete sequence) position: , mismatch: 5, identity: 0.815
ggcggtgccgtcggttttcgaatccga CRISPR spacer
ggcggtgccgtcggctttcgaaatggg Protospacer
**************.******* . *.
17. spacer 5.3|421706|27|NC_014656|CRISPRCasFinder matches to NZ_CP054033 (Rhizobium sp. JKLM13E plasmid pPR13E02, complete sequence) position: , mismatch: 5, identity: 0.815
ggcggtgccgtcggttttcgaatccga CRISPR spacer
ggcggtgccgtcggctttcgaaatggg Protospacer
**************.******* . *.
18. spacer 5.3|421706|27|NC_014656|CRISPRCasFinder matches to NZ_CP022566 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK02, complete sequence) position: , mismatch: 5, identity: 0.815
ggcggtgccgtcggttttcgaatccga CRISPR spacer
ggcggtgccgtcggctttcgaaatggg Protospacer
**************.******* . *.
19. spacer 5.3|421706|27|NC_014656|CRISPRCasFinder matches to NZ_CP053208 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1B, complete sequence) position: , mismatch: 5, identity: 0.815
ggcggtgccgtcggttttcgaatccga CRISPR spacer
ggcggtgccgtcggctttcgaaatggg Protospacer
**************.******* . *.
20. spacer 5.3|421706|27|NC_014656|CRISPRCasFinder matches to NZ_CP050087 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b5, complete sequence) position: , mismatch: 5, identity: 0.815
ggcggtgccgtcggttttcgaatccga CRISPR spacer
ggcggtgccgtcggctttcgaaatggg Protospacer
**************.******* . *.
21. spacer 7.4|2265550|32|NC_014656|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP004389 (Thalassospira xiamenensis M-5 = DSM 17429 strain M-5 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844
tccacgttgtcgatgacaccggtcatgcaggc- CRISPR spacer
tccacgttgtcgaccacaccggtcat-tatgcg Protospacer
*************. *********** .* **
22. spacer 1.4|2039|32|NC_014656|PILER-CR,CRISPRCasFinder,CRT matches to NC_014260 (Enterobacteria phage IME08, complete genome) position: , mismatch: 6, identity: 0.812
cattcggcaacggcggcaaaatcgg--caaatca CRISPR spacer
cattcggcaacggcgggaaaatagggtctgat-- Protospacer
**************** ***** ** * .**
23. spacer 1.4|2039|32|NC_014656|PILER-CR,CRISPRCasFinder,CRT matches to HM071924 (Enterobacteria phage IME08, complete sequence) position: , mismatch: 6, identity: 0.812
cattcggcaacggcggcaaaatcgg--caaatca CRISPR spacer
cattcggcaacggcgggaaaatagggtctgat-- Protospacer
**************** ***** ** * .**
24. spacer 1.12|2534|31|NC_014656|CRISPRCasFinder,CRT matches to NZ_CP038257 (Microbacterium sediminis strain YLB-01 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
gaaatcagcgacttcctctcgctggcaacaa CRISPR spacer
gagatcagcgacttcgtctcgctggcccgca Protospacer
**.************ ********** *
25. spacer 2.1|4080|32|NC_014656|CRT matches to MK937607 (Gordonia phage Zipp, complete genome) position: , mismatch: 6, identity: 0.812
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
tcgccgtcggtgtcggccttgtcgccgtcgcc Protospacer
*.******************* ***** *.
26. spacer 2.1|4080|32|NC_014656|CRT matches to MK937611 (Gordonia phage Verity, complete genome) position: , mismatch: 6, identity: 0.812
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
tcgccgtcggtgtcggccttgtcgccgtcgcc Protospacer
*.******************* ***** *.
27. spacer 2.1|4080|32|NC_014656|CRT matches to NZ_LR134452 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence) position: , mismatch: 6, identity: 0.812
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
tggtcgatggtgtcggccttgccgccgcagta Protospacer
* *.** .************* ***** ****
28. spacer 2.2|4141|32|NC_014656|CRT,CRISPRCasFinder matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
gagatagccgacgcactggaatcggccgcagg CRISPR spacer
gcgctggccgacgcactggaacaggccgcaga Protospacer
* * *.***************. ********.
29. spacer 2.2|4141|32|NC_014656|CRT,CRISPRCasFinder matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 6, identity: 0.812
gagatagccgacgcactggaatcggccgcagg CRISPR spacer
gcgctggccgacgcactggaacaggccgcaga Protospacer
* * *.***************. ********.
30. spacer 2.2|4141|32|NC_014656|CRT,CRISPRCasFinder matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
gagatagccgacgcactggaatcggccgcagg CRISPR spacer
gcgctggccgacgcactggaacaggccgcaga Protospacer
* * *.***************. ********.
31. spacer 2.2|4141|32|NC_014656|CRT,CRISPRCasFinder matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
gagatagccgacgcactggaatcggccgcagg CRISPR spacer
gcgctggccgacgcactggaacaggccgcaga Protospacer
* * *.***************. ********.
32. spacer 2.2|4141|32|NC_014656|CRT,CRISPRCasFinder matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 6, identity: 0.812
gagatagccgacgcactggaatcggccgcagg CRISPR spacer
gcgctggccgacgcactggaacaggccgcaga Protospacer
* * *.***************. ********.
33. spacer 2.2|4141|32|NC_014656|CRT,CRISPRCasFinder matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
gagatagccgacgcactggaatcggccgcagg CRISPR spacer
gcgctggccgacgcactggaacaggccgcaga Protospacer
* * *.***************. ********.
34. spacer 2.2|4141|32|NC_014656|CRT,CRISPRCasFinder matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
gagatagccgacgcactggaatcggccgcagg CRISPR spacer
gcgctggccgacgcactggaacaggccgcaga Protospacer
* * *.***************. ********.
35. spacer 2.2|4141|32|NC_014656|CRT,CRISPRCasFinder matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
gagatagccgacgcactggaatcggccgcagg CRISPR spacer
gcgctggccgacgcactggaacaggccgcaga Protospacer
* * *.***************. ********.
36. spacer 2.2|4141|32|NC_014656|CRT,CRISPRCasFinder matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
gagatagccgacgcactggaatcggccgcagg CRISPR spacer
gcgctggccgacgcactggaacaggccgcaga Protospacer
* * *.***************. ********.
37. spacer 2.2|4141|32|NC_014656|CRT,CRISPRCasFinder matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
gagatagccgacgcactggaatcggccgcagg CRISPR spacer
gcgctggccgacgcactggaacaggccgcaga Protospacer
* * *.***************. ********.
38. spacer 2.2|4141|32|NC_014656|CRT,CRISPRCasFinder matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
gagatagccgacgcactggaatcggccgcagg CRISPR spacer
gcgctggccgacgcactggaacaggccgcaga Protospacer
* * *.***************. ********.
39. spacer 5.3|421706|27|NC_014656|CRISPRCasFinder matches to NZ_CP050099 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b5, complete sequence) position: , mismatch: 6, identity: 0.778
ggcggtgccgtcggttttcgaatccga CRISPR spacer
ggcggtgccgtcggctttcgagatggg Protospacer
**************.******. . *.
40. spacer 5.3|421706|27|NC_014656|CRISPRCasFinder matches to NZ_CP053441 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eE, complete sequence) position: , mismatch: 6, identity: 0.778
ggcggtgccgtcggttttcgaatccga CRISPR spacer
ggcggtgccgtcggctttcgagatggg Protospacer
**************.******. . *.
41. spacer 5.3|421706|27|NC_014656|CRISPRCasFinder matches to NZ_CP020909 (Rhizobium etli strain NXC12 plasmid pRetNXC12c, complete sequence) position: , mismatch: 6, identity: 0.778
ggcggtgccgtcggttttcgaatccga CRISPR spacer
ggcggtgccgtcggctttcgagatggg Protospacer
**************.******. . *.
42. spacer 5.3|421706|27|NC_014656|CRISPRCasFinder matches to NC_021908 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1d, complete sequence) position: , mismatch: 6, identity: 0.778
ggcggtgccgtcggttttcgaatccga CRISPR spacer
ggcggtgccgtcggctttcgagatggg Protospacer
**************.******. . *.
43. spacer 7.1|2265367|32|NC_014656|PILER-CR,CRISPRCasFinder,CRT matches to NC_022001 (Streptomyces collinus Tu 365 plasmid pSCO1, complete sequence) position: , mismatch: 6, identity: 0.812
gacaaggtaggcaaggcgtcggttgctgccgg CRISPR spacer
ggcggcgtgggcaagacgtcggttgctgccgg Protospacer
*.*.. **.******.****************
44. spacer 7.3|2265489|32|NC_014656|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 6, identity: 0.812
gtgatgggcaggttgccgccggtccaggtgag--- CRISPR spacer
gtgacgtgcaggttgccgccggt---ggtcagcgt Protospacer
****.* **************** *** **
45. spacer 7.3|2265489|32|NC_014656|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 6, identity: 0.812
gtgatgggcaggttgccgccggtccaggtgag--- CRISPR spacer
gtgacgtgcaggttgccgccggt---ggtcagcgt Protospacer
****.* **************** *** **
46. spacer 7.3|2265489|32|NC_014656|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 6, identity: 0.812
gtgatgggcaggttgccgccggtccaggtgag--- CRISPR spacer
gtgacgtgcaggttgccgccggt---ggtcagcgt Protospacer
****.* **************** *** **
47. spacer 7.4|2265550|32|NC_014656|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 6, identity: 0.812
tccacgttgtcgatgacaccggtcatgcaggc CRISPR spacer
accaggttgtcgatgacaccggccatgcgctc Protospacer
*** *****************.*****. *
48. spacer 7.4|2265550|32|NC_014656|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 6, identity: 0.812
tccacgttgtcgatgacaccggtcatgcaggc CRISPR spacer
accaggttgtcgatgacaccggccatgcgctc Protospacer
*** *****************.*****. *
49. spacer 7.4|2265550|32|NC_014656|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 6, identity: 0.812
tccacgttgtcgatgacaccggtcatgcaggc CRISPR spacer
accaggttgtcgatgacaccggccatgcgctc Protospacer
*** *****************.*****. *
50. spacer 7.4|2265550|32|NC_014656|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 6, identity: 0.812
tccacgttgtcgatgacaccggtcatgcaggc CRISPR spacer
accaggttgtcgatgacaccggccatgcgctc Protospacer
*** *****************.*****. *
51. spacer 1.1|1856|32|NC_014656|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020927 (Sphingobium yanoikuyae strain SHJ plasmid pSES189, complete sequence) position: , mismatch: 7, identity: 0.781
cactgg--agttcgtggacatggacgcggccgac CRISPR spacer
--ctgaccccttcgtggacatggacgttgccgac Protospacer
***. ****************. ******
52. spacer 1.1|1856|32|NC_014656|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020927 (Sphingobium yanoikuyae strain SHJ plasmid pSES189, complete sequence) position: , mismatch: 7, identity: 0.781
cactgg--agttcgtggacatggacgcggccgac CRISPR spacer
--ctgaccccttcgtggacatggacgttgccgac Protospacer
***. ****************. ******
53. spacer 1.1|1856|32|NC_014656|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053023 (Sphingobium yanoikuyae strain YC-XJ2 plasmid p-B-Sy, complete sequence) position: , mismatch: 7, identity: 0.781
cactgg--agttcgtggacatggacgcggccgac CRISPR spacer
--ctgaccccttcgtggacatggacgttgccgac Protospacer
***. ****************. ******
54. spacer 1.1|1856|32|NC_014656|PILER-CR,CRISPRCasFinder,CRT matches to MN694334 (Marine virus AFVG_250M1054, complete genome) position: , mismatch: 7, identity: 0.781
----cactggagttcgtggacatggacgcggccgac CRISPR spacer
accccact----ctcgtggtcatggacgaggccgac Protospacer
**** .****** ******** *******
55. spacer 2.1|4080|32|NC_014656|CRT matches to NZ_CP054033 (Rhizobium sp. JKLM13E plasmid pPR13E02, complete sequence) position: , mismatch: 7, identity: 0.781
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
ttgccgtcggtctcgcccttgacgaggcgata Protospacer
*********** *** ******** * ..**
56. spacer 2.1|4080|32|NC_014656|CRT matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 7, identity: 0.781
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
ttgccgtcggtctcgcccttgacgaggcgata Protospacer
*********** *** ******** * ..**
57. spacer 2.1|4080|32|NC_014656|CRT matches to NZ_CP050093 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence) position: , mismatch: 7, identity: 0.781
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
ttgccgtcggtctcgcccttgacgaggcgata Protospacer
*********** *** ******** * ..**
58. spacer 2.1|4080|32|NC_014656|CRT matches to NZ_CP050082 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b4, complete sequence) position: , mismatch: 7, identity: 0.781
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
ttgccgtcggtctcgcccttgacgaggcgata Protospacer
*********** *** ******** * ..**
59. spacer 2.1|4080|32|NC_014656|CRT matches to NZ_CP050105 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b6, complete sequence) position: , mismatch: 7, identity: 0.781
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
ttgccgtcggtctcgcccttgacgaggcgata Protospacer
*********** *** ******** * ..**
60. spacer 2.1|4080|32|NC_014656|CRT matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 7, identity: 0.781
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
ttgccgtcggtctcgcccttgacgaggcgata Protospacer
*********** *** ******** * ..**
61. spacer 2.1|4080|32|NC_014656|CRT matches to NC_008384 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence) position: , mismatch: 7, identity: 0.781
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
ttgccgtcggtctcgcccttgacgaggcgata Protospacer
*********** *** ******** * ..**
62. spacer 2.1|4080|32|NC_014656|CRT matches to NZ_CP025014 (Rhizobium leguminosarum strain Norway plasmid pRLN2, complete sequence) position: , mismatch: 7, identity: 0.781
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
ttgccgtcggtctcgcccttgacgaggcgata Protospacer
*********** *** ******** * ..**
63. spacer 2.1|4080|32|NC_014656|CRT matches to NZ_CP049732 (Rhizobium leguminosarum strain A1 plasmid pRL11, complete sequence) position: , mismatch: 7, identity: 0.781
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
ttgccgtcggtctcgcccttgacgaggcgata Protospacer
*********** *** ******** * ..**
64. spacer 2.1|4080|32|NC_014656|CRT matches to NZ_CP053441 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eE, complete sequence) position: , mismatch: 7, identity: 0.781
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
ttgccgtcggtctcgcccttgacgaggcgata Protospacer
*********** *** ******** * ..**
65. spacer 2.1|4080|32|NC_014656|CRT matches to NZ_CP021028 (Rhizobium sp. TAL182 plasmid pRetTAL182d, complete sequence) position: , mismatch: 7, identity: 0.781
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
ttgccgtcggtctcgcccttgacgaggcgata Protospacer
*********** *** ******** * ..**
66. spacer 2.1|4080|32|NC_014656|CRT matches to NZ_CP006989 (Rhizobium sp. IE4771 plasmid pRetIE4771c, complete sequence) position: , mismatch: 7, identity: 0.781
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
ttgccgtcggtctcgcccttgacgaggcgata Protospacer
*********** *** ******** * ..**
67. spacer 2.1|4080|32|NC_014656|CRT matches to NZ_CP013525 (Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence) position: , mismatch: 7, identity: 0.781
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
ttgccgtcggtctcgcccttgacgaggcgata Protospacer
*********** *** ******** * ..**
68. spacer 2.1|4080|32|NC_014656|CRT matches to NZ_CP013554 (Rhizobium phaseoli strain N931 plasmid pRphaN931b, complete sequence) position: , mismatch: 7, identity: 0.781
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
ttgccgtcggtctcgcccttgacgaggcgata Protospacer
*********** *** ******** * ..**
69. spacer 2.1|4080|32|NC_014656|CRT matches to NZ_CP020951 (Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence) position: , mismatch: 7, identity: 0.781
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
ttgccgtcggtctcgcccttgacgaggcgata Protospacer
*********** *** ******** * ..**
70. spacer 2.1|4080|32|NC_014656|CRT matches to NZ_CP018230 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
ttgccgtcggtctcgcccttgacgaggcgata Protospacer
*********** *** ******** * ..**
71. spacer 2.1|4080|32|NC_014656|CRT matches to NZ_CP025508 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvB, complete sequence) position: , mismatch: 7, identity: 0.781
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
ttgccgtcggtctcgcccttgacgaggcgata Protospacer
*********** *** ******** * ..**
72. spacer 2.1|4080|32|NC_014656|CRT matches to NZ_CP016289 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
ttgccgtcggtctcgcccttgacgaggcgata Protospacer
*********** *** ******** * ..**
73. spacer 2.1|4080|32|NC_014656|CRT matches to NC_012858 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132502, complete sequence) position: , mismatch: 7, identity: 0.781
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
ttgccgtcggtctcgcccttgacgaggcgata Protospacer
*********** *** ******** * ..**
74. spacer 2.1|4080|32|NC_014656|CRT matches to NZ_CP013560 (Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence) position: , mismatch: 7, identity: 0.781
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
ttgccgtcggtctcgcccttgacgaggcgata Protospacer
*********** *** ******** * ..**
75. spacer 2.1|4080|32|NC_014656|CRT matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 7, identity: 0.781
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
ttgccgtcggtctcgcccttgacgaggcgata Protospacer
*********** *** ******** * ..**
76. spacer 2.1|4080|32|NC_014656|CRT matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 7, identity: 0.781
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
ttgccgtcggtctcgcccttgacgaggcgata Protospacer
*********** *** ******** * ..**
77. spacer 2.1|4080|32|NC_014656|CRT matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 7, identity: 0.781
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
ttgccgtcggtctcgcccttgacgaggcgata Protospacer
*********** *** ******** * ..**
78. spacer 2.1|4080|32|NC_014656|CRT matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 7, identity: 0.781
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
ttgccgtcggtctcgcccttgacgaggcgata Protospacer
*********** *** ******** * ..**
79. spacer 2.1|4080|32|NC_014656|CRT matches to NZ_CP013565 (Rhizobium phaseoli strain N831 plasmid pRphaN831b, complete sequence) position: , mismatch: 7, identity: 0.781
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
ttgccgtcggtctcgcccttgacgaggcgata Protospacer
*********** *** ******** * ..**
80. spacer 2.1|4080|32|NC_014656|CRT matches to NZ_CP013503 (Rhizobium esperanzae strain N561 plasmid pRspN561c, complete sequence) position: , mismatch: 7, identity: 0.781
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
ttgccgtcggtctcgcccttgacgaggcgata Protospacer
*********** *** ******** * ..**
81. spacer 2.1|4080|32|NC_014656|CRT matches to NZ_CP022999 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence) position: , mismatch: 7, identity: 0.781
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
ttgccgtcggtctcgcccttgacgaggcgata Protospacer
*********** *** ******** * ..**
82. spacer 2.1|4080|32|NC_014656|CRT matches to NZ_CP050110 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b4, complete sequence) position: , mismatch: 7, identity: 0.781
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
ttgccgtcggtctcgcccttgacgaggcgata Protospacer
*********** *** ******** * ..**
83. spacer 2.1|4080|32|NC_014656|CRT matches to NZ_CP048282 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248d, complete sequence) position: , mismatch: 7, identity: 0.781
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
ttgccgtcggtctcgcccttgacgaggcgata Protospacer
*********** *** ******** * ..**
84. spacer 2.1|4080|32|NC_014656|CRT matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 7, identity: 0.781
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
ttgccgtcggtctcgcccttgacgaggcgata Protospacer
*********** *** ******** * ..**
85. spacer 2.1|4080|32|NC_014656|CRT matches to NZ_CP015322 (Mesorhizobium amorphae CCNWGS0123 plasmid pM0123d, complete sequence) position: , mismatch: 7, identity: 0.781
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
taggcgtcggtgccgaccttgacgccgaggct Protospacer
* * ********.**.************.*.
86. spacer 2.1|4080|32|NC_014656|CRT matches to NZ_CP030764 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.781
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
ttgccgtcggtctcgcccttgacgaggcgata Protospacer
*********** *** ******** * ..**
87. spacer 2.1|4080|32|NC_014656|CRT matches to NZ_CP013509 (Rhizobium sp. N1341 plasmid pRspN1341d, complete sequence) position: , mismatch: 7, identity: 0.781
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
ttgccgtcggtctcgcccttgacgaggcgata Protospacer
*********** *** ******** * ..**
88. spacer 2.1|4080|32|NC_014656|CRT matches to NZ_CP013520 (Rhizobium sp. N113 plasmid pRspN113c, complete sequence) position: , mismatch: 7, identity: 0.781
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
ttgccgtcggtctcgcccttgacgaggcgata Protospacer
*********** *** ******** * ..**
89. spacer 2.1|4080|32|NC_014656|CRT matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 7, identity: 0.781
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
ttgccgtcggtctcgcccttgacgaggcgata Protospacer
*********** *** ******** * ..**
90. spacer 2.1|4080|32|NC_014656|CRT matches to NZ_CP021126 (Rhizobium sp. Kim5 plasmid pRetKim5b, complete sequence) position: , mismatch: 7, identity: 0.781
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
ttgccgtcggtctcgcccttgacgaggcgata Protospacer
*********** *** ******** * ..**
91. spacer 2.1|4080|32|NC_014656|CRT matches to NZ_CP013493 (Rhizobium sp. N6212 plasmid pRspN6212c, complete sequence) position: , mismatch: 7, identity: 0.781
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
ttgccgtcggtctcgcccttgacgaggcgata Protospacer
*********** *** ******** * ..**
92. spacer 2.1|4080|32|NC_014656|CRT matches to NZ_CP013516 (Rhizobium sp. N1314 plasmid pRspN1314e, complete sequence) position: , mismatch: 7, identity: 0.781
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
ttgccgtcggtctcgcccttgacgaggcgata Protospacer
*********** *** ******** * ..**
93. spacer 2.1|4080|32|NC_014656|CRT matches to NZ_CP054023 (Rhizobium sp. JKLM12A2 plasmid pPR12A202, complete sequence) position: , mismatch: 7, identity: 0.781
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
ttgccgtcggtctcgcccttgacgaggcgata Protospacer
*********** *** ******** * ..**
94. spacer 2.1|4080|32|NC_014656|CRT matches to NZ_CP022667 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR2, complete sequence) position: , mismatch: 7, identity: 0.781
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
ttgccgtcggtctcgcccttgacgaggcgata Protospacer
*********** *** ******** * ..**
95. spacer 2.1|4080|32|NC_014656|CRT matches to CP007642 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803a, complete sequence) position: , mismatch: 7, identity: 0.781
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
ttgccgtcggtctcgcccttgacgaggcgata Protospacer
*********** *** ******** * ..**
96. spacer 2.1|4080|32|NC_014656|CRT matches to NC_010998 (Rhizobium etli CIAT 652 plasmid pA, complete sequence) position: , mismatch: 7, identity: 0.781
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
ttgccgtcggtctcgcccttgacgaggcgata Protospacer
*********** *** ******** * ..**
97. spacer 2.1|4080|32|NC_014656|CRT matches to NZ_CP022566 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK02, complete sequence) position: , mismatch: 7, identity: 0.781
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
ttgccgtcggtctcgcccttgacgaggcgata Protospacer
*********** *** ******** * ..**
98. spacer 2.1|4080|32|NC_014656|CRT matches to NZ_CP053208 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1B, complete sequence) position: , mismatch: 7, identity: 0.781
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
ttgccgtcggtctcgcccttgacgaggcgata Protospacer
*********** *** ******** * ..**
99. spacer 2.1|4080|32|NC_014656|CRT matches to NZ_CP050087 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b5, complete sequence) position: , mismatch: 7, identity: 0.781
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
ttgccgtcggtctcgcccttgacgaggcgata Protospacer
*********** *** ******** * ..**
100. spacer 2.2|4141|32|NC_014656|CRT,CRISPRCasFinder matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
gagatagccgacgcactggaatcggccgcagg CRISPR spacer
gcgctgaccgacgcactggaacaggccgcaga Protospacer
* * *..**************. ********.
101. spacer 2.2|4141|32|NC_014656|CRT,CRISPRCasFinder matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
gagatagccgacgcactggaatcggccgcagg CRISPR spacer
gcgctgaccgacgcactggaacaggccgcaga Protospacer
* * *..**************. ********.
102. spacer 3.1|4566|31|NC_014656|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.774
gccggcggcgctggcattccgat-tcactggc CRISPR spacer
gccggcggcgctggcatgcagatcccgcccg- Protospacer
***************** * *** .*.*. *
103. spacer 5.3|421706|27|NC_014656|CRISPRCasFinder matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.741
ggcggtgccgtcggttttcgaatccga CRISPR spacer
cgcggtgccgtcggttttcggcggcac Protospacer
*******************. *.
104. spacer 7.2|2265428|32|NC_014656|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 7, identity: 0.781
atgttcgtgtcgaacgtgccggccggcagggt CRISPR spacer
ctggacatgtcgcacgtgccggccggcaaggg Protospacer
** *.***** ***************.**
105. spacer 7.2|2265428|32|NC_014656|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 7, identity: 0.781
atgttcgtgtcgaacgtgccggccggcagggt CRISPR spacer
ctggacatgtcgcacgtgccggccggcaaggg Protospacer
** *.***** ***************.**
106. spacer 7.2|2265428|32|NC_014656|PILER-CR,CRISPRCasFinder,CRT matches to MK510994 (Pseudomonas phage CF6, partial genome) position: , mismatch: 7, identity: 0.781
atgttcgtgtcgaacgtgccggccggcagggt CRISPR spacer
aagggcgtgtcgagcgtgccggccgtcagtct Protospacer
* * ********.*********** *** *
107. spacer 7.2|2265428|32|NC_014656|PILER-CR,CRISPRCasFinder,CRT matches to MK510995 (Pseudomonas phage CF52, partial genome) position: , mismatch: 7, identity: 0.781
atgttcgtgtcgaacgtgccggccggcagggt CRISPR spacer
aagggcgtgtcgagcgtgccggccgtcagtct Protospacer
* * ********.*********** *** *
108. spacer 7.3|2265489|32|NC_014656|PILER-CR,CRISPRCasFinder,CRT matches to NC_010510 (Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence) position: , mismatch: 7, identity: 0.781
gtgatgggcaggttgccgccggtccaggtgag CRISPR spacer
tcgtcgggcaggctgctgccggtccaggtgat Protospacer
.* .*******.***.**************
109. spacer 7.6|2265672|32|NC_014656|PILER-CR,CRISPRCasFinder,CRT matches to MT521993 (Gordonia phage RedWattleHog, complete genome) position: , mismatch: 7, identity: 0.781
gaccggccatgaagccacgctgcatcctgtgc CRISPR spacer
ccccggccatgaagccgcgctggatcgagtac Protospacer
**************.***** *** **.*
110. spacer 7.6|2265672|32|NC_014656|PILER-CR,CRISPRCasFinder,CRT matches to MN586040 (Gordonia phage Stormageddon, complete genome) position: , mismatch: 7, identity: 0.781
gaccggccatgaagccacgctgcatcctgtgc CRISPR spacer
ccccggccatgaagccgcgctggatcgagtac Protospacer
**************.***** *** **.*
111. spacer 1.1|1856|32|NC_014656|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.75
cactggagttcgtggacatggacgcggccgac CRISPR spacer
tcgccgagttcctggacctggacgcggccgaa Protospacer
. . ****** ***** *************
112. spacer 1.1|1856|32|NC_014656|PILER-CR,CRISPRCasFinder,CRT matches to NC_018583 (Gordonia sp. KTR9 plasmid pGKT3, complete sequence) position: , mismatch: 8, identity: 0.75
cactggagttcgtggacatggacgcggccgac CRISPR spacer
gcctatggctcgtggacatggaccccgccgac Protospacer
**. .*.************** * ******
113. spacer 1.1|1856|32|NC_014656|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP046321 (Gordonia bronchialis strain FDAARGOS_676 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
cactggagttcgtggacatggacgcggccgac CRISPR spacer
gcctatggctcgtggacatggaccccgccgac Protospacer
**. .*.************** * ******
114. spacer 1.1|1856|32|NC_014656|PILER-CR,CRISPRCasFinder,CRT matches to NC_013442 (Gordonia bronchialis DSM 43247 plasmid pGBRO01, complete sequence) position: , mismatch: 8, identity: 0.75
cactggagttcgtggacatggacgcggccgac CRISPR spacer
gcctatggctcgtggacatggaccccgccgac Protospacer
**. .*.************** * ******
115. spacer 1.1|1856|32|NC_014656|PILER-CR,CRISPRCasFinder,CRT matches to MN693691 (Marine virus AFVG_250M1053, complete genome) position: , mismatch: 8, identity: 0.75
----cactggagttcgtggacatggacgcggccgac CRISPR spacer
accccacc----ctcgtggtcatggacgaggccgac Protospacer
***. .****** ******** *******
116. spacer 1.2|1917|32|NC_014656|PILER-CR,CRISPRCasFinder,CRT matches to NC_018840 (Propionibacterium phage P100_1, complete genome) position: , mismatch: 8, identity: 0.75
aacgagccgaacagggagccgatcttacccaa CRISPR spacer
gcagacaccaacagggagcccatattacccaa Protospacer
. ** * *********** ** ********
117. spacer 1.4|2039|32|NC_014656|PILER-CR,CRISPRCasFinder,CRT matches to NC_008545 (Burkholderia cenocepacia HI2424 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
cattcggcaacggcggcaaaatcggcaaatca CRISPR spacer
taatcggcaagggcggcaaactcggcaaggtg Protospacer
.* ******* ********* *******. ..
118. spacer 1.4|2039|32|NC_014656|PILER-CR,CRISPRCasFinder,CRT matches to MK016501 (Mycobacterium phage Nebkiss, complete genome) position: , mismatch: 8, identity: 0.75
cattcggcaacggcggcaaaatcggcaaatca CRISPR spacer
caatcggcaacggcgtcaaaatctacatgccc Protospacer
** ************ ******* .** ..*
119. spacer 1.4|2039|32|NC_014656|PILER-CR,CRISPRCasFinder,CRT matches to NC_026590 (Mycobacterium phage Gaia, complete genome) position: , mismatch: 8, identity: 0.75
cattcggcaacggcggcaaaatcggcaaatca CRISPR spacer
caatcggcaacggcgtcaaaatctacatgccc Protospacer
** ************ ******* .** ..*
120. spacer 1.5|2100|39|NC_014656|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 8, identity: 0.795
gcgaatctggacgcgaagctgcgaggcacgatggagacc CRISPR spacer
tctaatctggacgccaagctgcgcggcacgatgcgttcc Protospacer
* *********** ******** ********* . **
121. spacer 1.7|2229|32|NC_014656|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020040 (Streptomyces sp. 3211 isolate 3 plasmid p3211-1, complete sequence) position: , mismatch: 8, identity: 0.75
acgtggctcccgaggctcgcgtgcatctcaac CRISPR spacer
tcgtggctccggaggttcgcgtgcatggcgcg Protospacer
********* ****.********** *.
122. spacer 2.1|4080|32|NC_014656|CRT matches to MH153804 (Rhodococcus phage Jace, complete genome) position: , mismatch: 8, identity: 0.75
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
ttgccgtcggtgtcggccttgccggaccggcg Protospacer
********************* ** .*..
123. spacer 2.1|4080|32|NC_014656|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
ttcaggtcggtgttgcccttgacgccgacctg Protospacer
** ********.* ************ *.
124. spacer 2.1|4080|32|NC_014656|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
ttcaggtcggtgttgcccttgacgccgacctg Protospacer
** ********.* ************ *.
125. spacer 2.1|4080|32|NC_014656|CRT matches to NZ_CP032520 (Cupriavidus oxalaticus strain T2 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
tggccgtcgatgtcgcccttgacgccacggcc Protospacer
* *******.***** **********. .*.
126. spacer 2.1|4080|32|NC_014656|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.75
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
ttcaggtcggtgttgcccttgacgccgacctg Protospacer
** ********.* ************ *.
127. spacer 2.1|4080|32|NC_014656|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
ttcaggtcggtgttgcccttgacgccgacctg Protospacer
** ********.* ************ *.
128. spacer 2.1|4080|32|NC_014656|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.75
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
ttcaggtcggtgttgcccttgacgccgacctg Protospacer
** ********.* ************ *.
129. spacer 2.1|4080|32|NC_014656|CRT matches to NZ_CP045385 (Ruegeria sp. THAF33 plasmid pTHAF33_a, complete sequence) position: , mismatch: 8, identity: 0.75
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
ttgccttcggtgtcggccttggcgaagtcgcg Protospacer
***** ***************.** * *..
130. spacer 2.1|4080|32|NC_014656|CRT matches to NZ_CP044087 (Pseudomonas luteola strain FDAARGOS_637 plasmid unnamed2) position: , mismatch: 8, identity: 0.75
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
atcgcgtcgatctcggccttgacgccgatgag Protospacer
* *****.* **************** * .
131. spacer 2.1|4080|32|NC_014656|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
tggccgtcgatgtcgcccttgacgccacggcc Protospacer
* *******.***** **********. .*.
132. spacer 2.1|4080|32|NC_014656|CRT matches to MT498037 (Streptomyces phage Dryad, complete genome) position: , mismatch: 8, identity: 0.75
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
ttgccgtcggtgtcggcctcgtcgtccttggg Protospacer
*******************.* **.* * .
133. spacer 2.1|4080|32|NC_014656|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
ttcaggtcggtgttgcccttgacgccgacctg Protospacer
** ********.* ************ *.
134. spacer 2.1|4080|32|NC_014656|CRT matches to NZ_CP050099 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b5, complete sequence) position: , mismatch: 8, identity: 0.75
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
ttgccgtcggtctcgcccttgacaaggcgata Protospacer
*********** *** *******. * ..**
135. spacer 2.1|4080|32|NC_014656|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
ttcaggtcggtgttgcccttgacgccgacctg Protospacer
** ********.* ************ *.
136. spacer 2.1|4080|32|NC_014656|CRT matches to NZ_CP013381 (Burkholderia sp. Bp5365 strain MSMB43 plasmid pMSMB43, complete sequence) position: , mismatch: 8, identity: 0.75
ttgccgtcggtgtcggccttgac-----gccgaagta CRISPR spacer
ttgccgtcggggtcgggcttgacccattgccc----- Protospacer
********** ***** ****** ***
137. spacer 2.1|4080|32|NC_014656|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
ttcaggtcggtgttgcccttgacgccgacctg Protospacer
** ********.* ************ *.
138. spacer 2.1|4080|32|NC_014656|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
ttcaggtcggtgttgcccttgacgccgacctg Protospacer
** ********.* ************ *.
139. spacer 2.1|4080|32|NC_014656|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
ttcaggtcggtgttgcccttgacgccgacctg Protospacer
** ********.* ************ *.
140. spacer 2.1|4080|32|NC_014656|CRT matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
ttgccgtcggtgtcggccttgacgccgaagta---- CRISPR spacer
ttgccgttggtgtcgtccttgac----cagttcggt Protospacer
*******.******* ******* ***
141. spacer 2.1|4080|32|NC_014656|CRT matches to NC_015178 (Acidiphilium multivorum AIU301 plasmid pACMV1, complete sequence) position: , mismatch: 8, identity: 0.75
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
acaccgtcggtgccggccttgatgcccgggta Protospacer
..*********.*********.*** ..***
142. spacer 2.1|4080|32|NC_014656|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
ttcaggtcggtgttgcccttgacgccgacctg Protospacer
** ********.* ************ *.
143. spacer 2.1|4080|32|NC_014656|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
ttcaggtcggtgttgcccttgacgccgacctg Protospacer
** ********.* ************ *.
144. spacer 2.1|4080|32|NC_014656|CRT matches to NZ_CP014797 (Salipiger profundus strain JLT2016 plasmid pTPRO1, complete sequence) position: , mismatch: 8, identity: 0.75
-ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
atcagcacc-gtgtcgaccttgccgccgaagta Protospacer
*.. *..* ******.***** **********
145. spacer 2.1|4080|32|NC_014656|CRT matches to NZ_CP009547 (Burkholderia sp. 2002721687 plasmid pBTU, complete sequence) position: , mismatch: 8, identity: 0.75
ttgccgtcggtgtcggccttgac-----gccgaagta CRISPR spacer
ttgccgtcggggtcgggcttgacccattgccc----- Protospacer
********** ***** ****** ***
146. spacer 2.2|4141|32|NC_014656|CRT,CRISPRCasFinder matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 8, identity: 0.75
gagatagccgacgcactggaatcggccgcagg CRISPR spacer
aagatggccggcgcactggaatcggctcaccg Protospacer
.****.****.***************. *
147. spacer 7.3|2265489|32|NC_014656|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012477 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
gtgatgggcaggttgccgccggtccaggtgag CRISPR spacer
gcgaactgcaggttgccgatggtccaggtgta Protospacer
*.** *********** .********** .
148. spacer 7.4|2265550|32|NC_014656|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 8, identity: 0.75
tccacgttgtcgatgacaccggtcatgcaggc CRISPR spacer
tggccgttgtcgatgacgccgggcatggaaac Protospacer
* *************.**** **** *..*
149. spacer 7.4|2265550|32|NC_014656|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 8, identity: 0.75
tccacgttgtcgatgacaccggtcatgcaggc CRISPR spacer
tggccgttgtcgatgacgccgggcatggaaac Protospacer
* *************.**** **** *..*
150. spacer 1.1|1856|32|NC_014656|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.719
cactggagttcgtggacatggacgcggccgac CRISPR spacer
agacgacattcgtggacatggaccctgccgac Protospacer
. .*. .*************** * ******
151. spacer 1.1|1856|32|NC_014656|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020539 (Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence) position: , mismatch: 9, identity: 0.719
cactggagttcgtggacatggacgcggccgac CRISPR spacer
tcgcgatgatcgaggacatggaggcggccgac Protospacer
. .*. * *** ********* *********
152. spacer 1.1|1856|32|NC_014656|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026654 (Streptomyces dengpaensis strain XZHG99 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
cactggagttcgtggacatggacgcggccgac CRISPR spacer
cgaacaaggtcgtcgacatggacgcggccagc Protospacer
*. .** **** ***************..*
153. spacer 1.2|1917|32|NC_014656|PILER-CR,CRISPRCasFinder,CRT matches to LR134122 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2) position: , mismatch: 9, identity: 0.719
aacgagccgaacagggagccgatcttacccaa CRISPR spacer
aacgatccgaactgggagccgattgcgctctc Protospacer
***** ****** **********. ..*.*
154. spacer 1.4|2039|32|NC_014656|PILER-CR,CRISPRCasFinder,CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 9, identity: 0.719
cattcggcaacggcggcaaaatcggcaaatca CRISPR spacer
gcggcggcagcggcggcaaaatcggcacggta Protospacer
*****.***************** . .*
155. spacer 1.4|2039|32|NC_014656|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030829 (Neorhizobium sp. NCHU2750 plasmid pNCHU2750b, complete sequence) position: , mismatch: 9, identity: 0.719
cattcggcaacggcggcaaaatcggcaaatca CRISPR spacer
gcttcggcaccggcggcaaaagcggcagtctc Protospacer
******* *********** *****. ..
156. spacer 1.4|2039|32|NC_014656|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009292 (Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence) position: , mismatch: 9, identity: 0.719
cattcggcaacggcggcaaaatcggcaaatca CRISPR spacer
gatgcggcaatggcggcaaaatcgaatacgcc Protospacer
** ******.*************. * *
157. spacer 1.10|2412|32|NC_014656|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP014580 (Burkholderia sp. RPE67 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.719
ggcgacaagcaacggatagtgcctatatcgga CRISPR spacer
ggcgacaagcaacggctcgtgccggccacgcg Protospacer
*************** * ***** .. ** .
158. spacer 1.12|2534|31|NC_014656|CRISPRCasFinder,CRT matches to NZ_HG938356 (Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence) position: , mismatch: 9, identity: 0.71
gaaatcagcgacttcctctcgctggcaacaa CRISPR spacer
gaaatcaacgacttcctttcgcttttcattg Protospacer
*******.*********.***** . *. .
159. spacer 2.1|4080|32|NC_014656|CRT matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 9, identity: 0.719
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
ccagcgccggtgtcggccttgccgccgccgga Protospacer
... **.************** ***** * *
160. spacer 2.1|4080|32|NC_014656|CRT matches to MN234223 (Mycobacterium phage Philly, complete genome) position: , mismatch: 9, identity: 0.719
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
gcctcgtcggtgttggccttgacgacgatctc Protospacer
. .*********.********** *** *
161. spacer 2.1|4080|32|NC_014656|CRT matches to KP027207 (Mycobacterium phage Chandler, complete genome) position: , mismatch: 9, identity: 0.719
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
gcctcgtcggtgttggccttgacgacgatctc Protospacer
. .*********.********** *** *
162. spacer 2.1|4080|32|NC_014656|CRT matches to MN096360 (Mycobacterium phage Rita1961, complete genome) position: , mismatch: 9, identity: 0.719
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
gcctcgtcggtgttggccttgacgacgatctc Protospacer
. .*********.********** *** *
163. spacer 2.1|4080|32|NC_014656|CRT matches to MN096360 (Mycobacterium phage Rita1961, complete genome) position: , mismatch: 9, identity: 0.719
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
ccgttgtcggtgtcgggcttcacgccgacgat Protospacer
..*..*********** *** ******* *
164. spacer 2.1|4080|32|NC_014656|CRT matches to MG839014 (Mycobacterium phage RagingRooster, complete genome) position: , mismatch: 9, identity: 0.719
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
gcctcgtcggtgttggccttgacgacgatctc Protospacer
. .*********.********** *** *
165. spacer 2.1|4080|32|NC_014656|CRT matches to KJ194581 (Mycobacterium phage Audrey, complete genome) position: , mismatch: 9, identity: 0.719
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
gcctcgtcggtgttggccttgacgacgatctc Protospacer
. .*********.********** *** *
166. spacer 2.1|4080|32|NC_014656|CRT matches to MK376963 (Microbacterium phage Alleb, complete genome) position: , mismatch: 9, identity: 0.719
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
gcccagtcggtgtcgagcttgacgccgaacgc Protospacer
. * **********. ************
167. spacer 2.1|4080|32|NC_014656|CRT matches to KR080203 (Mycobacterium phage OrangeOswald, complete genome) position: , mismatch: 9, identity: 0.719
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
gcctcgtcggtgttggccttgacgacgatctc Protospacer
. .*********.********** *** *
168. spacer 2.1|4080|32|NC_014656|CRT matches to MH513976 (Mycobacterium phage Morty007, complete genome) position: , mismatch: 9, identity: 0.719
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
gcctcgtcggtgttggccttgacgacgatctc Protospacer
. .*********.********** *** *
169. spacer 2.1|4080|32|NC_014656|CRT matches to MH051265 (Mycobacterium phage Yahalom, complete genome) position: , mismatch: 9, identity: 0.719
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
gcctcgtcggtgttggccttgacgacgatctc Protospacer
. .*********.********** *** *
170. spacer 2.1|4080|32|NC_014656|CRT matches to MH316565 (Mycobacterium phage Mortcellus, complete genome) position: , mismatch: 9, identity: 0.719
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
gcctcgtcggtgttggccttgacgacgatctc Protospacer
. .*********.********** *** *
171. spacer 2.1|4080|32|NC_014656|CRT matches to MT310871 (Mycobacterium phage Jackstina, complete genome) position: , mismatch: 9, identity: 0.719
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
gcctcgtcggtgttggccttgacgacgatctc Protospacer
. .*********.********** *** *
172. spacer 2.1|4080|32|NC_014656|CRT matches to MK359357 (Mycobacterium phage RomaT, complete genome) position: , mismatch: 9, identity: 0.719
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
gcctcgtcggtgttggccttgacgacgatctc Protospacer
. .*********.********** *** *
173. spacer 2.1|4080|32|NC_014656|CRT matches to JF704095 (Mycobacterium phage Daisy, complete sequence) position: , mismatch: 9, identity: 0.719
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
gcctcgtcggtgttggccttgacgacgatctc Protospacer
. .*********.********** *** *
174. spacer 2.1|4080|32|NC_014656|CRT matches to JF704095 (Mycobacterium phage Daisy, complete sequence) position: , mismatch: 9, identity: 0.719
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
ccgttgtcggtgtcgggcttcacgccgacgat Protospacer
..*..*********** *** ******* *
175. spacer 2.1|4080|32|NC_014656|CRT matches to EU816589 (Mycobacterium phage Phaedrus, complete genome) position: , mismatch: 9, identity: 0.719
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
gcctcgtcggtgttggccttgacgacgatctc Protospacer
. .*********.********** *** *
176. spacer 2.1|4080|32|NC_014656|CRT matches to MN096359 (Mycobacterium phage Obutu, complete genome) position: , mismatch: 9, identity: 0.719
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
gcctcgtcggtgttggccttgacgacgatctc Protospacer
. .*********.********** *** *
177. spacer 2.1|4080|32|NC_014656|CRT matches to MK061414 (Mycobacterium phage Marley1013, complete genome) position: , mismatch: 9, identity: 0.719
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
gcctcgtcggtgttggccttgacgacgatctc Protospacer
. .*********.********** *** *
178. spacer 2.1|4080|32|NC_014656|CRT matches to MT952851 (Mycobacterium phage Gervas, complete genome) position: , mismatch: 9, identity: 0.719
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
gcctcgtcggtgttggccttgacgacgatctc Protospacer
. .*********.********** *** *
179. spacer 2.1|4080|32|NC_014656|CRT matches to MF417932 (Uncultured Caudovirales phage clone 3S_12, partial genome) position: , mismatch: 9, identity: 0.719
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
acggcgtcgatgtcggccttcacgccgatcag Protospacer
.* *****.********** ******* .
180. spacer 2.1|4080|32|NC_014656|CRT matches to MG925353 (Mycobacterium phage Nozo, complete genome) position: , mismatch: 9, identity: 0.719
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
gcctcgtcggtgttggccttgacgacgatctc Protospacer
. .*********.********** *** *
181. spacer 2.1|4080|32|NC_014656|CRT matches to KJ194584 (Mycobacterium phage Heathcliff, complete genome) position: , mismatch: 9, identity: 0.719
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
gcctcgtcggtgttggccttgacgacgatctc Protospacer
. .*********.********** *** *
182. spacer 2.1|4080|32|NC_014656|CRT matches to MN444872 (Mycobacterium phage SynergyX, complete genome) position: , mismatch: 9, identity: 0.719
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
gcctcgtcggtgttggccttgacgacgatctc Protospacer
. .*********.********** *** *
183. spacer 2.1|4080|32|NC_014656|CRT matches to MH576977 (Mycobacterium phage Tydolla, complete genome) position: , mismatch: 9, identity: 0.719
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
gcctcgtcggtgttggccttgacgacgatctc Protospacer
. .*********.********** *** *
184. spacer 2.1|4080|32|NC_014656|CRT matches to MG925338 (Mycobacterium phage ChaChing, complete genome) position: , mismatch: 9, identity: 0.719
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
gcctcgtcggtgttggccttgacgacgatctc Protospacer
. .*********.********** *** *
185. spacer 2.1|4080|32|NC_014656|CRT matches to NC_023742 (Mycobacterium phage Akoma, complete genome) position: , mismatch: 9, identity: 0.719
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
gcctcgtcggtgttggccttgacgacgatctc Protospacer
. .*********.********** *** *
186. spacer 2.1|4080|32|NC_014656|CRT matches to MG920059 (Mycobacterium phage Baloo, complete genome) position: , mismatch: 9, identity: 0.719
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
gcctcgtcggtgttggccttgacgacgatctc Protospacer
. .*********.********** *** *
187. spacer 2.1|4080|32|NC_014656|CRT matches to NC_023686 (Mycobacterium phage Gadjet, complete genome) position: , mismatch: 9, identity: 0.719
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
gcctcgtcggtgttggccttgacgacgatctc Protospacer
. .*********.********** *** *
188. spacer 2.1|4080|32|NC_014656|CRT matches to NC_023686 (Mycobacterium phage Gadjet, complete genome) position: , mismatch: 9, identity: 0.719
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
ccgttgtcggtgtcgggcttcacgccgacgat Protospacer
..*..*********** *** ******* *
189. spacer 2.1|4080|32|NC_014656|CRT matches to KR080205 (Mycobacterium phage Corofin, complete genome) position: , mismatch: 9, identity: 0.719
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
gcctcgtcggtgttggccttgacgacgatctc Protospacer
. .*********.********** *** *
190. spacer 2.1|4080|32|NC_014656|CRT matches to NC_041965 (Mycobacterium phage Athena, complete genome) position: , mismatch: 9, identity: 0.719
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
gcctcgtcggtgttggccttgacgacgatctc Protospacer
. .*********.********** *** *
191. spacer 2.1|4080|32|NC_014656|CRT matches to DQ398049 (Mycobacterium phage Pipefish, complete genome) position: , mismatch: 9, identity: 0.719
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
gcctcgtcggtgttggccttgacgacgatctc Protospacer
. .*********.********** *** *
192. spacer 2.1|4080|32|NC_014656|CRT matches to MT310892 (Mycobacterium phage Compostia, complete genome) position: , mismatch: 9, identity: 0.719
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
gcctcgtcggtgttggccttgacgacgatctc Protospacer
. .*********.********** *** *
193. spacer 2.1|4080|32|NC_014656|CRT matches to JN699018 (Mycobacterium phage Kamiyu, complete genome) position: , mismatch: 9, identity: 0.719
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
gcctcgtcggtgttggccttgacgacgatctc Protospacer
. .*********.********** *** *
194. spacer 2.1|4080|32|NC_014656|CRT matches to NC_012027 (Mycobacterium phage Phlyer, complete genome) position: , mismatch: 9, identity: 0.719
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
gcctcgtcggtgttggccttgacgacgatctc Protospacer
. .*********.********** *** *
195. spacer 2.1|4080|32|NC_014656|CRT matches to MN444873 (Mycobacterium phage Abinghost, complete genome) position: , mismatch: 9, identity: 0.719
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
gcctcgtcggtgttggccttgacgacgatctc Protospacer
. .*********.********** *** *
196. spacer 2.1|4080|32|NC_014656|CRT matches to NC_008712 (Paenarthrobacter aurescens TC1 plasmid pTC1, complete sequence) position: , mismatch: 9, identity: 0.719
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
gaggcgccgatgtcggccttgacgccgcggcc Protospacer
* **.**.***************** .*.
197. spacer 2.1|4080|32|NC_014656|CRT matches to NZ_LN831788 (Streptomyces leeuwenhoekii strain type strain (C34 = DSM 42122 = NRRL B-24963) plasmid pSLE1, complete sequence) position: , mismatch: 9, identity: 0.719
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
gtgccgtcggtgtacgccttgacgtggtcgac Protospacer
************ *********. * *
198. spacer 2.1|4080|32|NC_014656|CRT matches to NZ_CP028919 (Gemmobacter sp. HYN0069 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
tggccgtcggtgtcggcctcgccgcggtgacc Protospacer
* *****************.* *** * ...
199. spacer 2.1|4080|32|NC_014656|CRT matches to NZ_CP020811 (Mycobacterium dioxanotrophicus strain PH-06 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
aggtggccggtgtcggcttcgacgccgaagat Protospacer
*. *.**********.*.**********
200. spacer 2.1|4080|32|NC_014656|CRT matches to NZ_CP020811 (Mycobacterium dioxanotrophicus strain PH-06 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
aggtggccggtgtcggcttcgacgccgaagat Protospacer
*. *.**********.*.**********
201. spacer 2.1|4080|32|NC_014656|CRT matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
ccagcgccggtgtcggccttgccgccgccgga Protospacer
... **.************** ***** * *
202. spacer 2.1|4080|32|NC_014656|CRT matches to NZ_CP023976 (Streptomyces alboflavus strain MDJK44 plasmid pMDJK44.1, complete sequence) position: , mismatch: 9, identity: 0.719
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
tccgtctgggcgtcggccttgacgccgatgtg Protospacer
*. . * **.***************** **.
203. spacer 2.1|4080|32|NC_014656|CRT matches to KF493879 (Mycobacterium phage Bernardo, complete genome) position: , mismatch: 9, identity: 0.719
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
ccgttgtcggtgtcgggcttcacgccgacgat Protospacer
..*..*********** *** ******* *
204. spacer 7.1|2265367|32|NC_014656|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 9, identity: 0.719
gacaaggtaggcaaggcgtcggttgctgccgg CRISPR spacer
tcgatcggcggcaaggcgtcgatggctgccgg Protospacer
* * ************.* ********
205. spacer 7.2|2265428|32|NC_014656|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR134455 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 13, complete sequence) position: , mismatch: 9, identity: 0.719
atgttcgtgtcgaacgtgccggccggcagggt CRISPR spacer
tcgatcgtgtcgatcgagccggccggcgacgc Protospacer
.* ********* ** **********.. *.
206. spacer 7.2|2265428|32|NC_014656|PILER-CR,CRISPRCasFinder,CRT matches to KY385384 (Mycobacterium phage SimranZ1, complete genome) position: , mismatch: 9, identity: 0.719
atgttcgtgtcgaacgtgccggccggcagggt CRISPR spacer
gcgcttctggcgaacgtgccggccggccggta Protospacer
..*.*. ** ***************** **
207. spacer 7.3|2265489|32|NC_014656|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP011665 (Streptomyces sp. Mg1 plasmid pSMg1-1, complete sequence) position: , mismatch: 9, identity: 0.719
gtgatgggcaggttgccgccggtccaggtgag CRISPR spacer
atgacgggcaggtcgccgccggtcgcgggagc Protospacer
.***.********.********** ** ..
208. spacer 1.1|1856|32|NC_014656|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
cactggagttcgtggacatggacgcggccgac CRISPR spacer
agggcgagatcgtcgacatggacgcggcgcgc Protospacer
. *** **** ************** .*
209. spacer 1.1|1856|32|NC_014656|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021083 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI2, complete sequence) position: , mismatch: 10, identity: 0.688
cactggagttcgtggacatggacgcggccgac CRISPR spacer
gggaggacttcgtggacatggtcgcggaggtg Protospacer
. *** ************* ***** *
210. spacer 1.4|2039|32|NC_014656|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
cattcggcaacggcggcaaaatcggcaaatca CRISPR spacer
atggcggcaacggcggcaacagcggcaatggc Protospacer
*************** * ******
211. spacer 1.4|2039|32|NC_014656|PILER-CR,CRISPRCasFinder,CRT matches to KU998238 (Gordonia phage Splinter, complete genome) position: , mismatch: 10, identity: 0.688
cattcggcaacggcggcaaaatcggcaaatca CRISPR spacer
gcggcggcaacggcggcaacttcggcaacggc Protospacer
*************** *******
212. spacer 1.4|2039|32|NC_014656|PILER-CR,CRISPRCasFinder,CRT matches to NC_030911 (Gordonia phage Vendetta, complete genome) position: , mismatch: 10, identity: 0.688
cattcggcaacggcggcaaaatcggcaaatca CRISPR spacer
gcggcggcaacggcggcaacttcggcaacggc Protospacer
*************** *******
213. spacer 1.4|2039|32|NC_014656|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 10, identity: 0.688
cattcggcaacggcggcaaaatcggcaaatca CRISPR spacer
tcggcggcatcggcggcaaagtcggcaccgcc Protospacer
. ***** **********.****** *
214. spacer 1.7|2229|32|NC_014656|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024940 (Paraburkholderia hospita strain mHSR1 plasmid pmHSR1_P, complete sequence) position: , mismatch: 10, identity: 0.688
acgtggctcccgaggctcgcgtgcatctcaac CRISPR spacer
ttcgggctcccgaggctcgcgtccatcgtgga Protospacer
. ****************** **** ...
215. spacer 2.1|4080|32|NC_014656|CRT matches to NC_012854 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132505, complete sequence) position: , mismatch: 10, identity: 0.688
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
aaaaagacggtgtcggcctgaacgccgaagac Protospacer
. * ************ .*********
216. spacer 2.1|4080|32|NC_014656|CRT matches to NZ_CP018232 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed4, complete sequence) position: , mismatch: 10, identity: 0.688
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
aaaaagacggtgtcggcctgaacgccgaagac Protospacer
. * ************ .*********
217. spacer 2.1|4080|32|NC_014656|CRT matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 10, identity: 0.688
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
cagccgtcggtctcggccttgatgcgggccac Protospacer
. ********* **********.** *.
218. spacer 2.1|4080|32|NC_014656|CRT matches to NZ_CP012886 (Mycobacterium chimaera strain AH16 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
tgcgcgccggtgtcgaccttgacgccgggcag Protospacer
* **.********.***********.. .
219. spacer 2.1|4080|32|NC_014656|CRT matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 10, identity: 0.688
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
agaaagacggcgtcggccttaacgccgaagac Protospacer
. * ***.*********.*********
220. spacer 2.1|4080|32|NC_014656|CRT matches to CP003954 (Rhodococcus opacus PD630 plasmid 5, complete sequence) position: , mismatch: 10, identity: 0.688
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
atgtcgtcggggtcggccttgacggccggcag Protospacer
**.****** ************* * .. .
221. spacer 2.1|4080|32|NC_014656|CRT matches to NZ_CP034185 (Deinococcus sp. S14-83 strain S14-83T plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
tcctcgttggtgtaggccttgacgccgtgtcc Protospacer
*. .***.***** ************* . .
222. spacer 2.1|4080|32|NC_014656|CRT matches to MH271310 (Microbacterium phage Pioneer3, complete genome) position: , mismatch: 10, identity: 0.688
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
gcccaatcggtgtcgagcttgacgccgaacgc Protospacer
. * .*********. ************
223. spacer 2.1|4080|32|NC_014656|CRT matches to MH271307 (Microbacterium phage OlinDD, complete genome) position: , mismatch: 10, identity: 0.688
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
gcccaatcggtgtcgagcttgacgccgaacgc Protospacer
. * .*********. ************
224. spacer 2.1|4080|32|NC_014656|CRT matches to KU984979 (Propionibacterium phage PFR1, complete genome) position: , mismatch: 10, identity: 0.688
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
gcgtcgtcggtgtcggccttgtcggcgggcac Protospacer
.*.***************** ** **..
225. spacer 2.1|4080|32|NC_014656|CRT matches to NC_031108 (Propionibacterium phage PFR2, complete genome) position: , mismatch: 10, identity: 0.688
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
gcgtcgtcggtgtcggccttgtcggcgggcac Protospacer
.*.***************** ** **..
226. spacer 2.1|4080|32|NC_014656|CRT matches to MK814759 (Gordonia phage Reyja, complete genome) position: , mismatch: 10, identity: 0.688
ttgccgtcggtgtcggccttgacgccgaagta CRISPR spacer
ccgtcgtcggggccggccttgacgccggcaag Protospacer
..*.****** *.**************. . .
227. spacer 7.3|2265489|32|NC_014656|PILER-CR,CRISPRCasFinder,CRT matches to MN234216 (Streptomyces phage Gilgamesh, complete genome) position: , mismatch: 10, identity: 0.688
gtgatgggcaggttgccgccggtccaggtgag CRISPR spacer
ttgacgggcaggttgccgtcggtcggctcgtc Protospacer
***.*************.***** . .*
228. spacer 1.6|2168|32|NC_014656|PILER-CR,CRISPRCasFinder,CRT matches to NZ_HG938356 (Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence) position: , mismatch: 11, identity: 0.656
gaaaagctctggaacgtggagttgctgccgta CRISPR spacer
ttgccgctctggaacgtggcgtcgctgcgcag Protospacer
. ************** **.***** .
229. spacer 2.2|4141|32|NC_014656|CRT,CRISPRCasFinder matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.656
gagatagccgacgcactggaatcggccgcagg CRISPR spacer
tcctctgccgacgcactggcctcggccgcgaa Protospacer
. ************* ********...
230. spacer 2.2|4141|32|NC_014656|CRT,CRISPRCasFinder matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 11, identity: 0.656
gagatagccgacgcactggaatcggccgcagg CRISPR spacer
tcctctgccgacgcactggcctcggccgcgaa Protospacer
. ************* ********...
231. spacer 2.2|4141|32|NC_014656|CRT,CRISPRCasFinder matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.656
gagatagccgacgcactggaatcggccgcagg CRISPR spacer
tcctctgccgacgcactggcctcggccgcgaa Protospacer
. ************* ********...
232. spacer 2.2|4141|32|NC_014656|CRT,CRISPRCasFinder matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.656
gagatagccgacgcactggaatcggccgcagg CRISPR spacer
tcctctgccgacgcactggcctcggccgcgaa Protospacer
. ************* ********...
233. spacer 2.2|4141|32|NC_014656|CRT,CRISPRCasFinder matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.656
gagatagccgacgcactggaatcggccgcagg CRISPR spacer
tcctctgccgacgcactggcctcggccgcgaa Protospacer
. ************* ********...
234. spacer 7.3|2265489|32|NC_014656|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032327 (Azospirillum brasilense strain MTCC4035 plasmid p6, complete sequence) position: , mismatch: 11, identity: 0.656
gtgatgggcaggttgccgccggtccaggtgag CRISPR spacer
ccatcgggcaggttgccgccgcgccagggcgc Protospacer
.. .**************** ***** .
235. spacer 7.3|2265489|32|NC_014656|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP007798 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p5, complete sequence) position: , mismatch: 11, identity: 0.656
gtgatgggcaggttgccgccggtccaggtgag CRISPR spacer
ccatcgggcaggttgccgccgcgccagggcgc Protospacer
.. .**************** ***** .
