Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_017546 Listeria monocytogenes FSL R2-561, complete sequence 4 crisprs DinG,cas3,WYL,casR,DEDDh,csa3 0 1 6 0

Results visualization

1. NC_017546
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017546_1 210230-210381 Unclear NA
1 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017546_2 497506-498090 Orphan NA
7 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017546_3 543052-543340 Orphan I-A
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017546_4 2808907-2809017 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_017546_3 3.3|543211|35|NC_017546|PILER-CR,CRISPRCasFinder,CRT 543211-543245 35 MH341453 Listeria phage PSU-VKH-LP041, complete genome 10139-10173 1 0.971
NC_017546_3 3.3|543211|35|NC_017546|PILER-CR,CRISPRCasFinder,CRT 543211-543245 35 NC_009813 Listeria phage B054, complete genome 10139-10173 2 0.943

1. spacer 3.3|543211|35|NC_017546|PILER-CR,CRISPRCasFinder,CRT matches to MH341453 (Listeria phage PSU-VKH-LP041, complete genome) position: , mismatch: 1, identity: 0.971

gcgatttttgtcaaagggacagcgatgggttacaa	CRISPR spacer
gcgatttttgtcaaaggaacagcgatgggttacaa	Protospacer
*****************.*****************

2. spacer 3.3|543211|35|NC_017546|PILER-CR,CRISPRCasFinder,CRT matches to NC_009813 (Listeria phage B054, complete genome) position: , mismatch: 2, identity: 0.943

gcgatttttgtcaaagggacagcgatgggttacaa	CRISPR spacer
gcgatttttgtcaaaggaacggcgatgggttacaa	Protospacer
*****************.**.**************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 120588 : 127113 10 Listeria_phage(33.33%) tail NA
DBSCAN-SWA_2 1122790 : 1130213 8 Hokovirus(33.33%) NA NA
DBSCAN-SWA_3 1244264 : 1324823 97 Listeria_phage(79.31%) integrase,terminase,capsid,tRNA,tail,protease,portal,holin attL 1244147:1244163|attR 1287121:1287137
DBSCAN-SWA_4 1858426 : 1866712 8 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_5 2381600 : 2420829 52 Listeria_phage(95.35%) holin,terminase,tail NA
DBSCAN-SWA_6 2564990 : 2572834 7 Streptococcus_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage