1. spacer 1.1|385222|27|NC_014973|CRISPRCasFinder matches to NZ_CP022669 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR4, complete sequence) position: , mismatch: 4, identity: 0.852
gagggttgaggttgagaaatgcctctt CRISPR spacer
gggttttgaggttgagaattgcctctt Protospacer
*.* ************* ********
2. spacer 1.1|385222|27|NC_014973|CRISPRCasFinder matches to NZ_CP025015 (Rhizobium leguminosarum strain Norway plasmid pRLN3, complete sequence) position: , mismatch: 4, identity: 0.852
gagggttgaggttgagaaatgcctctt CRISPR spacer
gggttttgaggttgagaattgcctctt Protospacer
*.* ************* ********
3. spacer 1.1|385222|27|NC_014973|CRISPRCasFinder matches to NZ_CP054030 (Rhizobium sp. JKLM19E plasmid pPR19E03) position: , mismatch: 4, identity: 0.852
gagggttgaggttgagaaatgcctctt CRISPR spacer
gggcgttgaggctgagaattgcctctt Protospacer
*.* *******.****** ********
4. spacer 1.1|385222|27|NC_014973|CRISPRCasFinder matches to NZ_CP014581 (Burkholderia sp. OLGA172 plasmid pOLGA2, complete sequence) position: , mismatch: 5, identity: 0.815
gagggttgaggttgagaaatgcctctt CRISPR spacer
cggtgttgagcttgagaagtgcctctt Protospacer
.* ****** *******.********
5. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP015204 (Rhodococcus sp. 008 plasmid pR8C1, complete sequence) position: , mismatch: 5, identity: 0.839
cgccg-cgccgggcgctgcaggcaatcaccag CRISPR spacer
-gccaccgccgggcgctgcaggcgatcgccgg Protospacer
***. *****************.***.**.*
6. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP042916 (Rhodococcus qingshengii strain RL1 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.839
cgccg-cgccgggcgctgcaggcaatcaccag CRISPR spacer
-gccaccgccgggcgctgcaggcgatcgccgg Protospacer
***. *****************.***.**.*
7. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP042916 (Rhodococcus qingshengii strain RL1 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.839
cgccg-cgccgggcgctgcaggcaatcaccag CRISPR spacer
-gccaccgccgggcgctgcaggcgatcgccgg Protospacer
***. *****************.***.**.*
8. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP042916 (Rhodococcus qingshengii strain RL1 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.839
cgccg-cgccgggcgctgcaggcaatcaccag CRISPR spacer
-gccaccgccgggcgctgcaggcgatcgccgg Protospacer
***. *****************.***.**.*
9. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NC_007486 (Rhodococcus erythropolis PR4 plasmid pREC1, complete sequence) position: , mismatch: 5, identity: 0.839
cgccg-cgccgggcgctgcaggcaatcaccag CRISPR spacer
-gccaccgccgggcgctgcaggcgatcgccgg Protospacer
***. *****************.***.**.*
10. spacer 3.1|1413285|30|NC_014973|CRISPRCasFinder matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 6, identity: 0.8
catgccgcgcggcgttgagcgtcccggcac CRISPR spacer
cttgccgcggggcgttgagcttcccgcttc Protospacer
* ******* ********** ***** . *
11. spacer 3.1|1413285|30|NC_014973|CRISPRCasFinder matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 6, identity: 0.8
catgccgcgcggcgttgagcgtcccggcac CRISPR spacer
cttgccgcggggcgttgagcttcccgcttc Protospacer
* ******* ********** ***** . *
12. spacer 3.1|1413285|30|NC_014973|CRISPRCasFinder matches to NZ_CP023000 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence) position: , mismatch: 6, identity: 0.8
catgccgcgcggcgttgagcgtcccggcac CRISPR spacer
cctgtcgcgcggcgttgagcgtcgtcgcat Protospacer
* **.****************** . ***.
13. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP015006 (Aminobacter aminovorans strain KCTC 2477 plasmid pAA01, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
cagcgcgccgggcgctgcgggcaatcgcctc Protospacer
*. ***************.*******.**
14. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_KX276657 (Escherichia coli strain MRSN388634 plasmid pMR0516mcr, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
15. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_KR653209 (Escherichia coli strain GDZ13 plasmid pGD0503Z13, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
16. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_KT002541 (Escherichia coli strain HeB7 plasmid pHeBE7, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
17. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP043952 (Escherichia coli strain ST95-32 plasmid pST95-32-2, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
18. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP010141 (Escherichia coli strain D3 plasmid A, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
19. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NC_025106 (Escherichia coli strain NMI5428/11 plasmid pMC-NDM, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
20. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP020546 (Escherichia coli strain ZJ3920 plasmid pZJ3920-1, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
21. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to CP043737 (Escherichia coli strain CVM N17EC0616 plasmid pN17EC0616-1, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
22. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP010316 (Escherichia coli strain 789 plasmid pAPEC-O78-ColV) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
23. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP053725 (Escherichia coli strain CP66-6_Sichuan plasmid pCP66-6-IncFII, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
24. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP019282 (Escherichia coli strain 13P484A plasmid p13P484A-2, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
25. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP019251 (Escherichia coli strain 13KWH46 plasmid p13KWH46-1, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
26. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP021728 (Escherichia coli strain Combat11I9 plasmid pCombat11I9-2, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
27. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to MN158992 (Escherichia coli strain TREC9 plasmid pTREC9, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
28. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP054942 (Escherichia coli strain MS6192 plasmid pMS6192B, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
29. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP024287 (Escherichia albertii strain 2014C-4356 plasmid unnamed5, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
30. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP026854 (Escherichia coli strain MS7163 plasmid pMS7163A, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
31. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP019247 (Escherichia coli strain Combat13F7 plasmid pCombat13F7-2, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
32. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP019268 (Escherichia coli strain 13C1079T plasmid p13C1079T-1, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
33. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to CP042642 (Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-4_MCR3, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
34. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to MN061455 (Escherichia coli strain EC-15-3 plasmid pEC-15-3-NDM-1, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
35. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP041414 (Escherichia coli strain STEC719 plasmid pSTEC719_3, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
36. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP041415 (Escherichia coli strain STEC719 plasmid pSTEC719_4, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
37. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP024617 (Escherichia coli strain SMN152SH1 plasmid pO177A1, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
38. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP032263 (Escherichia coli strain AR_0089 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
39. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to MN158991 (Escherichia coli strain TREC8 plasmid pTREC8, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
40. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP044347 (Escherichia coli strain P225M plasmid pP225M-CTX-M-55, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
41. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP044348 (Escherichia coli strain P225M plasmid pP225M-2, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
42. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP027357 (Escherichia coli strain 2013C-4991 plasmid unnamed2) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
43. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP039562 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014847 plasmid p08-5333.1, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
44. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP019007 (Escherichia coli strain Ecol_AZ159 plasmid pECAZ159_1, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
45. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to KU318420 (Klebsiella pneumoniae strain KP04 plasmid pKP04CTXM, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
46. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP034254 (Escherichia coli strain IVRI Kol CP4 plasmid p1ESCUMpO83_CORR) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
47. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to KY463220 (Escherichia coli plasmid pNDM5-IBAC, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
48. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP026201 (Escherichia coli strain ECONIH6 plasmid pNDM-d2e9, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
49. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP022731 (Escherichia coli strain SA186 plasmid pSA186_2, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
50. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NC_004998 (Escherichia coli plasmid p1658/97, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
51. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_LT985319 (Escherichia coli strain ECOR 30 genome assembly, plasmid: RCS96_pII) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
52. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NC_025179 (Escherichia coli plasmid pC59-153, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
53. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to CP042897 (Escherichia coli strain CFSAN061771 plasmid pCFSAN061771_01, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
54. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_AP018147 (Escherichia coli strain M217 isolate M217 plasmid pM217_FII, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
55. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP048372 (Escherichia coli strain 164 plasmid pC-F-163_A, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
56. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP051729 (Escherichia coli strain SCU-111 plasmid pSCU-111-2, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
57. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP051750 (Escherichia coli strain SCU-486 plasmid pSCU-486-1, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
58. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to KU932025 (Escherichia coli plasmid pEC14I, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
59. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP023674 (Escherichia coli strain SMN013SH2 plasmid pO177A2, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
60. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to MN158989 (Escherichia coli strain TREC1 plasmid pTREC1, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
61. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP022166 (Escherichia coli strain M160133 plasmid pM160133_p2, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
62. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to KX246267 (Escherichia coli plasmid pHNHN21, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
63. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_LR130554 (Escherichia coli strain MS14386 isolate MS14386 plasmid 3) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
64. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP047577 (Escherichia coli strain 94EC plasmid p94EC-1, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
65. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP026643 (Escherichia coli strain FORC_082 plasmid pFORC82_2, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
66. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP047407 (Escherichia coli strain MS6193 plasmid pMS6193B, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
67. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to MH061383 (Pseudomonas aeruginosa plasmid pP6qnrS1, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
68. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_LR025097 (Escherichia coli isolate EC-7215 plasmid 2, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
69. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP023355 (Escherichia coli strain 746 plasmid p72, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
70. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP034167 (Escherichia albertii strain 2014C-4015 plasmid p2014C-4015-3, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
71. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to MF353155 (Escherichia coli plasmid pLZ135-CTX, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
72. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to MF353156 (Escherichia coli plasmid pLZ135-NDM, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
73. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP041299 (Escherichia coli O1:H42 strain CLSC36 plasmid pCys-1, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
74. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_LR740759 (Escherichia coli strain BEN5202 isolate laying hen 51 weeks old plasmid paAPEC5202) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
75. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP047613 (Escherichia coli strain NMBU_ W06E18 plasmid pNMBU_W06E18_Str1_4, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
76. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP019055 (Escherichia coli strain CRE1540 plasmid p1540-4, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
77. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NC_022885 (Escherichia coli strain LK-NARMP plasmid pKPC-LKEc, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
78. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NC_012944 (Escherichia coli Vir68 plasmid pVir68, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
79. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_AP018139 (Escherichia coli strain M109 isolate M109 plasmid pM109_FII, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
80. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NC_011747 (Escherichia coli S88 plasmid pECOS88, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
81. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP031295 (Escherichia coli strain EC17GD31 plasmid pGD31-F1928, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
82. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP025403 (Escherichia coli strain MS8345 plasmid pMS8345B, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
83. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_MK416151 (Escherichia coli strain 6TC9eCTX plasmid pHNTC9e, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
84. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_MK878890 (Escherichia coli strain J53 plasmid pMG337, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
85. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_MH213345 (Escherichia coli strain EC1188 plasmid pEC1188-NDM16, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
86. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_MF474175 (Escherichia coli strain J53/pNIT-HK plasmid pNIT-HK, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
87. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_MF589339 (Escherichia coli strain 2271 plasmid pCTXM-2271, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
88. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_MF174860 (Escherichia coli strain 6/14/6b plasmid pIncF-MU4, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
89. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_MG385063 (Escherichia coli strain WF5-29 plasmid pWF5-29, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
90. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_MG515250 (Escherichia coli strain 16-50 plasmid pNDM-EC16-50, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
91. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_MG878866 (Escherichia coli strain Ec19397 plasmid pEc19397-131, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
92. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP025329 (Escherichia coli strain ExPEC XM plasmid unnamed) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
93. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NC_023327 (Escherichia coli ACN001 plasmid pACN001-B, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
94. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NC_009837 (Escherichia coli APEC O1 plasmid pAPEC-O1-ColBM, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
95. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP026494 (Escherichia coli strain HS13-1 plasmid pHS13-1-IncF, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
96. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to KR827684 (Escherichia coli plasmid pCERC3, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
97. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_KP119165 (Escherichia coli strain QT598 plasmid pEC598, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
98. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_KT845955 (Escherichia coli strain EP28 plasmid pHNEP28_cfr, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
99. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP010147 (Escherichia coli strain D5 plasmid B, complete genome) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
100. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP010232 (Escherichia coli strain S30 plasmid A, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
101. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_AP023192 (Escherichia coli strain TUM18530 plasmid pMTY18530-2, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
102. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP010158 (Escherichia coli strain D10 plasmid A, complete genome) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
103. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_AP017618 (Escherichia coli strain MRY15-117 plasmid pMRY15-117_1, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
104. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP049349 (Escherichia coli strain 3R plasmid p3R-1, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
105. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP021087 (Escherichia coli strain 13P460A plasmid p13P460A-2, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
106. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_LS992167 (Escherichia coli isolate Escherichia coli str. TO6 plasmid 2, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
107. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NC_010488 (Escherichia coli SMS-3-5 plasmid pSMS35_130, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
108. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP034739 (Escherichia coli strain L65 plasmid pL65-2, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
109. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP005931 (Escherichia coli APEC IMT5155 plasmid p1ColV5155, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
110. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP049082 (Escherichia coli strain p10A plasmid p10A_p1, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
111. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP024286 (Escherichia albertii strain 2014C-4356 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
112. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP029243 (Escherichia coli strain ECCRA-119 plasmid pTB201, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
113. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP029748 (Escherichia coli strain 2016C-3878 plasmid pMCR1-PA, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
114. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP049355 (Escherichia coli strain T28R plasmid pT28R-2, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
115. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to MN641485 (Escherichia coli strain SDCRK18-7 plasmid pNDM-SDCRK18-7, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
116. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP033091 (Escherichia coli DSM 30083 = JCM 1649 = ATCC 11775 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
117. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP024055 (Escherichia coli strain SMN197SH3 plasmid pO177A3, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
118. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP053236 (Escherichia coli strain SCU-106 plasmid pSCU-106-2, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
119. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP019018 (Escherichia coli strain Ecol_244 plasmid pEC244_2, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
120. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP019456 (Escherichia coli strain FHI_NMBU_03 plasmid pFHI_NMBU_03_1, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
121. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP028193 (Escherichia coli strain CFSAN018748 plasmid pGMI14-004_2, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
122. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP047878 (Escherichia coli strain LD22-1 plasmid pLD22-1-135kb, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
123. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP041303 (Escherichia coli strain MSHS 133 plasmid pCys-11, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
124. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NC_011964 (Escherichia coli plasmid pAPEC-O103-ColBM, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
125. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_LT985252 (Escherichia coli strain 666 plasmid RCS51_p, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
126. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_AP019676 (Escherichia coli strain GSH8M-2 plasmid pGSH8M-2-1, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
127. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NC_024956 (Escherichia coli strain K-12 plasmid pDM0133, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
128. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP051728 (Escherichia coli strain SCU-111 plasmid pSCU-111-1, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
129. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NC_019089 (Escherichia coli plasmid pGUE-NDM, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
130. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NC_019094 (Escherichia coli plasmid p417H-90, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
131. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP024827 (Escherichia coli strain CREC-544 plasmid pCREC-544_1, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
132. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NC_025175 (Escherichia coli plasmid pH2332-166, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
133. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NC_025139 (Escherichia coli plasmid pH2291-144, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
134. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP010149 (Escherichia coli strain D6 plasmid A, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
135. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_LS992172 (Escherichia coli isolate Escherichia coli str. TO73 plasmid 2, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
136. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_AP017621 (Escherichia coli strain MRY15-131 plasmid pMRY15-131_1, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
137. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to CP050167 (Escherichia coli plasmid Carbapenemase(NDM-4)_IncFIB, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
138. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP042586 (Escherichia coli strain LD91-1 plasmid pLD91-1-146kb, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
139. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NC_010409 (Escherichia coli plasmid pVM01, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
140. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP027589 (Escherichia coli strain 2014C-3011 plasmid unnamed1) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
141. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP020934 (Escherichia coli strain HB-Coli0 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
142. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NC_011980 (Escherichia coli chi7122 plasmid pAPEC-1, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
143. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP030791 (Escherichia coli strain APEC O2-211 plasmid pAPEC-O2-211A-ColV, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
144. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to MN865122 (Escherichia coli strain SCNJ06 plasmid prmtB_SCNJ06, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
145. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to MN823988 (Escherichia coli strain 14406 plasmid p14406-FII, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
146. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_LR740777 (Escherichia coli strain BEN2908 isolate 1 day old chicken plasmid pAPEC2908) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
147. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP047667 (Escherichia coli strain LD26-1 plasmid pLD26-1-135kb, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
148. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP031107 (Escherichia coli strain AMSCJX02 plasmid pAMSC2, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
149. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP012113 (Escherichia coli strain PSUO78 plasmid pPSUO78_1, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
150. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP048026 (Escherichia coli strain GZEC065 plasmid pTEM1-GZEC065, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
151. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP029744 (Escherichia coli strain AR_0085 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
152. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_AP023199 (Escherichia coli strain TUM18780 plasmid pMTY18780-2, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
153. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP050751 (Salmonella enterica subsp. enterica serovar Typhimurium strain ST46 plasmid pST46-1, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
154. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP041920 (Escherichia coli strain Ec40743 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
155. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP051224 (Escherichia coli strain SCZE5 plasmid pSCZE2) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
156. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP041997 (Escherichia coli strain AR Bank #0349 plasmid pAR349, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
157. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP032891 (Escherichia coli strain SCEC020022 plasmid pVir_020022, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
158. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP050732 (Salmonella enterica subsp. enterica serovar Typhimurium strain ST101 plasmid pST101-1, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
159. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP050754 (Salmonella enterica subsp. enterica serovar Typhimurium strain ST45 plasmid pST45-1, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
160. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP024140 (Escherichia coli strain 14EC020 plasmid p14EC020b, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
161. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP019909 (Escherichia coli strain MDR_56 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
162. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP049102 (Escherichia coli strain EC28 plasmid p2, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
163. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NC_017659 (Escherichia coli O83:H1 str. NRG 857C plasmid pO83_CORR, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
164. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP050727 (Salmonella enterica subsp. enterica serovar Typhimurium strain ST113 plasmid pST-1, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
165. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP042245 (Escherichia coli strain PU-1 plasmid pColV-PU1, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
166. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP045953 (Salmonella enterica subsp. enterica serovar Typhimurium strain AUSMDU00008979 plasmid pAUSMDU00008979_01, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
167. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_LT985293 (Escherichia coli strain 4410-1 plasmid RCS79_p, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
168. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP031655 (Escherichia coli strain UK_Dog_Liverpool plasmid pCARB35_02, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
169. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to MN807689 (Escherichia coli strain A241 plasmid pA241-TEM, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
170. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_MK430046 (Escherichia coli strain 11.4-R4 plasmid pCERC13, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
171. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_MN053930 (Escherichia coli strain 2.3-R4 plasmid pCERC14, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
172. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_MH580302 (Escherichia coli strain 1107 plasmid p1107-118K, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
173. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_CP006635 (Escherichia coli PCN033 plasmid p3PCN033, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
174. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_MG014722 (Escherichia coli strain P2-3 plasmid pP2-3T, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
175. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_MG014720 (Escherichia coli strain A74 plasmid pA74T, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
176. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_MG825372 (Escherichia coli strain 1106 plasmid p1106-IncFIB, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
177. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_MG825378 (Escherichia coli strain 1108 plasmid p1108-IncFIB, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
178. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to NZ_MH202955 (Escherichia coli strain HXH-1 plasmid pHXH-1, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
179. spacer 6.1|2485954|31|NC_014973|CRISPRCasFinder matches to MN816372 (Escherichia coli strain A130 plasmid pA130-TEM, complete sequence) position: , mismatch: 6, identity: 0.806
cgccgcgccgggcgctgcaggcaatcaccag CRISPR spacer
aactgcgccgggcgctgaaggccatcacccg Protospacer
.*.************* **** ****** *
180. spacer 3.1|1413285|30|NC_014973|CRISPRCasFinder matches to NZ_CP051543 (Paracoccus sanguinis strain OM2164 plasmid pPspOM122, complete sequence) position: , mismatch: 7, identity: 0.767
catgccgcgcggcgttgagcgtcccggcac CRISPR spacer
cgcggcgcgcggcgtcgagcgtctcggccg Protospacer
*..* **********.*******.****
181. spacer 3.1|1413285|30|NC_014973|CRISPRCasFinder matches to NZ_CP017943 (Phyllobacterium zundukense strain Tri-48 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.733
catgccgcgcggcgttgagcgtcccggcac CRISPR spacer
tgagatgcgcggctttcagcgtcccggcaa Protospacer
.. * .******* ** ************
182. spacer 3.1|1413285|30|NC_014973|CRISPRCasFinder matches to NC_014120 (Paraburkholderia sp. CCGE1002 plasmid pBC201, complete sequence) position: , mismatch: 8, identity: 0.733
catgccgcgcggcgttgagcgtcccggcac CRISPR spacer
tcaatcgcgcggcgttgcgcgtcgcggcgc Protospacer
. ..************ ***** ****.*
183. spacer 3.1|1413285|30|NC_014973|CRISPRCasFinder matches to NZ_KY000027 (Agrobacterium rhizogenes strain CFBP2692 plasmid pTi_CFBP2692, complete sequence) position: , mismatch: 9, identity: 0.7
catgccgcgcggcgttgagcgtcccggcac CRISPR spacer
tcaggttcgcggccttgagcgtcccggcga Protospacer
. * . ****** **************.
184. spacer 3.1|1413285|30|NC_014973|CRISPRCasFinder matches to NZ_KY000031 (Agrobacterium genomosp. 1 strain Tun198 plasmid pTi_Tun198, complete sequence) position: , mismatch: 9, identity: 0.7
catgccgcgcggcgttgagcgtcccggcac CRISPR spacer
tcaggttcgcggccttgagcgtcccggcga Protospacer
. * . ****** **************.
185. spacer 3.1|1413285|30|NC_014973|CRISPRCasFinder matches to NZ_KY000028 (Agrobacterium genomosp. 1 strain CFBP2712 plasmid pTi_CFBP2712, complete sequence) position: , mismatch: 9, identity: 0.7
catgccgcgcggcgttgagcgtcccggcac CRISPR spacer
tcaggttcgcggccttgagcgtcccggcga Protospacer
. * . ****** **************.