Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_015675 Mesorhizobium opportunistum WSM2075, complete sequence 4 crisprs csa3,DEDDh,WYL,cas3 5 1 2 0

Results visualization

1. NC_015675
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_015675_1 3129517-3129966 Orphan NA
12 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_015675_2 3303732-3303820 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_015675_3 3620464-3620550 Orphan NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_015675_4 6806036-6806111 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_015675_1 1.1|3129535|18|NC_015675|CRT 3129535-3129552 18 NC_015675.1 4798333-4798350 1 0.944
NC_015675_1 1.3|3129607|18|NC_015675|CRT 3129607-3129624 18 NC_015675.1 5745721-5745738 1 0.944
NC_015675_1 1.5|3129679|18|NC_015675|CRT 3129679-3129696 18 NC_015675.1 5745721-5745738 1 0.944
NC_015675_1 1.7|3129751|18|NC_015675|CRT 3129751-3129768 18 NC_015675.1 5745721-5745738 1 0.944
NC_015675_1 1.9|3129823|18|NC_015675|CRT 3129823-3129840 18 NC_015675.1 5745721-5745738 1 0.944

1. spacer 1.1|3129535|18|NC_015675|CRT matches to position: 4798333-4798350, mismatch: 1, identity: 0.944

tccgtggtggtgccggcg	CRISPR spacer
tccgtggtggtgcaggcg	Protospacer
************* ****

2. spacer 1.3|3129607|18|NC_015675|CRT matches to position: 5745721-5745738, mismatch: 1, identity: 0.944

tccgtggtggcgccggcc	CRISPR spacer
tccgaggtggcgccggcc	Protospacer
**** *************

3. spacer 1.5|3129679|18|NC_015675|CRT matches to position: 5745721-5745738, mismatch: 1, identity: 0.944

tccgtggtggcgccggcc	CRISPR spacer
tccgaggtggcgccggcc	Protospacer
**** *************

4. spacer 1.7|3129751|18|NC_015675|CRT matches to position: 5745721-5745738, mismatch: 1, identity: 0.944

tccgtggtggcgccggcc	CRISPR spacer
tccgaggtggcgccggcc	Protospacer
**** *************

5. spacer 1.9|3129823|18|NC_015675|CRT matches to position: 5745721-5745738, mismatch: 1, identity: 0.944

tccgtggtggcgccggcc	CRISPR spacer
tccgaggtggcgccggcc	Protospacer
**** *************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_015675_4 4.1|6806059|30|NC_015675|CRISPRCasFinder 6806059-6806088 30 NZ_CP010857 Marinovum algicola DG 898 plasmid pMaD2, complete sequence 106364-106393 8 0.733

1. spacer 4.1|6806059|30|NC_015675|CRISPRCasFinder matches to NZ_CP010857 (Marinovum algicola DG 898 plasmid pMaD2, complete sequence) position: , mismatch: 8, identity: 0.733

gctgggagccgtgacatgacacaggccact	CRISPR spacer
caggcaatccgtgacatgacacagtccaca	Protospacer
   * .* **************** **** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 3814156 : 3860565 56 Rhizobium_phage(14.29%) tRNA,head,tail,terminase,portal,integrase,capsid attL 3819152:3819169|attR 3825925:3825942
DBSCAN-SWA_2 4092911 : 4101117 9 uncultured_Mediterranean_phage(85.71%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage