Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_016114 Streptomyces pratensis ATCC 33331, complete sequence 7 crisprs csa3,DEDDh,DinG,WYL,c2c9_V-U4,PD-DExK,cas4 6 8 1 0
NC_016115 Streptomyces pratensis ATCC 33331 plasmid pSFLA02, complete sequence 1 crisprs NA 0 1 0 0
NC_016110 Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence 4 crisprs cas3,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2 1 63 2 0

Results visualization

1. NC_016114
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_016114_1 2014218-2014409 Orphan N:A
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_016114_2 2138512-2138606 Orphan N:A
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_016114_3 2543791-2543869 Orphan N:A
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_016114_4 2588279-2588357 Orphan N:A
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_016114_5 3471661-3471805 Orphan N:A
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_016114_6 4540766-4541179 Orphan N:A
9 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_016114_7 6805648-6805739 Orphan N:A
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_016114_1 1.3|2014332|18|NC_016114|CRT 2014332-2014349 18 NC_016114.1 3398457-3398474 1 0.944
NC_016114_3 3.1|2543819|23|NC_016114|CRISPRCasFinder 2543819-2543841 23 NC_016114.1 5545069-5545091 2 0.913
NC_016114_6 6.3|4540892|18|NC_016114|CRT 4540892-4540909 18 NC_016114.1 4116190-4116207 1 0.944
NC_016114_6 6.5|4540976|18|NC_016114|CRT 4540976-4540993 18 NC_016114.1 4116190-4116207 1 0.944
NC_016114_6 6.8|4541096|18|NC_016114|CRT 4541096-4541113 18 NC_016114.1 4116190-4116207 1 0.944
NC_016114_6 6.9|4541132|30|NC_016114|CRT 4541132-4541161 30 NC_016114.1 4541156-4541185 1 0.967

1. spacer 1.3|2014332|18|NC_016114|CRT matches to position: 3398457-3398474, mismatch: 1, identity: 0.944

tgcgccgccaccgccacc	CRISPR spacer
tgcgccgccacctccacc	Protospacer
************ *****

2. spacer 3.1|2543819|23|NC_016114|CRISPRCasFinder matches to position: 5545069-5545091, mismatch: 2, identity: 0.913

ggcgtccgcgtcgtcgtacggcg	CRISPR spacer
ggcgtcctcgtcgtcgtacagcg	Protospacer
******* ***********.***

3. spacer 6.3|4540892|18|NC_016114|CRT matches to position: 4116190-4116207, mismatch: 1, identity: 0.944

cggcggtaccgatggtgg	CRISPR spacer
cggcggtgccgatggtgg	Protospacer
*******.**********

4. spacer 6.5|4540976|18|NC_016114|CRT matches to position: 4116190-4116207, mismatch: 1, identity: 0.944

cggcggtaccgatggtgg	CRISPR spacer
cggcggtgccgatggtgg	Protospacer
*******.**********

5. spacer 6.8|4541096|18|NC_016114|CRT matches to position: 4116190-4116207, mismatch: 1, identity: 0.944

cggcggtaccgatggtgg	CRISPR spacer
cggcggtgccgatggtgg	Protospacer
*******.**********

6. spacer 6.9|4541132|30|NC_016114|CRT matches to position: 4541156-4541185, mismatch: 1, identity: 0.967

tggcgggaccgacggtgggaccgatggcgg	CRISPR spacer
tggcggtaccgacggtgggaccgatggcgg	Protospacer
****** ***********************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 NZ_CP040758 Paracoccus sp. 2251 plasmid unnamed7, complete sequence 35660-35683 1 0.958
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 NZ_CP015881 Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence 104217-104240 1 0.958
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 324782-324805 1 0.958
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 NC_019849 Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence 653165-653188 2 0.917
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 NC_003078 Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence 1083599-1083622 2 0.917
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 NZ_CP019586 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence 1052425-1052448 2 0.917
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 NC_017326 Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence 638159-638182 2 0.917
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 NZ_CP021799 Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence 1149821-1149844 2 0.917
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 NC_017323 Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence 235203-235226 2 0.917
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 NZ_CP009146 Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence 646224-646247 2 0.917
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 NC_018701 Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence 636033-636056 2 0.917
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 NZ_CP021828 Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence 654338-654361 2 0.917
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 NZ_CP021802 Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence 1303961-1303984 2 0.917
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 NZ_CP021831 Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence 897457-897480 2 0.917
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 NZ_CP021823 Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence 771219-771242 2 0.917
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 NZ_CP021814 Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence 560210-560233 2 0.917
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 NZ_CP021795 Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence 290676-290699 2 0.917
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 NZ_CP021810 Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence 1424824-1424847 2 0.917
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 NZ_CP021806 Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence 371588-371611 2 0.917
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 NZ_CP021218 Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence 796765-796788 2 0.917
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 NZ_CP026527 Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence 659838-659861 2 0.917
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 NZ_CP019484 Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence 1224178-1224201 2 0.917
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 NZ_CP019487 Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence 996861-996884 2 0.917
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 NC_020560 Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence 1083604-1083627 2 0.917
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 MT310887 Microbacterium phage Unphazed, complete genome 46102-46125 2 0.917
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 KY210139 Xanthomonas phage KPhi1, complete genome 29592-29615 2 0.917
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 NC_020303 Corynebacterium halotolerans YIM 70093 = DSM 44683 plasmid pCha1, complete sequence 75985-76008 2 0.917
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 MN657139 Flavobacterium sp. strain ANT_J25B plasmid pA25BJ1, complete sequence 1744-1767 2 0.917
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 MN657147 Polaromonas sp. strain ANT_J29B plasmid pA29BJ1, complete sequence 1744-1767 2 0.917
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 NZ_CP024609 Massilia violaceinigra strain B2 plasmid unnamed, complete sequence 19060-19083 2 0.917
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 NZ_CP029358 Azospirillum sp. CFH 70021 plasmid unnamed3 377354-377377 2 0.917
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 NZ_CP005085 Sphingobium sp. TKS plasmid pTK1, complete sequence 297387-297410 2 0.917
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 MT446392 UNVERIFIED: Escherichia virus TH15, complete genome 15883-15906 2 0.917
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 NC_048801 Microbacterium phage Araxxi, complete genome 33127-33150 2 0.917
NC_016114_3 3.1|2543819|23|NC_016114|CRISPRCasFinder 2543819-2543841 23 LN997843 Streptomyces reticuli genome assembly TUE45, plasmid : II 377676-377698 2 0.913
NC_016114_3 3.1|2543819|23|NC_016114|CRISPRCasFinder 2543819-2543841 23 NZ_LR594660 Variovorax sp. PBL-H6 plasmid 2 70541-70563 2 0.913
NC_016114_3 3.1|2543819|23|NC_016114|CRISPRCasFinder 2543819-2543841 23 NZ_LR594667 Variovorax sp. SRS16 plasmid 2 729839-729861 2 0.913
NC_016114_3 3.1|2543819|23|NC_016114|CRISPRCasFinder 2543819-2543841 23 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 580126-580148 2 0.913
NC_016114_3 3.1|2543819|23|NC_016114|CRISPRCasFinder 2543819-2543841 23 NZ_LR594690 Variovorax sp. WDL1 plasmid 2 743598-743620 2 0.913
NC_016114_3 3.1|2543819|23|NC_016114|CRISPRCasFinder 2543819-2543841 23 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 3072451-3072473 2 0.913
NC_016114_3 3.1|2543819|23|NC_016114|CRISPRCasFinder 2543819-2543841 23 NC_010679 Paraburkholderia phytofirmans PsJN plasmid pBPHYT01, complete sequence 21126-21148 2 0.913
NC_016114_3 3.1|2543819|23|NC_016114|CRISPRCasFinder 2543819-2543841 23 NZ_LR594672 Variovorax sp. PBL-E5 plasmid 2 729973-729995 2 0.913
NC_016114_3 3.1|2543819|23|NC_016114|CRISPRCasFinder 2543819-2543841 23 MN746332 Rauchvirus SR18, complete genome 6051-6073 2 0.913
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 1606580-1606603 3 0.875
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 525792-525815 3 0.875
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 NZ_CP007130 Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence 962177-962200 3 0.875
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 NZ_CP011053 Halomonas sp. KO116 plasmid unnamed1, complete sequence 22707-22730 3 0.875
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 NZ_CP005085 Sphingobium sp. TKS plasmid pTK1, complete sequence 292149-292172 3 0.875
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 MG945325 UNVERIFIED: Microviridae sp. isolate 1713-1801, complete genome 4770-4793 3 0.875
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 MN234234 Arthrobacter phage Lymara, complete genome 63235-63258 3 0.875
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 1548804-1548827 3 0.875
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 NZ_CP013072 Sphingobium indicum B90A plasmid pSRL2, complete sequence 31062-31085 3 0.875
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 5092-5115 3 0.875
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 1873548-1873571 3 0.875
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 NZ_CP025017 Rhizobium leguminosarum strain Norway plasmid pRLN5, complete sequence 113083-113106 3 0.875
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 852482-852505 3 0.875
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 157328-157351 3 0.875
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 276802-276825 3 0.875
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 1494349-1494372 3 0.875
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 1536272-1536295 3 0.875
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 NZ_CP053711 Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed4, complete sequence 147471-147494 3 0.875
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 673376-673399 3 0.875
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 CP000664 Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA03, complete sequence 86468-86491 3 0.875
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 1872568-1872591 3 0.875
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 1872892-1872915 3 0.875
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 1872941-1872964 3 0.875
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 1873528-1873551 3 0.875
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 NZ_CP031753 Rhodobacter sphaeroides strain EBL0706 plasmid p.B, complete sequence 99933-99956 3 0.875
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 817992-818015 3 0.875
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 NZ_CP045548 Streptomyces sp. SYP-A7193 plasmid unnamed1, complete sequence 272534-272557 3 0.875
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 NZ_CP034186 Deinococcus sp. S14-83 strain S14-83T plasmid unnamed2, complete sequence 274533-274556 3 0.875
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 MT773555 Myoviridae sp. isolate BML_3 genomic sequence 52933-52956 3 0.875
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 MH001451 Mycobacterium phage Nairb, complete genome 22501-22524 3 0.875
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 MF036691 Serratia phage CBH8, complete genome 7480-7503 3 0.875
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 MK937607 Gordonia phage Zipp, complete genome 48031-48054 3 0.875
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 MF155936 Mycobacterium phage ZenTime222, complete genome 22501-22524 3 0.875
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 MK937611 Gordonia phage Verity, complete genome 48107-48130 3 0.875
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 MK494089 Mycobacterium phage Ibrahim, complete genome 22501-22524 3 0.875
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 MF036690 Serratia phage CHI14, complete genome 7480-7503 3 0.875
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 KM612259 Vibrio phage QH, complete genome 10851-10874 3 0.875
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 MF036692 Serratia phage X20, complete genome 7700-7723 3 0.875
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 NC_024135 Mycobacterium phage Bernal13, complete genome 22501-22524 3 0.875
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 KM591905 Mycobacterium phage RonRayGun, complete genome 22501-22524 3 0.875
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 MN735432 Mycobacteriophage Whitty, complete genome 22501-22524 3 0.875
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 KY883647 Vibrio phage JSF33, complete genome 31640-31663 3 0.875
NC_016114_1 1.2|2014284|30|NC_016114|CRT 2014284-2014313 30 MN062703 Microbacterium phage McGalleon, complete genome 19701-19730 4 0.867
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 NZ_CP011973 Pseudomonas syringae pv. actinidiae ICMP 18884 plasmid unnamed, complete sequence 71544-71567 4 0.833
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 NZ_CP032870 Pseudomonas syringae pv. actinidiae strain P220 plasmid pLKQG722, complete sequence 47846-47869 4 0.833
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 NZ_CP012180 Pseudomonas syringae pv. actinidiae ICMP 18708 plasmid unnamed, complete sequence 73969-73992 4 0.833
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 NZ_CP019733 Pseudomonas syringae pv. actinidiae strain CRAFRU 14.08 plasmid unnamed, complete sequence 62181-62204 4 0.833
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 NZ_CP017010 Pseudomonas syringae pv. actinidiae strain NZ-47 plasmid pPsa22180a, complete sequence 71544-71567 4 0.833
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 NZ_CP017008 Pseudomonas syringae pv. actinidiae strain ICMP 20586 plasmid pPsa20586, complete sequence 71537-71560 4 0.833
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 NZ_LT963392 Pseudomonas syringae pv. cerasicola isolate CFBP6109 plasmid PP1, complete sequence 42041-42064 4 0.833
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 NZ_CP019731 Pseudomonas syringae pv. actinidiae strain CRAFRU 12.29 plasmid unnamed, complete sequence 62181-62204 4 0.833
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 NZ_LT985210 Pseudomonas syringae pv. cerasicola strain CFBP 6110 plasmid PP1, complete sequence 35249-35272 4 0.833
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 503871-503894 4 0.833
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 NZ_CP023152 Mycobacterium chimaera strain FLAC0070 plasmid pFLAC0070_1, complete sequence 28716-28739 4 0.833
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 543357-543380 4 0.833
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 NZ_AP012556 Mycobacterium avium subsp. hominissuis TH135 plasmid pMAH135, complete sequence 112649-112672 4 0.833
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 NZ_CP016850 Pseudomonas sp. TMW 2.1634 plasmid pL21564-1, complete sequence 41681-41704 4 0.833
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 NZ_CP032156 Mycobacterium sp. ELW1 plasmid pELW1-1, complete sequence 176258-176281 4 0.833
NC_016114_6 6.7|4541048|30|NC_016114|CRT 4541048-4541077 30 KM389405 UNVERIFIED: Pseudomonas phage F_HA1961sp/Pa1641 clone contig00005 genomic sequence 2849-2878 4 0.867
NC_016114_6 6.7|4541048|30|NC_016114|CRT 4541048-4541077 30 MK034952 Pseudomonas phage Dobby, complete genome 4281-4310 4 0.867
NC_016114_6 6.9|4541132|30|NC_016114|CRT 4541132-4541161 30 NZ_CP032325 Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence 95856-95885 4 0.867
NC_016114_1 1.4|2014368|24|NC_016114|CRT 2014368-2014391 24 NZ_CP035002 Rhizobium acidisoli strain FH23 plasmid pRapFH23d, complete sequence 64681-64704 5 0.792
NC_016114_6 6.7|4541048|30|NC_016114|CRT 4541048-4541077 30 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 91971-92000 5 0.833
NC_016114_6 6.7|4541048|30|NC_016114|CRT 4541048-4541077 30 NZ_CP007795 Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence 72712-72741 5 0.833
NC_016114_6 6.7|4541048|30|NC_016114|CRT 4541048-4541077 30 KJ433975 Mycobacterium phage 40BC, complete genome 20945-20974 5 0.833
NC_016114_6 6.7|4541048|30|NC_016114|CRT 4541048-4541077 30 KJ433973 Mycobacterium phage 39HC, complete genome 20945-20974 5 0.833
NC_016114_6 6.7|4541048|30|NC_016114|CRT 4541048-4541077 30 NC_024145 Mycobacterium phage Hosp, complete genome 19141-19170 5 0.833
NC_016114_1 1.2|2014284|30|NC_016114|CRT 2014284-2014313 30 NZ_CP040720 Rhodococcus pyridinivorans strain YF3 plasmid unnamed1, complete sequence 179827-179856 6 0.8
NC_016114_1 1.2|2014284|30|NC_016114|CRT 2014284-2014313 30 NZ_CP033072 Streptomyces sp. Z022 plasmid unnamed1 56739-56768 6 0.8
NC_016114_1 1.2|2014284|30|NC_016114|CRT 2014284-2014313 30 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 392443-392472 6 0.8
NC_016114_1 1.2|2014284|30|NC_016114|CRT 2014284-2014313 30 NZ_CP046575 Rhodococcus sp. WAY2 plasmid pRWAY03, complete sequence 215964-215993 6 0.8
NC_016114_6 6.4|4540928|30|NC_016114|CRT 4540928-4540957 30 MN047793 Xanthomonas phage Xoo-sp13, complete genome 132640-132669 6 0.8
NC_016114_6 6.7|4541048|30|NC_016114|CRT 4541048-4541077 30 MN703407 Microbacterium phage Leaf, complete genome 42662-42691 6 0.8
NC_016114_6 6.7|4541048|30|NC_016114|CRT 4541048-4541077 30 MN703414 Microbacterium phage Dewdrop, complete genome 42662-42691 6 0.8
NC_016114_6 6.7|4541048|30|NC_016114|CRT 4541048-4541077 30 NZ_CP041653 Streptomyces sp. RLB1-9 plasmid pRLB1-9.1, complete sequence 20388-20417 6 0.8
NC_016114_6 6.7|4541048|30|NC_016114|CRT 4541048-4541077 30 MH616681 Microviridae sp. isolate ctdb173, complete genome 1696-1725 6 0.8
NC_016114_6 6.7|4541048|30|NC_016114|CRT 4541048-4541077 30 NZ_CP034394 Herbaspirillum seropedicae strain AU13965 plasmid unnamed, complete sequence 20443-20472 6 0.8
NC_016114_6 6.7|4541048|30|NC_016114|CRT 4541048-4541077 30 NC_008195 Mycobacterium phage Cooper, complete genome 30964-30993 6 0.8
NC_016114_6 6.9|4541132|30|NC_016114|CRT 4541132-4541161 30 NZ_HG938354 Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence 1104397-1104426 6 0.8
NC_016114_1 1.2|2014284|30|NC_016114|CRT 2014284-2014313 30 NZ_AP022319 Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence 145842-145871 7 0.767
NC_016114_1 1.2|2014284|30|NC_016114|CRT 2014284-2014313 30 NZ_CP041349 Komagataeibacter xylinus strain CGMCC 17276 plasmid pA, complete sequence 48998-49027 7 0.767
NC_016114_1 1.2|2014284|30|NC_016114|CRT 2014284-2014313 30 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 1307589-1307618 7 0.767
NC_016114_1 1.2|2014284|30|NC_016114|CRT 2014284-2014313 30 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 882608-882637 7 0.767
NC_016114_1 1.2|2014284|30|NC_016114|CRT 2014284-2014313 30 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 1447918-1447947 7 0.767
NC_016114_1 1.2|2014284|30|NC_016114|CRT 2014284-2014313 30 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 824785-824814 7 0.767
NC_016114_1 1.2|2014284|30|NC_016114|CRT 2014284-2014313 30 NZ_CP016452 Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence 757056-757085 7 0.767
NC_016114_1 1.2|2014284|30|NC_016114|CRT 2014284-2014313 30 NZ_CP042332 Bosea sp. F3-2 plasmid pB32-1, complete sequence 53182-53211 7 0.767
NC_016114_4 4.1|2588304|29|NC_016114|CRISPRCasFinder 2588304-2588332 29 NZ_KY349138 Mycolicibacterium sp. CBMA 213 plasmid pCBMA213_2, complete sequence 53694-53722 7 0.759
NC_016114_4 4.1|2588304|29|NC_016114|CRISPRCasFinder 2588304-2588332 29 MN103533 Mycobacterium phage Weirdo19, complete genome 38163-38191 7 0.759
NC_016114_6 6.7|4541048|30|NC_016114|CRT 4541048-4541077 30 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 847306-847335 7 0.767
NC_016114_6 6.7|4541048|30|NC_016114|CRT 4541048-4541077 30 NZ_CP054616 Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence 135934-135963 7 0.767
NC_016114_6 6.7|4541048|30|NC_016114|CRT 4541048-4541077 30 NZ_CP016620 Microvirga ossetica strain V5/3m plasmid unnamed4, complete sequence 296852-296881 7 0.767
NC_016114_6 6.7|4541048|30|NC_016114|CRT 4541048-4541077 30 CP003952 Rhodococcus opacus PD630 plasmid 3, complete sequence 30445-30474 7 0.767
NC_016114_6 6.7|4541048|30|NC_016114|CRT 4541048-4541077 30 NZ_CP016463 Bosea sp. RAC05 plasmid pBSY19_1, complete sequence 17327-17356 7 0.767
NC_016114_6 6.7|4541048|30|NC_016114|CRT 4541048-4541077 30 NC_023286 Streptomyces sp. F12 plasmid pFRL6, complete sequence 234050-234079 7 0.767
NC_016114_1 1.2|2014284|30|NC_016114|CRT 2014284-2014313 30 NC_016623 Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence 226569-226598 8 0.733
NC_016114_1 1.2|2014284|30|NC_016114|CRT 2014284-2014313 30 NZ_AP014706 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_2p, complete sequence 59887-59916 8 0.733
NC_016114_1 1.2|2014284|30|NC_016114|CRT 2014284-2014313 30 MH020238 Mycobacterium phage Lilith, complete genome 18194-18223 8 0.733
NC_016114_1 1.2|2014284|30|NC_016114|CRT 2014284-2014313 30 MH077583 Mycobacterium phage PGHhamlin, complete genome 18193-18222 8 0.733
NC_016114_1 1.2|2014284|30|NC_016114|CRT 2014284-2014313 30 MT897907 Mycobacterium phage Grif, complete genome 18284-18313 8 0.733
NC_016114_1 1.2|2014284|30|NC_016114|CRT 2014284-2014313 30 MH727554 Mycobacterium phage MuchMore, complete genome 18193-18222 8 0.733
NC_016114_1 1.2|2014284|30|NC_016114|CRT 2014284-2014313 30 MH338240 Mycobacterium phage Sabia, complete genome 18194-18223 8 0.733
NC_016114_1 1.2|2014284|30|NC_016114|CRT 2014284-2014313 30 KM233455 Mycobacterium phage Farber, complete genome 18194-18223 8 0.733
NC_016114_1 1.2|2014284|30|NC_016114|CRT 2014284-2014313 30 KX664448 Mycobacterium phage Watson, complete genome 18193-18222 8 0.733
NC_016114_1 1.2|2014284|30|NC_016114|CRT 2014284-2014313 30 MH576949 Mycobacterium phage BreSam8, complete genome 18194-18223 8 0.733
NC_016114_1 1.2|2014284|30|NC_016114|CRT 2014284-2014313 30 NC_021535 Mycobacterium phage Jobu08, complete genome 18273-18302 8 0.733
NC_016114_1 1.2|2014284|30|NC_016114|CRT 2014284-2014313 30 MH536813 Mycobacterium phage AugsMagnumOpus, complete genome 18193-18222 8 0.733
NC_016114_1 1.2|2014284|30|NC_016114|CRT 2014284-2014313 30 MF185733 Mycobacterium phage StepMih, complete genome 18194-18223 8 0.733
NC_016114_1 1.2|2014284|30|NC_016114|CRT 2014284-2014313 30 MF185732 Mycobacterium phage Stagni, complete genome 18203-18232 8 0.733
NC_016114_1 1.2|2014284|30|NC_016114|CRT 2014284-2014313 30 MK494096 Mycobacterium phage Mainiac, complete genome 18194-18223 8 0.733
NC_016114_1 1.2|2014284|30|NC_016114|CRT 2014284-2014313 30 KU984914 Mycobacterium phage Malinsilva, complete genome 18193-18222 8 0.733
NC_016114_1 1.2|2014284|30|NC_016114|CRT 2014284-2014313 30 JF704101 Mycobacterium virus Microwolf, complete genome 18202-18231 8 0.733
NC_016114_1 1.2|2014284|30|NC_016114|CRT 2014284-2014313 30 MN062718 Mycobacterium phage SoilDragon, complete genome 17889-17918 8 0.733
NC_016114_1 1.2|2014284|30|NC_016114|CRT 2014284-2014313 30 KT359365 Mycobacterium phage DaHudson, complete genome 18193-18222 8 0.733
NC_016114_1 1.2|2014284|30|NC_016114|CRT 2014284-2014313 30 MH651179 Mycobacterium phage MadMarie, complete genome 18203-18232 8 0.733
NC_016114_5 5.2|3471746|35|NC_016114|CRISPRCasFinder 3471746-3471780 35 NZ_LR134460 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 18, complete sequence 108127-108161 8 0.771
NC_016114_6 6.7|4541048|30|NC_016114|CRT 4541048-4541077 30 NZ_CP019585 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence 231737-231766 8 0.733
NC_016114_6 6.7|4541048|30|NC_016114|CRT 4541048-4541077 30 NC_017327 Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence 1444452-1444481 8 0.733
NC_016114_6 6.7|4541048|30|NC_016114|CRT 4541048-4541077 30 NZ_CP009145 Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence 242171-242200 8 0.733
NC_016114_6 6.7|4541048|30|NC_016114|CRT 4541048-4541077 30 NZ_CP021827 Sinorhizobium meliloti strain KH35c plasmid psymA, complete sequence 365506-365535 8 0.733
NC_016114_6 6.7|4541048|30|NC_016114|CRT 4541048-4541077 30 NZ_CP021827 Sinorhizobium meliloti strain KH35c plasmid psymA, complete sequence 1193444-1193473 8 0.733
NC_016114_6 6.7|4541048|30|NC_016114|CRT 4541048-4541077 30 NZ_CP021801 Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence 140935-140964 8 0.733
NC_016114_6 6.7|4541048|30|NC_016114|CRT 4541048-4541077 30 NZ_CP021819 Sinorhizobium meliloti strain M162 plasmid psymA, complete sequence 90671-90700 8 0.733
NC_016114_6 6.7|4541048|30|NC_016114|CRT 4541048-4541077 30 NZ_CP021830 Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence 1222043-1222072 8 0.733
NC_016114_6 6.7|4541048|30|NC_016114|CRT 4541048-4541077 30 NZ_CP021824 Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence 118757-118786 8 0.733
NC_016114_6 6.7|4541048|30|NC_016114|CRT 4541048-4541077 30 NC_018683 Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence 153388-153417 8 0.733
NC_016114_6 6.7|4541048|30|NC_016114|CRT 4541048-4541077 30 NZ_CP021809 Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence 474122-474151 8 0.733
NC_016114_6 6.7|4541048|30|NC_016114|CRT 4541048-4541077 30 NZ_CP021217 Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence 1474178-1474207 8 0.733
NC_016114_6 6.7|4541048|30|NC_016114|CRT 4541048-4541077 30 MH884510 Exiguobacterium phage vB_EalM-137, complete genome 31369-31398 8 0.733
NC_016114_6 6.7|4541048|30|NC_016114|CRT 4541048-4541077 30 NC_017324 Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence 1379858-1379887 8 0.733
NC_016114_6 6.7|4541048|30|NC_016114|CRT 4541048-4541077 30 NZ_CP021813 Sinorhizobium meliloti strain M270 plasmid psymA, complete sequence 326191-326220 8 0.733
NC_016114_6 6.7|4541048|30|NC_016114|CRT 4541048-4541077 30 NZ_CP021805 Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence 201759-201788 8 0.733
NC_016114_1 1.2|2014284|30|NC_016114|CRT 2014284-2014313 30 NC_003078 Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence 1572389-1572418 9 0.7
NC_016114_1 1.2|2014284|30|NC_016114|CRT 2014284-2014313 30 NZ_LR134446 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 4, complete sequence 3749-3778 9 0.7
NC_016114_1 1.2|2014284|30|NC_016114|CRT 2014284-2014313 30 NZ_CP021799 Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence 1637321-1637350 9 0.7
NC_016114_1 1.2|2014284|30|NC_016114|CRT 2014284-2014313 30 NZ_CP015609 Bacillus safensis strain U14-5 plasmid unnamed2, complete sequence 3783-3812 9 0.7
NC_016114_1 1.2|2014284|30|NC_016114|CRT 2014284-2014313 30 NZ_CP021828 Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence 1139851-1139880 9 0.7
NC_016114_1 1.2|2014284|30|NC_016114|CRT 2014284-2014313 30 NC_020560 Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence 1572403-1572432 9 0.7
NC_016114_1 1.2|2014284|30|NC_016114|CRT 2014284-2014313 30 NZ_CP025188 Roseomonas mucosa strain AD2 plasmid p1-AD2, complete sequence 295865-295894 9 0.7
NC_016114_1 1.2|2014284|30|NC_016114|CRT 2014284-2014313 30 NZ_CP009146 Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence 165899-165928 9 0.7
NC_016114_1 1.2|2014284|30|NC_016114|CRT 2014284-2014313 30 NZ_CP021802 Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence 431885-431914 9 0.7
NC_016114_1 1.2|2014284|30|NC_016114|CRT 2014284-2014313 30 NZ_CP021218 Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence 319098-319127 9 0.7
NC_016114_6 6.7|4541048|30|NC_016114|CRT 4541048-4541077 30 NZ_CP010410 Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence 238330-238359 9 0.7

1. spacer 1.4|2014368|24|NC_016114|CRT matches to NZ_CP040758 (Paracoccus sp. 2251 plasmid unnamed7, complete sequence) position: , mismatch: 1, identity: 0.958

ggcgaagccgccaccgccaccgcc	CRISPR spacer
ggcgaagccaccaccgccaccgcc	Protospacer
*********.**************

2. spacer 1.4|2014368|24|NC_016114|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 1, identity: 0.958

ggcgaagccgccaccgccaccgcc	CRISPR spacer
ggcgtagccgccaccgccaccgcc	Protospacer
**** *******************

3. spacer 1.4|2014368|24|NC_016114|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 1, identity: 0.958

ggcgaagccgccaccgccaccgcc	CRISPR spacer
ggcgtagccgccaccgccaccgcc	Protospacer
**** *******************

4. spacer 1.4|2014368|24|NC_016114|CRT matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 2, identity: 0.917

ggcgaagccgccaccgccaccgcc	CRISPR spacer
tgcgtagccgccaccgccaccgcc	Protospacer
 *** *******************

5. spacer 1.4|2014368|24|NC_016114|CRT matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 2, identity: 0.917

ggcgaagccgccaccgccaccgcc	CRISPR spacer
tgcgtagccgccaccgccaccgcc	Protospacer
 *** *******************

6. spacer 1.4|2014368|24|NC_016114|CRT matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 2, identity: 0.917

ggcgaagccgccaccgccaccgcc	CRISPR spacer
tgcgtagccgccaccgccaccgcc	Protospacer
 *** *******************

7. spacer 1.4|2014368|24|NC_016114|CRT matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 2, identity: 0.917

ggcgaagccgccaccgccaccgcc	CRISPR spacer
tgcgtagccgccaccgccaccgcc	Protospacer
 *** *******************

8. spacer 1.4|2014368|24|NC_016114|CRT matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 2, identity: 0.917

ggcgaagccgccaccgccaccgcc	CRISPR spacer
tgcgtagccgccaccgccaccgcc	Protospacer
 *** *******************

9. spacer 1.4|2014368|24|NC_016114|CRT matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 2, identity: 0.917

ggcgaagccgccaccgccaccgcc	CRISPR spacer
tgcgtagccgccaccgccaccgcc	Protospacer
 *** *******************

10. spacer 1.4|2014368|24|NC_016114|CRT matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 2, identity: 0.917

ggcgaagccgccaccgccaccgcc	CRISPR spacer
tgcgtagccgccaccgccaccgcc	Protospacer
 *** *******************

11. spacer 1.4|2014368|24|NC_016114|CRT matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 2, identity: 0.917

ggcgaagccgccaccgccaccgcc	CRISPR spacer
tgcgtagccgccaccgccaccgcc	Protospacer
 *** *******************

12. spacer 1.4|2014368|24|NC_016114|CRT matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 2, identity: 0.917

ggcgaagccgccaccgccaccgcc	CRISPR spacer
tgcgtagccgccaccgccaccgcc	Protospacer
 *** *******************

13. spacer 1.4|2014368|24|NC_016114|CRT matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 2, identity: 0.917

ggcgaagccgccaccgccaccgcc	CRISPR spacer
tgcgtagccgccaccgccaccgcc	Protospacer
 *** *******************

14. spacer 1.4|2014368|24|NC_016114|CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 2, identity: 0.917

ggcgaagccgccaccgccaccgcc	CRISPR spacer
tgcgtagccgccaccgccaccgcc	Protospacer
 *** *******************

15. spacer 1.4|2014368|24|NC_016114|CRT matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 2, identity: 0.917

ggcgaagccgccaccgccaccgcc	CRISPR spacer
tgcgtagccgccaccgccaccgcc	Protospacer
 *** *******************

16. spacer 1.4|2014368|24|NC_016114|CRT matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 2, identity: 0.917

ggcgaagccgccaccgccaccgcc	CRISPR spacer
tgcgtagccgccaccgccaccgcc	Protospacer
 *** *******************

17. spacer 1.4|2014368|24|NC_016114|CRT matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 2, identity: 0.917

ggcgaagccgccaccgccaccgcc	CRISPR spacer
tgcgtagccgccaccgccaccgcc	Protospacer
 *** *******************

18. spacer 1.4|2014368|24|NC_016114|CRT matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 2, identity: 0.917

ggcgaagccgccaccgccaccgcc	CRISPR spacer
tgcgtagccgccaccgccaccgcc	Protospacer
 *** *******************

19. spacer 1.4|2014368|24|NC_016114|CRT matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 2, identity: 0.917

ggcgaagccgccaccgccaccgcc	CRISPR spacer
tgcgtagccgccaccgccaccgcc	Protospacer
 *** *******************

20. spacer 1.4|2014368|24|NC_016114|CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 2, identity: 0.917

ggcgaagccgccaccgccaccgcc	CRISPR spacer
tgcgtagccgccaccgccaccgcc	Protospacer
 *** *******************

21. spacer 1.4|2014368|24|NC_016114|CRT matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 2, identity: 0.917

ggcgaagccgccaccgccaccgcc	CRISPR spacer
tgcgtagccgccaccgccaccgcc	Protospacer
 *** *******************

22. spacer 1.4|2014368|24|NC_016114|CRT matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 2, identity: 0.917

ggcgaagccgccaccgccaccgcc	CRISPR spacer
tgcgtagccgccaccgccaccgcc	Protospacer
 *** *******************

23. spacer 1.4|2014368|24|NC_016114|CRT matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 2, identity: 0.917

ggcgaagccgccaccgccaccgcc	CRISPR spacer
tgcgtagccgccaccgccaccgcc	Protospacer
 *** *******************

24. spacer 1.4|2014368|24|NC_016114|CRT matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 2, identity: 0.917

ggcgaagccgccaccgccaccgcc	CRISPR spacer
tgcgtagccgccaccgccaccgcc	Protospacer
 *** *******************

25. spacer 1.4|2014368|24|NC_016114|CRT matches to MT310887 (Microbacterium phage Unphazed, complete genome) position: , mismatch: 2, identity: 0.917

ggcgaagccgccaccgccaccgcc	CRISPR spacer
agcgacgccgccaccgccaccgcc	Protospacer
.**** ******************

26. spacer 1.4|2014368|24|NC_016114|CRT matches to KY210139 (Xanthomonas phage KPhi1, complete genome) position: , mismatch: 2, identity: 0.917

ggcgaagccgccaccgccaccgcc	CRISPR spacer
cgctaagccgccaccgccaccgcc	Protospacer
 ** ********************

27. spacer 1.4|2014368|24|NC_016114|CRT matches to NC_020303 (Corynebacterium halotolerans YIM 70093 = DSM 44683 plasmid pCha1, complete sequence) position: , mismatch: 2, identity: 0.917

ggcgaagccgccaccgccaccgcc	CRISPR spacer
gtcgaggccgccaccgccaccgcc	Protospacer
* ***.******************

28. spacer 1.4|2014368|24|NC_016114|CRT matches to MN657139 (Flavobacterium sp. strain ANT_J25B plasmid pA25BJ1, complete sequence) position: , mismatch: 2, identity: 0.917

ggcgaagccgccaccgccaccgcc	CRISPR spacer
ggtgaacccgccaccgccaccgcc	Protospacer
**.*** *****************

29. spacer 1.4|2014368|24|NC_016114|CRT matches to MN657147 (Polaromonas sp. strain ANT_J29B plasmid pA29BJ1, complete sequence) position: , mismatch: 2, identity: 0.917

ggcgaagccgccaccgccaccgcc	CRISPR spacer
ggtgaacccgccaccgccaccgcc	Protospacer
**.*** *****************

30. spacer 1.4|2014368|24|NC_016114|CRT matches to NZ_CP024609 (Massilia violaceinigra strain B2 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.917

ggcgaagccgccaccgccaccgcc	CRISPR spacer
ggcgaagccgcctgcgccaccgcc	Protospacer
************  **********

31. spacer 1.4|2014368|24|NC_016114|CRT matches to NZ_CP029358 (Azospirillum sp. CFH 70021 plasmid unnamed3) position: , mismatch: 2, identity: 0.917

ggcgaagccgccaccgccaccgcc	CRISPR spacer
ggcgccgccgccaccgccaccgcc	Protospacer
****  ******************

32. spacer 1.4|2014368|24|NC_016114|CRT matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 2, identity: 0.917

ggcgaagccgccaccgccaccgcc	CRISPR spacer
ggcgaagccgccagcgccgccgcc	Protospacer
************* ****.*****

33. spacer 1.4|2014368|24|NC_016114|CRT matches to MT446392 (UNVERIFIED: Escherichia virus TH15, complete genome) position: , mismatch: 2, identity: 0.917

ggcgaagccgccaccgccaccgcc	CRISPR spacer
ggcaatgccgccaccgccaccgcc	Protospacer
***.* ******************

34. spacer 1.4|2014368|24|NC_016114|CRT matches to NC_048801 (Microbacterium phage Araxxi, complete genome) position: , mismatch: 2, identity: 0.917

ggcgaagccgccaccgccaccgcc	CRISPR spacer
ggcgtagccgcctccgccaccgcc	Protospacer
**** ******* ***********

35. spacer 3.1|2543819|23|NC_016114|CRISPRCasFinder matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 2, identity: 0.913

ggcgtccgcgtcgtcgtacggcg	CRISPR spacer
cgcgtccgcgtcgtcgtacggct	Protospacer
 ********************* 

36. spacer 3.1|2543819|23|NC_016114|CRISPRCasFinder matches to NZ_LR594660 (Variovorax sp. PBL-H6 plasmid 2) position: , mismatch: 2, identity: 0.913

ggcgtccgcgtcgtcgtacggcg	CRISPR spacer
ggcgtccgcgtcgtcgtacttcg	Protospacer
*******************  **

37. spacer 3.1|2543819|23|NC_016114|CRISPRCasFinder matches to NZ_LR594667 (Variovorax sp. SRS16 plasmid 2) position: , mismatch: 2, identity: 0.913

ggcgtccgcgtcgtcgtacggcg	CRISPR spacer
ggcgtccgcgtcgtcgtacttcg	Protospacer
*******************  **

38. spacer 3.1|2543819|23|NC_016114|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 2, identity: 0.913

ggcgtccgcgtcgtcgtacggcg	CRISPR spacer
ggcgtccgcgtcgtcgggcggcg	Protospacer
**************** .*****

39. spacer 3.1|2543819|23|NC_016114|CRISPRCasFinder matches to NZ_LR594690 (Variovorax sp. WDL1 plasmid 2) position: , mismatch: 2, identity: 0.913

ggcgtccgcgtcgtcgtacggcg	CRISPR spacer
ggcgtccgcgtcgtcgtacttcg	Protospacer
*******************  **

40. spacer 3.1|2543819|23|NC_016114|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 2, identity: 0.913

ggcgtccgcgtcgtcgtacggcg	CRISPR spacer
ggcgtcggcgtcgtcgtacgtcg	Protospacer
****** ************* **

41. spacer 3.1|2543819|23|NC_016114|CRISPRCasFinder matches to NC_010679 (Paraburkholderia phytofirmans PsJN plasmid pBPHYT01, complete sequence) position: , mismatch: 2, identity: 0.913

ggcgtccgcgtcgtcgtacggcg	CRISPR spacer
ggcgtccgcgtcgtcgaacgacg	Protospacer
**************** ***.**

42. spacer 3.1|2543819|23|NC_016114|CRISPRCasFinder matches to NZ_LR594672 (Variovorax sp. PBL-E5 plasmid 2) position: , mismatch: 2, identity: 0.913

ggcgtccgcgtcgtcgtacggcg	CRISPR spacer
ggcgtccgcgtcgtcgtacttcg	Protospacer
*******************  **

43. spacer 3.1|2543819|23|NC_016114|CRISPRCasFinder matches to MN746332 (Rauchvirus SR18, complete genome) position: , mismatch: 2, identity: 0.913

ggcgtccgcgtcgtcgtacggcg	CRISPR spacer
ggcgtccgcgtcttcgtacagcg	Protospacer
************ ******.***

44. spacer 1.4|2014368|24|NC_016114|CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 3, identity: 0.875

ggcgaagccgccaccgccaccgcc	CRISPR spacer
caggaagccgccaccgccaccgcc	Protospacer
 . *********************

45. spacer 1.4|2014368|24|NC_016114|CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 3, identity: 0.875

ggcgaagccgccaccgccaccgcc	CRISPR spacer
caggaagccgccaccgccaccgcc	Protospacer
 . *********************

46. spacer 1.4|2014368|24|NC_016114|CRT matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 3, identity: 0.875

ggcgaagccgccaccgccaccgcc	CRISPR spacer
accgaagccgccaccaccaccgcc	Protospacer
. *************.********

47. spacer 1.4|2014368|24|NC_016114|CRT matches to NZ_CP011053 (Halomonas sp. KO116 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

ggcgaagccgccaccgccaccgcc	CRISPR spacer
accgaagccgccgccgccaccgcc	Protospacer
. **********.***********

48. spacer 1.4|2014368|24|NC_016114|CRT matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 3, identity: 0.875

ggcgaagccgccaccgccaccgcc	CRISPR spacer
cgcgaagccgcctgcgccaccgcc	Protospacer
 ***********  **********

49. spacer 1.4|2014368|24|NC_016114|CRT matches to MG945325 (UNVERIFIED: Microviridae sp. isolate 1713-1801, complete genome) position: , mismatch: 3, identity: 0.875

ggcgaagccgccaccgccaccgcc	CRISPR spacer
tccgaagccgccaccgcgaccgcc	Protospacer
  *************** ******

50. spacer 1.4|2014368|24|NC_016114|CRT matches to MN234234 (Arthrobacter phage Lymara, complete genome) position: , mismatch: 3, identity: 0.875

ggcgaagccgccaccgccaccgcc	CRISPR spacer
accgaacccgccaccgccaccgcc	Protospacer
. **** *****************

51. spacer 1.4|2014368|24|NC_016114|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 3, identity: 0.875

ggcgaagccgccaccgccaccgcc	CRISPR spacer
cgcgccgccgccaccgccaccgcc	Protospacer
 ***  ******************

52. spacer 1.4|2014368|24|NC_016114|CRT matches to NZ_CP013072 (Sphingobium indicum B90A plasmid pSRL2, complete sequence) position: , mismatch: 3, identity: 0.875

ggcgaagccgccaccgccaccgcc	CRISPR spacer
gccgaagccgccacggccaccgcg	Protospacer
* ************ ******** 

53. spacer 1.4|2014368|24|NC_016114|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 3, identity: 0.875

ggcgaagccgccaccgccaccgcc	CRISPR spacer
cgcgacgccaccaccgccaccgcc	Protospacer
 **** ***.**************

54. spacer 1.4|2014368|24|NC_016114|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

ggcgaagccgccaccgccaccgcc	CRISPR spacer
agcgaagccgacagcgccaccgcc	Protospacer
.********* ** **********

55. spacer 1.4|2014368|24|NC_016114|CRT matches to NZ_CP025017 (Rhizobium leguminosarum strain Norway plasmid pRLN5, complete sequence) position: , mismatch: 3, identity: 0.875

ggcgaagccgccaccgccaccgcc	CRISPR spacer
cgcgccgccgccaccgccaccgcc	Protospacer
 ***  ******************

56. spacer 1.4|2014368|24|NC_016114|CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 3, identity: 0.875

ggcgaagccgccaccgccaccgcc	CRISPR spacer
cgtgacgccgccaccgccaccgcc	Protospacer
 *.** ******************

57. spacer 1.4|2014368|24|NC_016114|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 3, identity: 0.875

ggcgaagccgccaccgccaccgcc	CRISPR spacer
cgccaggccgccaccgccaccgcc	Protospacer
 ** *.******************

58. spacer 1.4|2014368|24|NC_016114|CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 3, identity: 0.875

ggcgaagccgccaccgccaccgcc	CRISPR spacer
ggcgacgccgccaccgccgccgcg	Protospacer
***** ************.**** 

59. spacer 1.4|2014368|24|NC_016114|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

ggcgaagccgccaccgccaccgcc	CRISPR spacer
cgcgccgccgccaccgccaccgcc	Protospacer
 ***  ******************

60. spacer 1.4|2014368|24|NC_016114|CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 3, identity: 0.875

ggcgaagccgccaccgccaccgcc	CRISPR spacer
ggcgacgccgccaccgccgccgcg	Protospacer
***** ************.**** 

61. spacer 1.4|2014368|24|NC_016114|CRT matches to NZ_CP053711 (Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed4, complete sequence) position: , mismatch: 3, identity: 0.875

ggcgaagccgccaccgccaccgcc	CRISPR spacer
agcgccgccgccaccgccaccgcc	Protospacer
.***  ******************

62. spacer 1.4|2014368|24|NC_016114|CRT matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 3, identity: 0.875

ggcgaagccgccaccgccaccgcc	CRISPR spacer
ggcgaagccgccgccgccacccac	Protospacer
************.********  *

63. spacer 1.4|2014368|24|NC_016114|CRT matches to CP000664 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA03, complete sequence) position: , mismatch: 3, identity: 0.875

ggcgaagccgccaccgccaccgcc	CRISPR spacer
cgcgaggccgccatcgccaccgcc	Protospacer
 ****.*******.**********

64. spacer 1.4|2014368|24|NC_016114|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 3, identity: 0.875

ggcgaagccgccaccgccaccgcc	CRISPR spacer
agcgaagccgacagcgccaccgcc	Protospacer
.********* ** **********

65. spacer 1.4|2014368|24|NC_016114|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

ggcgaagccgccaccgccaccgcc	CRISPR spacer
agcgaagccgacagcgccaccgcc	Protospacer
.********* ** **********

66. spacer 1.4|2014368|24|NC_016114|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

ggcgaagccgccaccgccaccgcc	CRISPR spacer
agcgaagccgacagcgccaccgcc	Protospacer
.********* ** **********

67. spacer 1.4|2014368|24|NC_016114|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

ggcgaagccgccaccgccaccgcc	CRISPR spacer
agcgaagccgacagcgccaccgcc	Protospacer
.********* ** **********

68. spacer 1.4|2014368|24|NC_016114|CRT matches to NZ_CP031753 (Rhodobacter sphaeroides strain EBL0706 plasmid p.B, complete sequence) position: , mismatch: 3, identity: 0.875

ggcgaagccgccaccgccaccgcc	CRISPR spacer
cgcgaggccgccatcgccaccgcc	Protospacer
 ****.*******.**********

69. spacer 1.4|2014368|24|NC_016114|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

ggcgaagccgccaccgccaccgcc	CRISPR spacer
cgcgccgccgccaccgccaccgcc	Protospacer
 ***  ******************

70. spacer 1.4|2014368|24|NC_016114|CRT matches to NZ_CP045548 (Streptomyces sp. SYP-A7193 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

ggcgaagccgccaccgccaccgcc	CRISPR spacer
cgcggagccgccaccgcccccgcc	Protospacer
 ***.************* *****

71. spacer 1.4|2014368|24|NC_016114|CRT matches to NZ_CP034186 (Deinococcus sp. S14-83 strain S14-83T plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.875

ggcgaagccgccaccgccaccgcc	CRISPR spacer
agccaagccgccaccgccagcgcc	Protospacer
.** *************** ****

72. spacer 1.4|2014368|24|NC_016114|CRT matches to MT773555 (Myoviridae sp. isolate BML_3 genomic sequence) position: , mismatch: 3, identity: 0.875

ggcgaagccgccaccgccaccgcc	CRISPR spacer
gaggtagccgccaccgccaccgcc	Protospacer
*. * *******************

73. spacer 1.4|2014368|24|NC_016114|CRT matches to MH001451 (Mycobacterium phage Nairb, complete genome) position: , mismatch: 3, identity: 0.875

ggcgaagccgccaccgccaccgcc	CRISPR spacer
cgtgacgccgccaccgccaccgcc	Protospacer
 *.** ******************

74. spacer 1.4|2014368|24|NC_016114|CRT matches to MF036691 (Serratia phage CBH8, complete genome) position: , mismatch: 3, identity: 0.875

ggcgaagccgccaccgccaccgcc	CRISPR spacer
gtagaagccgccacccccaccgcc	Protospacer
*  ************ ********

75. spacer 1.4|2014368|24|NC_016114|CRT matches to MK937607 (Gordonia phage Zipp, complete genome) position: , mismatch: 3, identity: 0.875

ggcgaagccgccaccgccaccgcc	CRISPR spacer
ggcgaagtcgccaccgccgccgcg	Protospacer
*******.**********.**** 

76. spacer 1.4|2014368|24|NC_016114|CRT matches to MF155936 (Mycobacterium phage ZenTime222, complete genome) position: , mismatch: 3, identity: 0.875

ggcgaagccgccaccgccaccgcc	CRISPR spacer
cgtgacgccgccaccgccaccgcc	Protospacer
 *.** ******************

77. spacer 1.4|2014368|24|NC_016114|CRT matches to MK937611 (Gordonia phage Verity, complete genome) position: , mismatch: 3, identity: 0.875

ggcgaagccgccaccgccaccgcc	CRISPR spacer
ggcgaagtcgccaccgccgccgcg	Protospacer
*******.**********.**** 

78. spacer 1.4|2014368|24|NC_016114|CRT matches to MK494089 (Mycobacterium phage Ibrahim, complete genome) position: , mismatch: 3, identity: 0.875

ggcgaagccgccaccgccaccgcc	CRISPR spacer
cgtgacgccgccaccgccaccgcc	Protospacer
 *.** ******************

79. spacer 1.4|2014368|24|NC_016114|CRT matches to MF036690 (Serratia phage CHI14, complete genome) position: , mismatch: 3, identity: 0.875

ggcgaagccgccaccgccaccgcc	CRISPR spacer
gtagaagccgccacccccaccgcc	Protospacer
*  ************ ********

80. spacer 1.4|2014368|24|NC_016114|CRT matches to KM612259 (Vibrio phage QH, complete genome) position: , mismatch: 3, identity: 0.875

ggcgaagccgccaccgccaccgcc	CRISPR spacer
gcctgagccgccaccgccaccgcc	Protospacer
* * .*******************

81. spacer 1.4|2014368|24|NC_016114|CRT matches to MF036692 (Serratia phage X20, complete genome) position: , mismatch: 3, identity: 0.875

ggcgaagccgccaccgccaccgcc	CRISPR spacer
gtagaagccgccacccccaccgcc	Protospacer
*  ************ ********

82. spacer 1.4|2014368|24|NC_016114|CRT matches to NC_024135 (Mycobacterium phage Bernal13, complete genome) position: , mismatch: 3, identity: 0.875

ggcgaagccgccaccgccaccgcc	CRISPR spacer
cgtgacgccgccaccgccaccgcc	Protospacer
 *.** ******************

83. spacer 1.4|2014368|24|NC_016114|CRT matches to KM591905 (Mycobacterium phage RonRayGun, complete genome) position: , mismatch: 3, identity: 0.875

ggcgaagccgccaccgccaccgcc	CRISPR spacer
cgtgacgccgccaccgccaccgcc	Protospacer
 *.** ******************

84. spacer 1.4|2014368|24|NC_016114|CRT matches to MN735432 (Mycobacteriophage Whitty, complete genome) position: , mismatch: 3, identity: 0.875

ggcgaagccgccaccgccaccgcc	CRISPR spacer
cgtgacgccgccaccgccaccgcc	Protospacer
 *.** ******************

85. spacer 1.4|2014368|24|NC_016114|CRT matches to KY883647 (Vibrio phage JSF33, complete genome) position: , mismatch: 3, identity: 0.875

ggcgaagccgccaccgccaccgcc	CRISPR spacer
gcctgagccgccaccgccaccgcc	Protospacer
* * .*******************

86. spacer 1.2|2014284|30|NC_016114|CRT matches to MN062703 (Microbacterium phage McGalleon, complete genome) position: , mismatch: 4, identity: 0.867

accgaagccgggacgaccgccgaagccgcc-	CRISPR spacer
accgaagccggggcgaccggcg-agccacca	Protospacer
************.****** ** ****.** 

87. spacer 1.4|2014368|24|NC_016114|CRT matches to NZ_CP011973 (Pseudomonas syringae pv. actinidiae ICMP 18884 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.833

ggcgaagccgccaccgccaccgcc	CRISPR spacer
ccaaaagccgccaccgccaccgcc	Protospacer
   .********************

88. spacer 1.4|2014368|24|NC_016114|CRT matches to NZ_CP032870 (Pseudomonas syringae pv. actinidiae strain P220 plasmid pLKQG722, complete sequence) position: , mismatch: 4, identity: 0.833

ggcgaagccgccaccgccaccgcc	CRISPR spacer
ccaaaagccgccaccgccaccgcc	Protospacer
   .********************

89. spacer 1.4|2014368|24|NC_016114|CRT matches to NZ_CP012180 (Pseudomonas syringae pv. actinidiae ICMP 18708 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.833

ggcgaagccgccaccgccaccgcc	CRISPR spacer
ccaaaagccgccaccgccaccgcc	Protospacer
   .********************

90. spacer 1.4|2014368|24|NC_016114|CRT matches to NZ_CP019733 (Pseudomonas syringae pv. actinidiae strain CRAFRU 14.08 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.833

ggcgaagccgccaccgccaccgcc	CRISPR spacer
ccaaaagccgccaccgccaccgcc	Protospacer
   .********************

91. spacer 1.4|2014368|24|NC_016114|CRT matches to NZ_CP017010 (Pseudomonas syringae pv. actinidiae strain NZ-47 plasmid pPsa22180a, complete sequence) position: , mismatch: 4, identity: 0.833

ggcgaagccgccaccgccaccgcc	CRISPR spacer
ccaaaagccgccaccgccaccgcc	Protospacer
   .********************

92. spacer 1.4|2014368|24|NC_016114|CRT matches to NZ_CP017008 (Pseudomonas syringae pv. actinidiae strain ICMP 20586 plasmid pPsa20586, complete sequence) position: , mismatch: 4, identity: 0.833

ggcgaagccgccaccgccaccgcc	CRISPR spacer
ccaaaagccgccaccgccaccgcc	Protospacer
   .********************

93. spacer 1.4|2014368|24|NC_016114|CRT matches to NZ_LT963392 (Pseudomonas syringae pv. cerasicola isolate CFBP6109 plasmid PP1, complete sequence) position: , mismatch: 4, identity: 0.833

ggcgaagccgccaccgccaccgcc	CRISPR spacer
ccaaaagccgccaccgccaccgcc	Protospacer
   .********************

94. spacer 1.4|2014368|24|NC_016114|CRT matches to NZ_CP019731 (Pseudomonas syringae pv. actinidiae strain CRAFRU 12.29 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.833

ggcgaagccgccaccgccaccgcc	CRISPR spacer
ccaaaagccgccaccgccaccgcc	Protospacer
   .********************

95. spacer 1.4|2014368|24|NC_016114|CRT matches to NZ_LT985210 (Pseudomonas syringae pv. cerasicola strain CFBP 6110 plasmid PP1, complete sequence) position: , mismatch: 4, identity: 0.833

ggcgaagccgccaccgccaccgcc	CRISPR spacer
ccaaaagccgccaccgccaccgcc	Protospacer
   .********************

96. spacer 1.4|2014368|24|NC_016114|CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 4, identity: 0.833

ggcgaagccgccaccgccaccgcc	CRISPR spacer
ctggaagccgccaccaccaccgcc	Protospacer
   ************.********

97. spacer 1.4|2014368|24|NC_016114|CRT matches to NZ_CP023152 (Mycobacterium chimaera strain FLAC0070 plasmid pFLAC0070_1, complete sequence) position: , mismatch: 4, identity: 0.833

ggcgaagccgccaccgccaccgcc	CRISPR spacer
accgaagccgccaccgcgaccgct	Protospacer
. *************** *****.

98. spacer 1.4|2014368|24|NC_016114|CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 4, identity: 0.833

ggcgaagccgccaccgccaccgcc	CRISPR spacer
ctggaagccgccaccaccaccgcc	Protospacer
   ************.********

99. spacer 1.4|2014368|24|NC_016114|CRT matches to NZ_AP012556 (Mycobacterium avium subsp. hominissuis TH135 plasmid pMAH135, complete sequence) position: , mismatch: 4, identity: 0.833

ggcgaagccgccaccgccaccgcc	CRISPR spacer
accgaagccgccaccgcgaccgct	Protospacer
. *************** *****.

100. spacer 1.4|2014368|24|NC_016114|CRT matches to NZ_CP016850 (Pseudomonas sp. TMW 2.1634 plasmid pL21564-1, complete sequence) position: , mismatch: 4, identity: 0.833

ggcgaagccgccaccgccaccgcc	CRISPR spacer
gctagagccgccaccgccaccgcc	Protospacer
* ...*******************

101. spacer 1.4|2014368|24|NC_016114|CRT matches to NZ_CP032156 (Mycobacterium sp. ELW1 plasmid pELW1-1, complete sequence) position: , mismatch: 4, identity: 0.833

ggcgaagccgccaccgccaccgcc	CRISPR spacer
ccccgagccgccaccgccaccgcc	Protospacer
  * .*******************

102. spacer 6.7|4541048|30|NC_016114|CRT matches to KM389405 (UNVERIFIED: Pseudomonas phage F_HA1961sp/Pa1641 clone contig00005 genomic sequence) position: , mismatch: 4, identity: 0.867

tggtggtgccgacggcggtaccgatggcgg--	CRISPR spacer
tggtggcgccgccggcggtaccg--ggcggca	Protospacer
******.**** ***********  *****  

103. spacer 6.7|4541048|30|NC_016114|CRT matches to MK034952 (Pseudomonas phage Dobby, complete genome) position: , mismatch: 4, identity: 0.867

tggtggtgccgacggcggtaccgatggcgg--	CRISPR spacer
tggtggcgccgccggcggtaccg--ggcggca	Protospacer
******.**** ***********  *****  

104. spacer 6.9|4541132|30|NC_016114|CRT matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 4, identity: 0.867

tggcgggaccgacggtgggaccgatggcgg	CRISPR spacer
cggcgggaccgatggcgggaccgatggcga	Protospacer
.***********.**.*************.

105. spacer 1.4|2014368|24|NC_016114|CRT matches to NZ_CP035002 (Rhizobium acidisoli strain FH23 plasmid pRapFH23d, complete sequence) position: , mismatch: 5, identity: 0.792

ggcgaagccgccaccgccaccgcc	CRISPR spacer
atgcgagccgccaccgccaccgcc	Protospacer
.   .*******************

106. spacer 6.7|4541048|30|NC_016114|CRT matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 5, identity: 0.833

tggtggtgccgacggcggtaccgatggcgg	CRISPR spacer
tggtggtgccgacggcgctgccgatggtcc	Protospacer
***************** *.*******.  

107. spacer 6.7|4541048|30|NC_016114|CRT matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 5, identity: 0.833

tggtggtgccgacggcggtaccgatggcgg	CRISPR spacer
tggtggtgccgacggcgctgccgatggtcc	Protospacer
***************** *.*******.  

108. spacer 6.7|4541048|30|NC_016114|CRT matches to KJ433975 (Mycobacterium phage 40BC, complete genome) position: , mismatch: 5, identity: 0.833

tggtggtgccgacggcggtaccgatggcgg	CRISPR spacer
gcgcggtgccgacgccggtaccgatggccg	Protospacer
  *.********** ************* *

109. spacer 6.7|4541048|30|NC_016114|CRT matches to KJ433973 (Mycobacterium phage 39HC, complete genome) position: , mismatch: 5, identity: 0.833

tggtggtgccgacggcggtaccgatggcgg	CRISPR spacer
gcgcggtgccgacgccggtaccgatggccg	Protospacer
  *.********** ************* *

110. spacer 6.7|4541048|30|NC_016114|CRT matches to NC_024145 (Mycobacterium phage Hosp, complete genome) position: , mismatch: 5, identity: 0.833

tggtggtgccgacggcggtaccgatggcgg	CRISPR spacer
gcgcggtgccgacgccggtaccgatggccg	Protospacer
  *.********** ************* *

111. spacer 1.2|2014284|30|NC_016114|CRT matches to NZ_CP040720 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

accgaagccgggacgaccgccgaagccgcc	CRISPR spacer
cacgaagccgggacgaccgccgacgctgta	Protospacer
  ********************* **.*. 

112. spacer 1.2|2014284|30|NC_016114|CRT matches to NZ_CP033072 (Streptomyces sp. Z022 plasmid unnamed1) position: , mismatch: 6, identity: 0.8

accgaagccgggacgaccgccgaagccgcc	CRISPR spacer
ggggcagccggaacgaccgccgtagccgcc	Protospacer
.  * ******.********** *******

113. spacer 1.2|2014284|30|NC_016114|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 6, identity: 0.8

accgaagccgggacgaccgccgaa--gccgcc	CRISPR spacer
gccgaagccgggccgcccgccgaattgcag--	Protospacer
.*********** ** ********  ** *  

114. spacer 1.2|2014284|30|NC_016114|CRT matches to NZ_CP046575 (Rhodococcus sp. WAY2 plasmid pRWAY03, complete sequence) position: , mismatch: 6, identity: 0.8

accgaagccgggacgaccgccgaagccgcc	CRISPR spacer
cccgaagccgggtcgatcgccgaaccgacc	Protospacer
 *********** ***.******* * .**

115. spacer 6.4|4540928|30|NC_016114|CRT matches to MN047793 (Xanthomonas phage Xoo-sp13, complete genome) position: , mismatch: 6, identity: 0.8

tggtggtactgacggcggtaccgatggtgg	CRISPR spacer
ttgagttactgacggcgttaacgatggtgc	Protospacer
* * * *********** ** ******** 

116. spacer 6.7|4541048|30|NC_016114|CRT matches to MN703407 (Microbacterium phage Leaf, complete genome) position: , mismatch: 6, identity: 0.8

tggtggtgccgacggcggtaccgatggcgg	CRISPR spacer
cgagggtgccgatggcggcaccgatggcgc	Protospacer
.*. ********.*****.********** 

117. spacer 6.7|4541048|30|NC_016114|CRT matches to MN703414 (Microbacterium phage Dewdrop, complete genome) position: , mismatch: 6, identity: 0.8

tggtggtgccgacggcggtaccgatggcgg	CRISPR spacer
cgagggtgccgatggcggcaccgatggcgc	Protospacer
.*. ********.*****.********** 

118. spacer 6.7|4541048|30|NC_016114|CRT matches to NZ_CP041653 (Streptomyces sp. RLB1-9 plasmid pRLB1-9.1, complete sequence) position: , mismatch: 6, identity: 0.8

tggtggtgccgacggcggtaccgatggcgg	CRISPR spacer
cggtggtgccgatggcggtaccggcggagc	Protospacer
.***********.**********..** * 

119. spacer 6.7|4541048|30|NC_016114|CRT matches to MH616681 (Microviridae sp. isolate ctdb173, complete genome) position: , mismatch: 6, identity: 0.8

tggtggtgccgacggcggtaccgatggcgg	CRISPR spacer
tgggaccgccgagggcggtaccgagggcgg	Protospacer
*** . .***** *********** *****

120. spacer 6.7|4541048|30|NC_016114|CRT matches to NZ_CP034394 (Herbaspirillum seropedicae strain AU13965 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

tggtggtgccgacggcggtaccgatggcgg	CRISPR spacer
tggtggtgccgacgccggtatcggacgagg	Protospacer
************** *****.**.  * **

121. spacer 6.7|4541048|30|NC_016114|CRT matches to NC_008195 (Mycobacterium phage Cooper, complete genome) position: , mismatch: 6, identity: 0.8

tggtggtgccgacggcggtaccgatggcgg	CRISPR spacer
tggtggtgccaacggcggtagcgccagctg	Protospacer
**********.********* ** ..** *

122. spacer 6.9|4541132|30|NC_016114|CRT matches to NZ_HG938354 (Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence) position: , mismatch: 6, identity: 0.8

tggcggg--accgacggtgggaccgatggcgg	CRISPR spacer
--gccgatcaccgagggtgggatcgatggcgg	Protospacer
  ** *.  ***** *******.*********

123. spacer 1.2|2014284|30|NC_016114|CRT matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 7, identity: 0.767

accgaagccgggacgaccgccgaagccgcc	CRISPR spacer
catgccgccgggaccaccgccgaagcggcc	Protospacer
  .*  ******** *********** ***

124. spacer 1.2|2014284|30|NC_016114|CRT matches to NZ_CP041349 (Komagataeibacter xylinus strain CGMCC 17276 plasmid pA, complete sequence) position: , mismatch: 7, identity: 0.767

accgaagccgggacgaccgccgaagccgcc	CRISPR spacer
gctggtaccgggaagaccgccgatgccgcc	Protospacer
.*.*. .****** ********* ******

125. spacer 1.2|2014284|30|NC_016114|CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.767

accgaagccgggacgaccgccgaagccgcc	CRISPR spacer
acaagcgccgggacgaccgccgcagcccgc	Protospacer
** .. **************** ****  *

126. spacer 1.2|2014284|30|NC_016114|CRT matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.767

accgaagccgggacgaccgccgaagccgcc	CRISPR spacer
gtcggtcccgtgacgaacgccgaagccgcc	Protospacer
..**.  *** ***** *************

127. spacer 1.2|2014284|30|NC_016114|CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

accgaagccgggacgaccgccgaagccgcc	CRISPR spacer
gtcggtcccgtgacgaacgccgaagccgcc	Protospacer
..**.  *** ***** *************

128. spacer 1.2|2014284|30|NC_016114|CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 7, identity: 0.767

accgaagccgggacgaccgccgaagccgcc	CRISPR spacer
acaagcgccgggacgaccgccgcagcccgc	Protospacer
** .. **************** ****  *

129. spacer 1.2|2014284|30|NC_016114|CRT matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 7, identity: 0.767

accgaagccgggacgaccgccgaagccgcc	CRISPR spacer
tgcaaggccgcgacgaccgcggaagccgct	Protospacer
  *.*.**** ********* ********.

130. spacer 1.2|2014284|30|NC_016114|CRT matches to NZ_CP042332 (Bosea sp. F3-2 plasmid pB32-1, complete sequence) position: , mismatch: 7, identity: 0.767

accgaagccgggacgaccgccgaagccgcc	CRISPR spacer
tccgaagccgcgacgaccgccgcgccggcg	Protospacer
 ********* *********** . * ** 

131. spacer 4.1|2588304|29|NC_016114|CRISPRCasFinder matches to NZ_KY349138 (Mycolicibacterium sp. CBMA 213 plasmid pCBMA213_2, complete sequence) position: , mismatch: 7, identity: 0.759

gaggagcgctgcgcgccgccctaccgcca	CRISPR spacer
tggctgcgctgcgagccgcgctaccgccg	Protospacer
 .*  ******** ***** ********.

132. spacer 4.1|2588304|29|NC_016114|CRISPRCasFinder matches to MN103533 (Mycobacterium phage Weirdo19, complete genome) position: , mismatch: 7, identity: 0.759

gaggagcgctgcgcgccgccctaccgcca	CRISPR spacer
gaggagcgcagcgcgccgcccatgagcgg	Protospacer
********* ***********    ** .

133. spacer 6.7|4541048|30|NC_016114|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 7, identity: 0.767

tggtggtgccgacggcggtaccgatggcgg	CRISPR spacer
aacggctgccgacggcggttccgatgccgg	Protospacer
 .  * ************* ****** ***

134. spacer 6.7|4541048|30|NC_016114|CRT matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767

tggtggtgccgacggcggtaccgatggcgg	CRISPR spacer
tcagcgcgccgacgccggcaccgatggcgg	Protospacer
* .  *.******* ***.***********

135. spacer 6.7|4541048|30|NC_016114|CRT matches to NZ_CP016620 (Microvirga ossetica strain V5/3m plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.767

tggtggtgccgacggcggtaccgatggcgg	CRISPR spacer
ggatcaggccgacggccgttccgatggcgg	Protospacer
 *.* . ********* ** **********

136. spacer 6.7|4541048|30|NC_016114|CRT matches to CP003952 (Rhodococcus opacus PD630 plasmid 3, complete sequence) position: , mismatch: 7, identity: 0.767

tggtggtgccgacggcggtaccgatggcgg	CRISPR spacer
cgccgaagccgacagcggtaccggtggcgg	Protospacer
.* .*. ******.*********.******

137. spacer 6.7|4541048|30|NC_016114|CRT matches to NZ_CP016463 (Bosea sp. RAC05 plasmid pBSY19_1, complete sequence) position: , mismatch: 7, identity: 0.767

tggtggtgccgacggcggtaccgatggcgg	CRISPR spacer
cggacatgccgacggcgggaccgacggcgc	Protospacer
.**  .************ *****.**** 

138. spacer 6.7|4541048|30|NC_016114|CRT matches to NC_023286 (Streptomyces sp. F12 plasmid pFRL6, complete sequence) position: , mismatch: 7, identity: 0.767

tggtggtgccgacggcggtaccgatggcgg	CRISPR spacer
gcgagaggccgacggcgagaccgatggcgg	Protospacer
  * *. **********. ***********

139. spacer 1.2|2014284|30|NC_016114|CRT matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 8, identity: 0.733

accgaagccgggacgaccgccgaagccgcc	CRISPR spacer
caggaagccggcaccaccgccgaagccaag	Protospacer
   ******** ** ************.  

140. spacer 1.2|2014284|30|NC_016114|CRT matches to NZ_AP014706 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_2p, complete sequence) position: , mismatch: 8, identity: 0.733

accgaagccgggacgaccgccgaagccgcc	CRISPR spacer
cacaggcccggggggaccgccgaagccgcc	Protospacer
  *... *****. ****************

141. spacer 1.2|2014284|30|NC_016114|CRT matches to MH020238 (Mycobacterium phage Lilith, complete genome) position: , mismatch: 8, identity: 0.733

accgaagccgggacgaccgccgaagccgcc	CRISPR spacer
cgtgccgccgagacgaccgccgaagcggcg	Protospacer
  .*  ****.*************** ** 

142. spacer 1.2|2014284|30|NC_016114|CRT matches to MH077583 (Mycobacterium phage PGHhamlin, complete genome) position: , mismatch: 8, identity: 0.733

accgaagccgggacgaccgccgaagccgcc	CRISPR spacer
cgtgccgccgagacgaccgccgaagcggcg	Protospacer
  .*  ****.*************** ** 

143. spacer 1.2|2014284|30|NC_016114|CRT matches to MT897907 (Mycobacterium phage Grif, complete genome) position: , mismatch: 8, identity: 0.733

accgaagccgggacgaccgccgaagccgcc	CRISPR spacer
cgtgccgccgagacgaccgccgaagcggcg	Protospacer
  .*  ****.*************** ** 

144. spacer 1.2|2014284|30|NC_016114|CRT matches to MH727554 (Mycobacterium phage MuchMore, complete genome) position: , mismatch: 8, identity: 0.733

accgaagccgggacgaccgccgaagccgcc	CRISPR spacer
cgtgccgccgagacgaccgccgaagcggcg	Protospacer
  .*  ****.*************** ** 

145. spacer 1.2|2014284|30|NC_016114|CRT matches to MH338240 (Mycobacterium phage Sabia, complete genome) position: , mismatch: 8, identity: 0.733

accgaagccgggacgaccgccgaagccgcc	CRISPR spacer
cgtgccgccgagacgaccgccgaagcggcg	Protospacer
  .*  ****.*************** ** 

146. spacer 1.2|2014284|30|NC_016114|CRT matches to KM233455 (Mycobacterium phage Farber, complete genome) position: , mismatch: 8, identity: 0.733

accgaagccgggacgaccgccgaagccgcc	CRISPR spacer
cgtgccgccgagacgaccgccgaagcggcg	Protospacer
  .*  ****.*************** ** 

147. spacer 1.2|2014284|30|NC_016114|CRT matches to KX664448 (Mycobacterium phage Watson, complete genome) position: , mismatch: 8, identity: 0.733

accgaagccgggacgaccgccgaagccgcc	CRISPR spacer
cgtgccgccgagacgaccgccgaagcggcg	Protospacer
  .*  ****.*************** ** 

148. spacer 1.2|2014284|30|NC_016114|CRT matches to MH576949 (Mycobacterium phage BreSam8, complete genome) position: , mismatch: 8, identity: 0.733

accgaagccgggacgaccgccgaagccgcc	CRISPR spacer
cgtgccgccgagacgaccgccgaagcggcg	Protospacer
  .*  ****.*************** ** 

149. spacer 1.2|2014284|30|NC_016114|CRT matches to NC_021535 (Mycobacterium phage Jobu08, complete genome) position: , mismatch: 8, identity: 0.733

accgaagccgggacgaccgccgaagccgcc	CRISPR spacer
cgtgccgccgagacgaccgccgaagcggcg	Protospacer
  .*  ****.*************** ** 

150. spacer 1.2|2014284|30|NC_016114|CRT matches to MH536813 (Mycobacterium phage AugsMagnumOpus, complete genome) position: , mismatch: 8, identity: 0.733

accgaagccgggacgaccgccgaagccgcc	CRISPR spacer
cgtgccgccgagacgaccgccgaagcggcg	Protospacer
  .*  ****.*************** ** 

151. spacer 1.2|2014284|30|NC_016114|CRT matches to MF185733 (Mycobacterium phage StepMih, complete genome) position: , mismatch: 8, identity: 0.733

accgaagccgggacgaccgccgaagccgcc	CRISPR spacer
cgtgccgccgagacgaccgccgaagcggcg	Protospacer
  .*  ****.*************** ** 

152. spacer 1.2|2014284|30|NC_016114|CRT matches to MF185732 (Mycobacterium phage Stagni, complete genome) position: , mismatch: 8, identity: 0.733

accgaagccgggacgaccgccgaagccgcc	CRISPR spacer
cgtgccgccgagacgaccgccgaagcggcg	Protospacer
  .*  ****.*************** ** 

153. spacer 1.2|2014284|30|NC_016114|CRT matches to MK494096 (Mycobacterium phage Mainiac, complete genome) position: , mismatch: 8, identity: 0.733

accgaagccgggacgaccgccgaagccgcc	CRISPR spacer
cgtgccgccgagacgaccgccgaagcggcg	Protospacer
  .*  ****.*************** ** 

154. spacer 1.2|2014284|30|NC_016114|CRT matches to KU984914 (Mycobacterium phage Malinsilva, complete genome) position: , mismatch: 8, identity: 0.733

accgaagccgggacgaccgccgaagccgcc	CRISPR spacer
cgtgccgccgagacgaccgccgaagcggcg	Protospacer
  .*  ****.*************** ** 

155. spacer 1.2|2014284|30|NC_016114|CRT matches to JF704101 (Mycobacterium virus Microwolf, complete genome) position: , mismatch: 8, identity: 0.733

accgaagccgggacgaccgccgaagccgcc	CRISPR spacer
cgtgccgccgagacgaccgccgaagcggcg	Protospacer
  .*  ****.*************** ** 

156. spacer 1.2|2014284|30|NC_016114|CRT matches to MN062718 (Mycobacterium phage SoilDragon, complete genome) position: , mismatch: 8, identity: 0.733

accgaagccgggacgaccgccgaagccgcc	CRISPR spacer
cgtgccgccgagacgaccgccgaagcggcg	Protospacer
  .*  ****.*************** ** 

157. spacer 1.2|2014284|30|NC_016114|CRT matches to KT359365 (Mycobacterium phage DaHudson, complete genome) position: , mismatch: 8, identity: 0.733

accgaagccgggacgaccgccgaagccgcc	CRISPR spacer
cgtgccgccgagacgaccgccgaagcggcg	Protospacer
  .*  ****.*************** ** 

158. spacer 1.2|2014284|30|NC_016114|CRT matches to MH651179 (Mycobacterium phage MadMarie, complete genome) position: , mismatch: 8, identity: 0.733

accgaagccgggacgaccgccgaagccgcc	CRISPR spacer
cgtgccgccgagacgaccgccgaagcggcg	Protospacer
  .*  ****.*************** ** 

159. spacer 5.2|3471746|35|NC_016114|CRISPRCasFinder matches to NZ_LR134460 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 18, complete sequence) position: , mismatch: 8, identity: 0.771

cacggtcg-tcacgacggtcgccacggtcgtcacga	CRISPR spacer
-gcgcctgctcgcgacggtcgccacggttgtcacgc	Protospacer
 .** ..* **.****************.****** 

160. spacer 6.7|4541048|30|NC_016114|CRT matches to NZ_CP019585 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence) position: , mismatch: 8, identity: 0.733

tggtggtgccgacggcggtaccgatggcgg	CRISPR spacer
tcaaaatgccgacggcggccccgatggcga	Protospacer
* . ..************. *********.

161. spacer 6.7|4541048|30|NC_016114|CRT matches to NC_017327 (Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence) position: , mismatch: 8, identity: 0.733

tggtggtgccgacggcggtaccgatggcgg	CRISPR spacer
tcaaaatgccgacggcggccccgatggcga	Protospacer
* . ..************. *********.

162. spacer 6.7|4541048|30|NC_016114|CRT matches to NZ_CP009145 (Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence) position: , mismatch: 8, identity: 0.733

tggtggtgccgacggcggtaccgatggcgg	CRISPR spacer
tcaaaatgccgacggcggccccgatggcga	Protospacer
* . ..************. *********.

163. spacer 6.7|4541048|30|NC_016114|CRT matches to NZ_CP021827 (Sinorhizobium meliloti strain KH35c plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.733

tggtggtgccgacggcggtaccgatggcgg	CRISPR spacer
tcaaaatgccgacggcggccccgatggcga	Protospacer
* . ..************. *********.

164. spacer 6.7|4541048|30|NC_016114|CRT matches to NZ_CP021827 (Sinorhizobium meliloti strain KH35c plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.733

tggtggtgccgacggcggtaccgatggcgg	CRISPR spacer
tcaaaatgccgacggcggccccgatggcga	Protospacer
* . ..************. *********.

165. spacer 6.7|4541048|30|NC_016114|CRT matches to NZ_CP021801 (Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.733

tggtggtgccgacggcggtaccgatggcgg	CRISPR spacer
tcaaaatgccgacggcggccccgatggcga	Protospacer
* . ..************. *********.

166. spacer 6.7|4541048|30|NC_016114|CRT matches to NZ_CP021819 (Sinorhizobium meliloti strain M162 plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.733

tggtggtgccgacggcggtaccgatggcgg	CRISPR spacer
tcaaaatgccgacggcggccccgatggcga	Protospacer
* . ..************. *********.

167. spacer 6.7|4541048|30|NC_016114|CRT matches to NZ_CP021830 (Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.733

tggtggtgccgacggcggtaccgatggcgg	CRISPR spacer
tcaaaatgccgacggcggccccgatggcga	Protospacer
* . ..************. *********.

168. spacer 6.7|4541048|30|NC_016114|CRT matches to NZ_CP021824 (Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.733

tggtggtgccgacggcggtaccgatggcgg	CRISPR spacer
tcaaaatgccgacggcggccccgatggcga	Protospacer
* . ..************. *********.

169. spacer 6.7|4541048|30|NC_016114|CRT matches to NC_018683 (Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence) position: , mismatch: 8, identity: 0.733

tggtggtgccgacggcggtaccgatggcgg	CRISPR spacer
tcaaaatgccgacggcggccccgatggcga	Protospacer
* . ..************. *********.

170. spacer 6.7|4541048|30|NC_016114|CRT matches to NZ_CP021809 (Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.733

tggtggtgccgacggcggtaccgatggcgg	CRISPR spacer
tcaaaatgccgacggcggccccgatggcga	Protospacer
* . ..************. *********.

171. spacer 6.7|4541048|30|NC_016114|CRT matches to NZ_CP021217 (Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence) position: , mismatch: 8, identity: 0.733

tggtggtgccgacggcggtaccgatggcgg	CRISPR spacer
tcaaaatgccgacggcggccccgatggcga	Protospacer
* . ..************. *********.

172. spacer 6.7|4541048|30|NC_016114|CRT matches to MH884510 (Exiguobacterium phage vB_EalM-137, complete genome) position: , mismatch: 8, identity: 0.733

tggtggtgccgacggcggtaccgatggcgg	CRISPR spacer
cgaccgccgcgatggcggtaccgatggcgg	Protospacer
.*.. *.  ***.*****************

173. spacer 6.7|4541048|30|NC_016114|CRT matches to NC_017324 (Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence) position: , mismatch: 8, identity: 0.733

tggtggtgccgacggcggtaccgatggcgg	CRISPR spacer
tcaaaatgccgacggcggccccgatggcga	Protospacer
* . ..************. *********.

174. spacer 6.7|4541048|30|NC_016114|CRT matches to NZ_CP021813 (Sinorhizobium meliloti strain M270 plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.733

tggtggtgccgacggcggtaccgatggcgg	CRISPR spacer
tcaaaatgccgacggcggccccgatggcga	Protospacer
* . ..************. *********.

175. spacer 6.7|4541048|30|NC_016114|CRT matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.733

tggtggtgccgacggcggtaccgatggcgg	CRISPR spacer
tcaaaatgccgacggcggccccgatggcga	Protospacer
* . ..************. *********.

176. spacer 1.2|2014284|30|NC_016114|CRT matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.7

accgaagccgggacgaccgccgaagccgcc	CRISPR spacer
gaaagcggcgggacgaccgccgaaggcgct	Protospacer
.  .. * ***************** ***.

177. spacer 1.2|2014284|30|NC_016114|CRT matches to NZ_LR134446 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 4, complete sequence) position: , mismatch: 9, identity: 0.7

accgaagccgggacgaccgccgaagccgcc	CRISPR spacer
gtgccagccgggaccaccgccgaagcgatc	Protospacer
..   ********* *********** ..*

178. spacer 1.2|2014284|30|NC_016114|CRT matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.7

accgaagccgggacgaccgccgaagccgcc	CRISPR spacer
gaaagcggcgggacgaccgccgaaggcgct	Protospacer
.  .. * ***************** ***.

179. spacer 1.2|2014284|30|NC_016114|CRT matches to NZ_CP015609 (Bacillus safensis strain U14-5 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.7

accgaagccgggacgaccgccgaagccgcc	CRISPR spacer
cgcgaagccggaactaccgccgaagggcag	Protospacer
  *********.** **********     

180. spacer 1.2|2014284|30|NC_016114|CRT matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.7

accgaagccgggacgaccgccgaagccgcc	CRISPR spacer
gaaagcggcgggacgaccgccgaaggcgct	Protospacer
.  .. * ***************** ***.

181. spacer 1.2|2014284|30|NC_016114|CRT matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.7

accgaagccgggacgaccgccgaagccgcc	CRISPR spacer
gaaagcggcgggacgaccgccgaaggcgct	Protospacer
.  .. * ***************** ***.

182. spacer 1.2|2014284|30|NC_016114|CRT matches to NZ_CP025188 (Roseomonas mucosa strain AD2 plasmid p1-AD2, complete sequence) position: , mismatch: 9, identity: 0.7

accgaagccgggacgaccgccgaagccgcc	CRISPR spacer
cgcgaagccggaactaccgccgaagggcag	Protospacer
  *********.** **********     

183. spacer 1.2|2014284|30|NC_016114|CRT matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.7

accgaagccgggacgaccgccgaagccgcc	CRISPR spacer
gaaagcggcgggacgaccgccgaaggcgct	Protospacer
.  .. * ***************** ***.

184. spacer 1.2|2014284|30|NC_016114|CRT matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.7

accgaagccgggacgaccgccgaagccgcc	CRISPR spacer
gaaagcggcgggacgaccgccgaaggcgct	Protospacer
.  .. * ***************** ***.

185. spacer 1.2|2014284|30|NC_016114|CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.7

accgaagccgggacgaccgccgaagccgcc	CRISPR spacer
gaaagcggcgggacgaccgccgaaggcgct	Protospacer
.  .. * ***************** ***.

186. spacer 6.7|4541048|30|NC_016114|CRT matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tggtggtgccgacggcggtaccgatggcgg	CRISPR spacer
gcatggtgccgacggcggtgccgacgaaac	Protospacer
  .****************.****.*. . 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 5813491 : 5820419 8 Streptomyces_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_016110
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_016110_1 44664-45059 Orphan NA:I-E
6 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_016110_2 52111-52875 Orphan N:A
12 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_016110_3 133924-134626 TypeI-E N:A
11 spacers
cas3,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_016110_4 144274-145340 TypeI-E N:A
17 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_016110_2 2.11|52754|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 52754-52785 32 NC_016114.1 2431806-2431837 0 1.0

1. spacer 2.11|52754|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to position: 2431806-2431837, mismatch: 0, identity: 1.0

atccggtgtccggacccgaggtggcgtcctcg	CRISPR spacer
atccggtgtccggacccgaggtggcgtcctcg	Protospacer
********************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_016110_1 1.1|44694|31|NC_016110|CRISPRCasFinder 44694-44724 31 NC_016110 Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence 44694-44724 0 1.0
NC_016110_1 1.2|44755|31|NC_016110|CRISPRCasFinder 44755-44785 31 NC_016110 Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence 44755-44785 0 1.0
NC_016110_1 1.3|44816|31|NC_016110|CRISPRCasFinder 44816-44846 31 NC_016110 Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence 44816-44846 0 1.0
NC_016110_1 1.4|44877|31|NC_016110|CRISPRCasFinder 44877-44907 31 NC_016110 Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence 44877-44907 0 1.0
NC_016110_1 1.5|44938|31|NC_016110|CRISPRCasFinder 44938-44968 31 NC_016110 Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence 44938-44968 0 1.0
NC_016110_1 1.6|44999|31|NC_016110|CRISPRCasFinder 44999-45029 31 NC_016110 Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence 44999-45029 0 1.0
NC_016110_1 1.7|44693|39|NC_016110|CRT 44693-44731 39 NC_016110 Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence 44693-44731 0 1.0
NC_016110_1 1.8|44754|39|NC_016110|CRT 44754-44792 39 NC_016110 Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence 44754-44792 0 1.0
NC_016110_1 1.9|44815|39|NC_016110|CRT 44815-44853 39 NC_016110 Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence 44815-44853 0 1.0
NC_016110_1 1.10|44876|39|NC_016110|CRT 44876-44914 39 NC_016110 Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence 44876-44914 0 1.0
NC_016110_1 1.11|44937|39|NC_016110|CRT 44937-44975 39 NC_016110 Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence 44937-44975 0 1.0
NC_016110_1 1.12|44998|39|NC_016110|CRT 44998-45036 39 NC_016110 Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence 44998-45036 0 1.0
NC_016110_1 1.13|44754|32|NC_016110|PILER-CR 44754-44785 32 NC_016110 Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence 44754-44785 0 1.0
NC_016110_1 1.14|44815|32|NC_016110|PILER-CR 44815-44846 32 NC_016110 Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence 44815-44846 0 1.0
NC_016110_1 1.15|44876|32|NC_016110|PILER-CR 44876-44907 32 NC_016110 Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence 44876-44907 0 1.0
NC_016110_1 1.16|44937|32|NC_016110|PILER-CR 44937-44968 32 NC_016110 Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence 44937-44968 0 1.0
NC_016110_1 1.17|44998|32|NC_016110|PILER-CR 44998-45029 32 NC_016110 Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence 44998-45029 0 1.0
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 NC_016110 Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence 52140-52169 0 1.0
NC_016110_2 2.2|52199|32|NC_016110|CRISPRCasFinder,CRT 52199-52230 32 NC_016110 Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence 52199-52230 0 1.0
NC_016110_2 2.3|52260|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 52260-52291 32 NC_016110 Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence 52260-52291 0 1.0
NC_016110_2 2.4|52321|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 52321-52352 32 NC_021056 Streptomyces sp. PAMC 26508 plasmid pSP01, complete sequence 51166-51197 0 1.0
NC_016110_2 2.4|52321|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 52321-52352 32 NC_016110 Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence 52321-52352 0 1.0
NC_016110_2 2.5|52382|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 52382-52413 32 NC_016110 Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence 52382-52413 0 1.0
NC_016110_2 2.6|52443|38|NC_016110|CRISPRCasFinder,CRT,PILER-CR 52443-52480 38 NC_016110 Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence 52443-52480 0 1.0
NC_016110_2 2.7|52510|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 52510-52541 32 NC_016110 Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence 52510-52541 0 1.0
NC_016110_2 2.8|52571|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 52571-52602 32 NC_016110 Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence 52571-52602 0 1.0
NC_016110_2 2.9|52632|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 52632-52663 32 NC_016110 Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence 52632-52663 0 1.0
NC_016110_2 2.10|52693|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 52693-52724 32 NC_016110 Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence 52693-52724 0 1.0
NC_016110_2 2.11|52754|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 52754-52785 32 NC_016110 Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence 52754-52785 0 1.0
NC_016110_2 2.12|52815|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 52815-52846 32 NC_016110 Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence 52815-52846 0 1.0
NC_016110_3 3.1|133953|35|NC_016110|CRISPRCasFinder,CRT 133953-133987 35 NC_016110 Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence 133953-133987 0 1.0
NC_016110_3 3.1|133953|35|NC_016110|CRISPRCasFinder,CRT 133953-133987 35 NZ_CP038146 Streptomyces sp. S501 plasmid unnamed, complete sequence 107193-107227 0 1.0
NC_016110_3 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT 134017-134048 32 NC_016110 Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence 134017-134048 0 1.0
NC_016110_3 3.3|134078|32|NC_016110|CRISPRCasFinder,CRT 134078-134109 32 NC_016110 Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence 134078-134109 0 1.0
NC_016110_3 3.4|134139|32|NC_016110|CRISPRCasFinder,CRT 134139-134170 32 NC_016110 Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence 134139-134170 0 1.0
NC_016110_3 3.5|134200|32|NC_016110|CRISPRCasFinder,CRT 134200-134231 32 NC_016110 Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence 134200-134231 0 1.0
NC_016110_3 3.6|134261|32|NC_016110|CRISPRCasFinder,CRT 134261-134292 32 NC_016110 Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence 134261-134292 0 1.0
NC_016110_3 3.7|134322|32|NC_016110|CRISPRCasFinder,CRT 134322-134353 32 NC_016110 Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence 134322-134353 0 1.0
NC_016110_3 3.8|134383|32|NC_016110|CRISPRCasFinder,CRT 134383-134414 32 NC_016110 Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence 134383-134414 0 1.0
NC_016110_3 3.9|134444|32|NC_016110|CRISPRCasFinder,CRT 134444-134475 32 NC_016110 Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence 134444-134475 0 1.0
NC_016110_3 3.10|134505|32|NC_016110|CRISPRCasFinder,CRT 134505-134536 32 NC_016110 Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence 134505-134536 0 1.0
NC_016110_3 3.11|134566|32|NC_016110|CRISPRCasFinder,CRT 134566-134597 32 NC_016110 Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence 134566-134597 0 1.0
NC_016110_3 3.12|134261|33|NC_016110|PILER-CR 134261-134293 33 NC_016110 Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence 134261-134293 0 1.0
NC_016110_3 3.13|134322|33|NC_016110|PILER-CR 134322-134354 33 NC_016110 Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence 134322-134354 0 1.0
NC_016110_3 3.14|134383|33|NC_016110|PILER-CR 134383-134415 33 NC_016110 Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence 134383-134415 0 1.0
NC_016110_3 3.15|134444|33|NC_016110|PILER-CR 134444-134476 33 NC_016110 Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence 134444-134476 0 1.0
NC_016110_3 3.16|134505|33|NC_016110|PILER-CR 134505-134537 33 NC_016110 Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence 134505-134537 0 1.0
NC_016110_3 3.17|134566|33|NC_016110|PILER-CR 134566-134598 33 NC_016110 Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence 134566-134598 0 1.0
NC_016110_4 4.1|144303|32|NC_016110|PILER-CR,CRISPRCasFinder,CRT 144303-144334 32 NC_016110 Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence 144303-144334 0 1.0
NC_016110_4 4.2|144364|32|NC_016110|PILER-CR,CRISPRCasFinder,CRT 144364-144395 32 NC_016110 Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence 144364-144395 0 1.0
NC_016110_4 4.3|144425|32|NC_016110|PILER-CR,CRISPRCasFinder,CRT 144425-144456 32 NC_016110 Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence 144425-144456 0 1.0
NC_016110_4 4.4|144486|32|NC_016110|PILER-CR,CRISPRCasFinder,CRT 144486-144517 32 NC_016110 Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence 144486-144517 0 1.0
NC_016110_4 4.5|144547|32|NC_016110|CRISPRCasFinder,CRT 144547-144578 32 NC_016110 Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence 144547-144578 0 1.0
NC_016110_4 4.6|144608|32|NC_016110|CRISPRCasFinder,CRT 144608-144639 32 NC_016110 Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence 144608-144639 0 1.0
NC_016110_4 4.7|144669|32|NC_016110|CRISPRCasFinder,CRT 144669-144700 32 NC_016110 Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence 144669-144700 0 1.0
NC_016110_4 4.8|144730|32|NC_016110|CRISPRCasFinder,CRT 144730-144761 32 NC_016110 Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence 144730-144761 0 1.0
NC_016110_4 4.9|144791|32|NC_016110|CRISPRCasFinder,CRT 144791-144822 32 NC_016110 Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence 144791-144822 0 1.0
NC_016110_4 4.9|144791|32|NC_016110|CRISPRCasFinder,CRT 144791-144822 32 NC_016110 Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence 144913-144944 0 1.0
NC_016110_4 4.10|144852|32|NC_016110|CRISPRCasFinder,CRT 144852-144883 32 NC_016110 Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence 144852-144883 0 1.0
NC_016110_4 4.10|144852|32|NC_016110|CRISPRCasFinder,CRT 144852-144883 32 NC_016110 Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence 144974-145005 0 1.0
NC_016110_4 4.11|144913|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 144913-144944 32 NC_016110 Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence 144791-144822 0 1.0
NC_016110_4 4.11|144913|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 144913-144944 32 NC_016110 Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence 144913-144944 0 1.0
NC_016110_4 4.12|144974|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 144974-145005 32 NC_016110 Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence 144852-144883 0 1.0
NC_016110_4 4.12|144974|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 144974-145005 32 NC_016110 Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence 144974-145005 0 1.0
NC_016110_4 4.13|145035|33|NC_016110|CRISPRCasFinder,CRT,PILER-CR 145035-145067 33 NC_016110 Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence 145035-145067 0 1.0
NC_016110_4 4.14|145097|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 145097-145128 32 NC_016110 Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence 145097-145128 0 1.0
NC_016110_4 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 145158-145189 32 NC_016110 Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence 145158-145189 0 1.0
NC_016110_4 4.16|145219|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 145219-145250 32 NC_016110 Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence 145219-145250 0 1.0
NC_016110_4 4.17|145280|32|NC_016110|CRISPRCasFinder,CRT 145280-145311 32 NC_016110 Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence 145280-145311 0 1.0
NC_016110_4 4.17|145280|32|NC_016110|CRISPRCasFinder,CRT 145280-145311 32 NZ_CP038146 Streptomyces sp. S501 plasmid unnamed, complete sequence 95181-95212 0 1.0
NC_016110_3 3.5|134200|32|NC_016110|CRISPRCasFinder,CRT 134200-134231 32 NC_001387 Streptomyces lividans plasmid pIJ101, complete sequence 4363-4394 2 0.938
NC_016110_1 1.3|44816|31|NC_016110|CRISPRCasFinder 44816-44846 31 NZ_CP052758 Cellulosimicrobium sp. BI34T plasmid pCPRO01, complete sequence 113784-113814 3 0.903
NC_016110_1 1.14|44815|32|NC_016110|PILER-CR 44815-44846 32 NZ_CP052758 Cellulosimicrobium sp. BI34T plasmid pCPRO01, complete sequence 113783-113814 3 0.906
NC_016110_3 3.10|134505|32|NC_016110|CRISPRCasFinder,CRT 134505-134536 32 NZ_CP048398 Streptomyces sp. S4.7 plasmid pSSPS4.7a, complete sequence 3387-3418 3 0.906
NC_016110_3 3.16|134505|33|NC_016110|PILER-CR 134505-134537 33 NZ_CP048398 Streptomyces sp. S4.7 plasmid pSSPS4.7a, complete sequence 3386-3418 3 0.909
NC_016110_1 1.5|44938|31|NC_016110|CRISPRCasFinder 44938-44968 31 NC_049489 Arthrobacter phage DrYang, complete genome 2006-2036 4 0.871
NC_016110_1 1.16|44937|32|NC_016110|PILER-CR 44937-44968 32 NC_049489 Arthrobacter phage DrYang, complete genome 2006-2037 4 0.875
NC_016110_2 2.2|52199|32|NC_016110|CRISPRCasFinder,CRT 52199-52230 32 KY092484 Streptomyces phage Raleigh, complete genome 8298-8329 4 0.875
NC_016110_1 1.3|44816|31|NC_016110|CRISPRCasFinder 44816-44846 31 NZ_LR134460 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 18, complete sequence 319871-319901 5 0.839
NC_016110_1 1.5|44938|31|NC_016110|CRISPRCasFinder 44938-44968 31 NZ_CP015008 Aminobacter aminovorans strain KCTC 2477 plasmid pAA03, complete sequence 22453-22483 5 0.839
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 335201-335230 5 0.833
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 1782656-1782685 5 0.833
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 341676-341705 5 0.833
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 1647959-1647988 5 0.833
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 123152-123181 5 0.833
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 19611-19640 5 0.833
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 97765-97794 5 0.833
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 788976-789005 5 0.833
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 1803904-1803933 5 0.833
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 1785960-1785989 5 0.833
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 1785960-1785989 5 0.833
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 289562-289591 5 0.833
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 309974-310003 5 0.833
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 292703-292732 5 0.833
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 354048-354077 5 0.833
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 446128-446157 5 0.833
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 2020542-2020571 5 0.833
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 294829-294858 5 0.833
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 904787-904816 5 0.833
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 1283905-1283934 5 0.833
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 293962-293991 5 0.833
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 NZ_CP022773 Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence 303076-303105 5 0.833
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 290735-290764 5 0.833
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 183657-183686 5 0.833
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 289818-289847 5 0.833
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 306774-306803 5 0.833
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 287018-287047 5 0.833
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 290978-291007 5 0.833
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 293979-294008 5 0.833
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 306774-306803 5 0.833
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 308438-308467 5 0.833
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 292743-292772 5 0.833
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 306773-306802 5 0.833
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 354106-354135 5 0.833
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 285600-285629 5 0.833
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 308438-308467 5 0.833
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 292743-292772 5 0.833
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 306774-306803 5 0.833
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 308438-308467 5 0.833
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 285603-285632 5 0.833
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 308438-308467 5 0.833
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 292743-292772 5 0.833
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 292743-292772 5 0.833
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 292743-292772 5 0.833
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 306774-306803 5 0.833
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 306774-306803 5 0.833
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 285603-285632 5 0.833
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 303059-303088 5 0.833
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 303029-303058 5 0.833
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 297580-297609 5 0.833
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 295709-295738 5 0.833
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 291254-291283 5 0.833
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 306774-306803 5 0.833
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 285603-285632 5 0.833
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 308438-308467 5 0.833
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 355520-355549 5 0.833
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 306768-306797 5 0.833
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 285603-285632 5 0.833
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 285603-285632 5 0.833
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 306774-306803 5 0.833
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 292743-292772 5 0.833
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 306774-306803 5 0.833
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 306774-306803 5 0.833
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 NZ_CP019938 Ketogulonicigenium robustum strain SPU_B003 plasmid unnamed1, complete sequence 129197-129226 5 0.833
NC_016110_2 2.2|52199|32|NC_016110|CRISPRCasFinder,CRT 52199-52230 32 NZ_CP034352 Streptomyces sp. W1SF4 plasmid p2, complete sequence 31634-31665 5 0.844
NC_016110_2 2.4|52321|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 52321-52352 32 NC_009507 Sphingomonas wittichii RW1 plasmid pSWIT01, complete sequence 193446-193477 5 0.844
NC_016110_3 3.7|134322|32|NC_016110|CRISPRCasFinder,CRT 134322-134353 32 MN657146 Cryobacterium sp. strain ANT_H28B plasmid pA28BH2, complete sequence 604-635 5 0.844
NC_016110_3 3.13|134322|33|NC_016110|PILER-CR 134322-134354 33 MN657146 Cryobacterium sp. strain ANT_H28B plasmid pA28BH2, complete sequence 604-636 5 0.848
NC_016110_1 1.3|44816|31|NC_016110|CRISPRCasFinder 44816-44846 31 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 1043079-1043109 6 0.806
NC_016110_1 1.3|44816|31|NC_016110|CRISPRCasFinder 44816-44846 31 NC_013858 Azospirillum sp. B510 plasmid pAB510d, complete sequence 23956-23986 6 0.806
NC_016110_1 1.3|44816|31|NC_016110|CRISPRCasFinder 44816-44846 31 NC_023136 Leisingera methylohalidivorans DSM 14336 plasmid unnamed, complete sequence 264963-264993 6 0.806
NC_016110_1 1.6|44999|31|NC_016110|CRISPRCasFinder 44999-45029 31 NZ_CP021356 Rhodococcus sp. S2-17 plasmid pRB29, complete sequence 46529-46559 6 0.806
NC_016110_1 1.6|44999|31|NC_016110|CRISPRCasFinder 44999-45029 31 NZ_CP023408 Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence 182615-182645 6 0.806
NC_016110_1 1.6|44999|31|NC_016110|CRISPRCasFinder 44999-45029 31 NZ_CP021083 Deinococcus ficus strain CC-FR2-10 plasmid pDFI2, complete sequence 43232-43262 6 0.806
NC_016110_1 1.9|44815|39|NC_016110|CRT 44815-44853 39 NZ_CP052758 Cellulosimicrobium sp. BI34T plasmid pCPRO01, complete sequence 113783-113821 6 0.846
NC_016110_1 1.14|44815|32|NC_016110|PILER-CR 44815-44846 32 NZ_LR134460 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 18, complete sequence 319871-319902 6 0.812
NC_016110_1 1.14|44815|32|NC_016110|PILER-CR 44815-44846 32 NC_013858 Azospirillum sp. B510 plasmid pAB510d, complete sequence 23955-23986 6 0.812
NC_016110_1 1.17|44998|32|NC_016110|PILER-CR 44998-45029 32 NZ_CP021356 Rhodococcus sp. S2-17 plasmid pRB29, complete sequence 46528-46559 6 0.812
NC_016110_1 1.17|44998|32|NC_016110|PILER-CR 44998-45029 32 NZ_CP021083 Deinococcus ficus strain CC-FR2-10 plasmid pDFI2, complete sequence 43231-43262 6 0.812
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 1429281-1429310 6 0.8
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 703105-703134 6 0.8
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 1787890-1787919 6 0.8
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 NZ_CP029358 Azospirillum sp. CFH 70021 plasmid unnamed3 236855-236884 6 0.8
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 2578269-2578298 6 0.8
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 671855-671884 6 0.8
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 1260786-1260815 6 0.8
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 1027120-1027149 6 0.8
NC_016110_2 2.2|52199|32|NC_016110|CRISPRCasFinder,CRT 52199-52230 32 NZ_CP026950 Mycetocola sp. 449 strain CGMCC 1.16372 plasmid unnamed, complete sequence 20739-20770 6 0.812
NC_016110_2 2.4|52321|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 52321-52352 32 NZ_CP022747 Sphingobium hydrophobicum strain C1 plasmid p1, complete sequence 7924-7955 6 0.812
NC_016110_2 2.4|52321|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 52321-52352 32 NZ_CP022749 Sphingobium hydrophobicum strain C1 plasmid p3, complete sequence 91103-91134 6 0.812
NC_016110_2 2.9|52632|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 52632-52663 32 NZ_CP039965 Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence 1463555-1463586 6 0.812
NC_016110_2 2.12|52815|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 52815-52846 32 NZ_CP029357 Azospirillum sp. CFH 70021 plasmid unnamed2 148771-148802 6 0.812
NC_016110_4 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 145158-145189 32 MH513984 Mycobacterium phage Steamy, complete genome 31984-32015 6 0.812
NC_016110_1 1.3|44816|31|NC_016110|CRISPRCasFinder 44816-44846 31 NZ_CP046258 Gordonia sp. 135 plasmid pG135, complete sequence 123064-123094 7 0.774
NC_016110_1 1.3|44816|31|NC_016110|CRISPRCasFinder 44816-44846 31 NZ_CP038257 Microbacterium sediminis strain YLB-01 plasmid unnamed, complete sequence 73571-73601 7 0.774
NC_016110_1 1.4|44877|31|NC_016110|CRISPRCasFinder 44877-44907 31 NZ_CP024314 Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence 1279464-1279494 7 0.774
NC_016110_1 1.5|44938|31|NC_016110|CRISPRCasFinder 44938-44968 31 NZ_CP024940 Paraburkholderia hospita strain mHSR1 plasmid pmHSR1_P, complete sequence 303829-303859 7 0.774
NC_016110_1 1.5|44938|31|NC_016110|CRISPRCasFinder 44938-44968 31 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 51771-51801 7 0.774
NC_016110_1 1.5|44938|31|NC_016110|CRISPRCasFinder 44938-44968 31 NZ_CP051294 Mesorhizobium sp. NZP2077 plasmid pMSNZP2077A, complete sequence 145949-145979 7 0.774
NC_016110_1 1.5|44938|31|NC_016110|CRISPRCasFinder 44938-44968 31 NZ_CP033363 Mesorhizobium sp. NZP2077 plasmid pMSNZP2077NSa, complete sequence 145949-145979 7 0.774
NC_016110_1 1.6|44999|31|NC_016110|CRISPRCasFinder 44999-45029 31 MH001458 Mycobacterium phage Smeagol, complete genome 27018-27048 7 0.774
NC_016110_1 1.6|44999|31|NC_016110|CRISPRCasFinder 44999-45029 31 NZ_CP013588 Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence 77204-77234 7 0.774
NC_016110_1 1.6|44999|31|NC_016110|CRISPRCasFinder 44999-45029 31 NZ_CP013560 Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence 77461-77491 7 0.774
NC_016110_1 1.6|44999|31|NC_016110|CRISPRCasFinder 44999-45029 31 NZ_CP013577 Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence 82399-82429 7 0.774
NC_016110_1 1.6|44999|31|NC_016110|CRISPRCasFinder 44999-45029 31 NZ_CP013549 Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence 82399-82429 7 0.774
NC_016110_1 1.6|44999|31|NC_016110|CRISPRCasFinder 44999-45029 31 NZ_CP013534 Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence 82399-82429 7 0.774
NC_016110_1 1.6|44999|31|NC_016110|CRISPRCasFinder 44999-45029 31 NZ_CP013545 Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence 82393-82423 7 0.774
NC_016110_1 1.6|44999|31|NC_016110|CRISPRCasFinder 44999-45029 31 NZ_CP013571 Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence 82399-82429 7 0.774
NC_016110_1 1.6|44999|31|NC_016110|CRISPRCasFinder 44999-45029 31 NC_010998 Rhizobium etli CIAT 652 plasmid pA, complete sequence 77505-77535 7 0.774
NC_016110_1 1.6|44999|31|NC_016110|CRISPRCasFinder 44999-45029 31 NC_048046 Caulobacter phage CcrPW, complete genome 128908-128938 7 0.774
NC_016110_1 1.6|44999|31|NC_016110|CRISPRCasFinder 44999-45029 31 NZ_AP022622 Mycobacteroides abscessus strain JCM 30620 plasmid pJCM30620_1 5744-5774 7 0.774
NC_016110_1 1.6|44999|31|NC_016110|CRISPRCasFinder 44999-45029 31 NZ_AP022622 Mycobacteroides abscessus strain JCM 30620 plasmid pJCM30620_1 102975-103005 7 0.774
NC_016110_1 1.6|44999|31|NC_016110|CRISPRCasFinder 44999-45029 31 NZ_AP014706 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_2p, complete sequence 249515-249545 7 0.774
NC_016110_1 1.6|44999|31|NC_016110|CRISPRCasFinder 44999-45029 31 NZ_CP020371 Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs417, complete sequence 381157-381187 7 0.774
NC_016110_1 1.6|44999|31|NC_016110|CRISPRCasFinder 44999-45029 31 NC_021279 Mycobacteroides abscessus subsp. bolletii 50594 plasmid 2, complete sequence 32204-32234 7 0.774
NC_016110_1 1.14|44815|32|NC_016110|PILER-CR 44815-44846 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 1043078-1043109 7 0.781
NC_016110_1 1.14|44815|32|NC_016110|PILER-CR 44815-44846 32 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 598408-598439 7 0.781
NC_016110_1 1.14|44815|32|NC_016110|PILER-CR 44815-44846 32 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 138531-138562 7 0.781
NC_016110_1 1.14|44815|32|NC_016110|PILER-CR 44815-44846 32 NC_016587 Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence 142358-142389 7 0.781
NC_016110_1 1.14|44815|32|NC_016110|PILER-CR 44815-44846 32 NZ_CP024424 Paracoccus yeei strain TT13 plasmid pTT13-2, complete sequence 204917-204948 7 0.781
NC_016110_1 1.14|44815|32|NC_016110|PILER-CR 44815-44846 32 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 521087-521118 7 0.781
NC_016110_1 1.14|44815|32|NC_016110|PILER-CR 44815-44846 32 NZ_CP020440 Paracoccus yeei strain FDAARGOS_252 plasmid unnamed2, complete sequence 86957-86988 7 0.781
NC_016110_1 1.14|44815|32|NC_016110|PILER-CR 44815-44846 32 NZ_CP029833 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence 373429-373460 7 0.781
NC_016110_1 1.14|44815|32|NC_016110|PILER-CR 44815-44846 32 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 1414652-1414683 7 0.781
NC_016110_1 1.14|44815|32|NC_016110|PILER-CR 44815-44846 32 NZ_CP044082 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed4, complete sequence 235722-235753 7 0.781
NC_016110_1 1.14|44815|32|NC_016110|PILER-CR 44815-44846 32 NZ_CP031080 Paracoccus yeei strain CCUG 32053 plasmid pYEE2, complete sequence 127350-127381 7 0.781
NC_016110_1 1.14|44815|32|NC_016110|PILER-CR 44815-44846 32 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 546587-546618 7 0.781
NC_016110_1 1.14|44815|32|NC_016110|PILER-CR 44815-44846 32 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 717718-717749 7 0.781
NC_016110_1 1.14|44815|32|NC_016110|PILER-CR 44815-44846 32 NZ_CP038257 Microbacterium sediminis strain YLB-01 plasmid unnamed, complete sequence 73570-73601 7 0.781
NC_016110_1 1.16|44937|32|NC_016110|PILER-CR 44937-44968 32 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 51770-51801 7 0.781
NC_016110_1 1.17|44998|32|NC_016110|PILER-CR 44998-45029 32 MH001458 Mycobacterium phage Smeagol, complete genome 27018-27049 7 0.781
NC_016110_1 1.17|44998|32|NC_016110|PILER-CR 44998-45029 32 NZ_CP013588 Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence 77204-77235 7 0.781
NC_016110_1 1.17|44998|32|NC_016110|PILER-CR 44998-45029 32 NZ_CP013560 Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence 77461-77492 7 0.781
NC_016110_1 1.17|44998|32|NC_016110|PILER-CR 44998-45029 32 NZ_CP013577 Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence 82399-82430 7 0.781
NC_016110_1 1.17|44998|32|NC_016110|PILER-CR 44998-45029 32 NZ_CP013549 Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence 82399-82430 7 0.781
NC_016110_1 1.17|44998|32|NC_016110|PILER-CR 44998-45029 32 NZ_CP013534 Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence 82399-82430 7 0.781
NC_016110_1 1.17|44998|32|NC_016110|PILER-CR 44998-45029 32 NZ_CP013545 Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence 82393-82424 7 0.781
NC_016110_1 1.17|44998|32|NC_016110|PILER-CR 44998-45029 32 NZ_CP013571 Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence 82399-82430 7 0.781
NC_016110_1 1.17|44998|32|NC_016110|PILER-CR 44998-45029 32 NC_010998 Rhizobium etli CIAT 652 plasmid pA, complete sequence 77505-77536 7 0.781
NC_016110_1 1.17|44998|32|NC_016110|PILER-CR 44998-45029 32 NZ_CP020371 Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs417, complete sequence 381156-381187 7 0.781
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 NZ_CP007795 Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence 318681-318710 7 0.767
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 788563-788592 7 0.767
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 NC_008269 Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence 349427-349456 7 0.767
NC_016110_2 2.1|52140|30|NC_016110|CRISPRCasFinder 52140-52169 30 CP043032 Dermacoccus abyssi strain HZAU 226 plasmid unnamed, complete sequence 56232-56261 7 0.767
NC_016110_2 2.4|52321|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 52321-52352 32 MT451980 Streptomyces phage Ignacio, complete genome 715-746 7 0.781
NC_016110_2 2.7|52510|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 52510-52541 32 NZ_CP017564 Paraburkholderia sprentiae WSM5005 plasmid pl3WSM5005, complete sequence 56124-56155 7 0.781
NC_016110_2 2.8|52571|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 52571-52602 32 NZ_CP023977 Streptomyces alboflavus strain MDJK44 plasmid pMDJK44.2, complete sequence 87860-87891 7 0.781
NC_016110_2 2.9|52632|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 52632-52663 32 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 1125868-1125899 7 0.781
NC_016110_2 2.9|52632|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 52632-52663 32 NZ_CP020539 Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence 919372-919403 7 0.781
NC_016110_2 2.9|52632|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 52632-52663 32 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 1089457-1089488 7 0.781
NC_016110_3 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT 134017-134048 32 NZ_LR134467 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 25, complete sequence 40592-40623 7 0.781
NC_016110_3 3.9|134444|32|NC_016110|CRISPRCasFinder,CRT 134444-134475 32 NZ_CP021375 Rhizobium sp. ACO-34A plasmid pRACO34Aa, complete sequence 28844-28875 7 0.781
NC_016110_3 3.9|134444|32|NC_016110|CRISPRCasFinder,CRT 134444-134475 32 NZ_CP035710 Sphaerotilus natans subsp. sulfidivorans strain D-507 plasmid pSna507_unt10, complete sequence 36543-36574 7 0.781
NC_016110_4 4.3|144425|32|NC_016110|PILER-CR,CRISPRCasFinder,CRT 144425-144456 32 NZ_CP029833 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence 169852-169883 7 0.781
NC_016110_4 4.4|144486|32|NC_016110|PILER-CR,CRISPRCasFinder,CRT 144486-144517 32 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 1828118-1828149 7 0.781
NC_016110_4 4.4|144486|32|NC_016110|PILER-CR,CRISPRCasFinder,CRT 144486-144517 32 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 1048492-1048523 7 0.781
NC_016110_4 4.8|144730|32|NC_016110|CRISPRCasFinder,CRT 144730-144761 32 NZ_CP054621 Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence 913235-913266 7 0.781
NC_016110_4 4.10|144852|32|NC_016110|CRISPRCasFinder,CRT 144852-144883 32 NC_012811 Methylorubrum extorquens AM1 megaplasmid, complete sequence 92465-92496 7 0.781
NC_016110_4 4.12|144974|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 144974-145005 32 NC_012811 Methylorubrum extorquens AM1 megaplasmid, complete sequence 92465-92496 7 0.781
NC_016110_4 4.13|145035|33|NC_016110|CRISPRCasFinder,CRT,PILER-CR 145035-145067 33 NC_016623 Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence 458986-459018 7 0.788
NC_016110_4 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 145158-145189 32 NZ_CP028970 Aminobacter sp. MSH1 plasmid pUSP2, complete sequence 17528-17559 7 0.781
NC_016110_4 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 145158-145189 32 MK494113 Mycobacterium phage Refuge, complete genome 33700-33731 7 0.781
NC_016110_4 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 145158-145189 32 NC_028662 Mycobacterium phage Phlei, complete genome 31987-32018 7 0.781
NC_016110_1 1.1|44694|31|NC_016110|CRISPRCasFinder 44694-44724 31 NZ_LR134450 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 8, complete sequence 80510-80540 8 0.742
NC_016110_1 1.2|44755|31|NC_016110|CRISPRCasFinder 44755-44785 31 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 272492-272522 8 0.742
NC_016110_1 1.3|44816|31|NC_016110|CRISPRCasFinder 44816-44846 31 NZ_CP020399 Burkholderia multivorans strain FDAARGOS_246 plasmid unnamed, complete sequence 68958-68988 8 0.742
NC_016110_1 1.3|44816|31|NC_016110|CRISPRCasFinder 44816-44846 31 NZ_LR699556 Paraburkholderia sp. Msb3 isolate PDMSB31 plasmid pII 52737-52767 8 0.742
NC_016110_1 1.4|44877|31|NC_016110|CRISPRCasFinder 44877-44907 31 NZ_CP012664 Defluviimonas alba strain cai42 plasmid pcai42C, complete sequence 101-131 8 0.742
NC_016110_1 1.5|44938|31|NC_016110|CRISPRCasFinder 44938-44968 31 NZ_CP035710 Sphaerotilus natans subsp. sulfidivorans strain D-507 plasmid pSna507_unt10, complete sequence 121206-121236 8 0.742
NC_016110_1 1.5|44938|31|NC_016110|CRISPRCasFinder 44938-44968 31 NZ_CP021115 Rhodobacteraceae bacterium strain G7 plasmid unnamed1, complete sequence 49238-49268 8 0.742
NC_016110_1 1.6|44999|31|NC_016110|CRISPRCasFinder 44999-45029 31 NZ_CP054617 Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence 585259-585289 8 0.742
NC_016110_1 1.6|44999|31|NC_016110|CRISPRCasFinder 44999-45029 31 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 1032942-1032972 8 0.742
NC_016110_1 1.6|44999|31|NC_016110|CRISPRCasFinder 44999-45029 31 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 1782036-1782066 8 0.742
NC_016110_1 1.6|44999|31|NC_016110|CRISPRCasFinder 44999-45029 31 NZ_CP029362 Streptomyces globisporus strain TFH56 plasmid pTFSG1, complete sequence 76972-77002 8 0.742
NC_016110_1 1.6|44999|31|NC_016110|CRISPRCasFinder 44999-45029 31 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 677646-677676 8 0.742
NC_016110_1 1.6|44999|31|NC_016110|CRISPRCasFinder 44999-45029 31 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 1266669-1266699 8 0.742
NC_016110_1 1.6|44999|31|NC_016110|CRISPRCasFinder 44999-45029 31 NZ_CP013739 Streptomyces globisporus C-1027 plasmid SGLP1, complete sequence 44104-44134 8 0.742
NC_016110_1 1.6|44999|31|NC_016110|CRISPRCasFinder 44999-45029 31 NZ_CP017148 Bosea vaviloviae strain Vaf18 plasmid unnamed1, complete sequence 15436-15466 8 0.742
NC_016110_1 1.6|44999|31|NC_016110|CRISPRCasFinder 44999-45029 31 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 1060376-1060406 8 0.742
NC_016110_1 1.6|44999|31|NC_016110|CRISPRCasFinder 44999-45029 31 NC_028745 Pseudomonas phage DL60, complete genome 24768-24798 8 0.742
NC_016110_1 1.13|44754|32|NC_016110|PILER-CR 44754-44785 32 NC_008010 Deinococcus geothermalis DSM 11300 plasmid pDGEO01, complete sequence 128513-128544 8 0.75
NC_016110_1 1.14|44815|32|NC_016110|PILER-CR 44815-44846 32 NZ_CP046258 Gordonia sp. 135 plasmid pG135, complete sequence 123064-123095 8 0.75
NC_016110_1 1.14|44815|32|NC_016110|PILER-CR 44815-44846 32 NZ_CP054617 Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence 397103-397134 8 0.75
NC_016110_1 1.15|44876|32|NC_016110|PILER-CR 44876-44907 32 NZ_CP024314 Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence 1279463-1279494 8 0.75
NC_016110_1 1.16|44937|32|NC_016110|PILER-CR 44937-44968 32 NZ_CP024940 Paraburkholderia hospita strain mHSR1 plasmid pmHSR1_P, complete sequence 303828-303859 8 0.75
NC_016110_1 1.16|44937|32|NC_016110|PILER-CR 44937-44968 32 NZ_CP021115 Rhodobacteraceae bacterium strain G7 plasmid unnamed1, complete sequence 49238-49269 8 0.75
NC_016110_1 1.16|44937|32|NC_016110|PILER-CR 44937-44968 32 NZ_CP051294 Mesorhizobium sp. NZP2077 plasmid pMSNZP2077A, complete sequence 145949-145980 8 0.75
NC_016110_1 1.16|44937|32|NC_016110|PILER-CR 44937-44968 32 NZ_CP033363 Mesorhizobium sp. NZP2077 plasmid pMSNZP2077NSa, complete sequence 145949-145980 8 0.75
NC_016110_1 1.17|44998|32|NC_016110|PILER-CR 44998-45029 32 NZ_CP054617 Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence 585258-585289 8 0.75
NC_016110_1 1.17|44998|32|NC_016110|PILER-CR 44998-45029 32 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 1032941-1032972 8 0.75
NC_016110_1 1.17|44998|32|NC_016110|PILER-CR 44998-45029 32 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 1782036-1782067 8 0.75
NC_016110_1 1.17|44998|32|NC_016110|PILER-CR 44998-45029 32 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 677645-677676 8 0.75
NC_016110_1 1.17|44998|32|NC_016110|PILER-CR 44998-45029 32 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 1266668-1266699 8 0.75
NC_016110_1 1.17|44998|32|NC_016110|PILER-CR 44998-45029 32 NC_048046 Caulobacter phage CcrPW, complete genome 128907-128938 8 0.75
NC_016110_1 1.17|44998|32|NC_016110|PILER-CR 44998-45029 32 NZ_AP022622 Mycobacteroides abscessus strain JCM 30620 plasmid pJCM30620_1 5744-5775 8 0.75
NC_016110_1 1.17|44998|32|NC_016110|PILER-CR 44998-45029 32 NZ_AP022622 Mycobacteroides abscessus strain JCM 30620 plasmid pJCM30620_1 102975-103006 8 0.75
NC_016110_1 1.17|44998|32|NC_016110|PILER-CR 44998-45029 32 NZ_AP014706 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_2p, complete sequence 249515-249546 8 0.75
NC_016110_1 1.17|44998|32|NC_016110|PILER-CR 44998-45029 32 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 1060375-1060406 8 0.75
NC_016110_1 1.17|44998|32|NC_016110|PILER-CR 44998-45029 32 NC_021279 Mycobacteroides abscessus subsp. bolletii 50594 plasmid 2, complete sequence 32203-32234 8 0.75
NC_016110_1 1.17|44998|32|NC_016110|PILER-CR 44998-45029 32 NC_028745 Pseudomonas phage DL60, complete genome 24768-24799 8 0.75
NC_016110_2 2.2|52199|32|NC_016110|CRISPRCasFinder,CRT 52199-52230 32 NZ_CP015739 Shinella sp. HZN7 plasmid pShin-03, complete sequence 390576-390607 8 0.75
NC_016110_2 2.2|52199|32|NC_016110|CRISPRCasFinder,CRT 52199-52230 32 NC_013858 Azospirillum sp. B510 plasmid pAB510d, complete sequence 518979-519010 8 0.75
NC_016110_2 2.2|52199|32|NC_016110|CRISPRCasFinder,CRT 52199-52230 32 NC_013858 Azospirillum sp. B510 plasmid pAB510d, complete sequence 33564-33595 8 0.75
NC_016110_2 2.2|52199|32|NC_016110|CRISPRCasFinder,CRT 52199-52230 32 NZ_CP054618 Azospirillum oryzae strain KACC 14407 plasmid unnamed4, complete sequence 189322-189353 8 0.75
NC_016110_2 2.2|52199|32|NC_016110|CRISPRCasFinder,CRT 52199-52230 32 NZ_CP035001 Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence 573664-573695 8 0.75
NC_016110_2 2.2|52199|32|NC_016110|CRISPRCasFinder,CRT 52199-52230 32 NZ_CP034186 Deinococcus sp. S14-83 strain S14-83T plasmid unnamed2, complete sequence 272485-272516 8 0.75
NC_016110_2 2.2|52199|32|NC_016110|CRISPRCasFinder,CRT 52199-52230 32 NZ_CP006370 Aureimonas sp. AU20 plasmid pAU20c, complete sequence 889-920 8 0.75
NC_016110_2 2.9|52632|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 52632-52663 32 NC_049850 Burkholderia phage BcepSaruman, complete genome 85406-85437 8 0.75
NC_016110_2 2.9|52632|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 52632-52663 32 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 1447904-1447935 8 0.75
NC_016110_2 2.9|52632|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 52632-52663 32 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 1707792-1707823 8 0.75
NC_016110_2 2.9|52632|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 52632-52663 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 5029090-5029121 8 0.75
NC_016110_2 2.9|52632|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 52632-52663 32 NZ_AP022319 Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence 42763-42794 8 0.75
NC_016110_2 2.9|52632|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 52632-52663 32 NZ_CP018235 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed7, complete sequence 110167-110198 8 0.75
NC_016110_2 2.9|52632|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 52632-52663 32 NZ_CP016290 Rhizobium leguminosarum strain Vaf10 plasmid unnamed3, complete sequence 282897-282928 8 0.75
NC_016110_2 2.9|52632|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 52632-52663 32 NZ_HG938356 Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence 1063759-1063790 8 0.75
NC_016110_2 2.9|52632|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 52632-52663 32 NZ_CP021813 Sinorhizobium meliloti strain M270 plasmid psymA, complete sequence 912304-912335 8 0.75
NC_016110_2 2.12|52815|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 52815-52846 32 NZ_AP014579 Burkholderia sp. RPE67 plasmid p1, complete sequence 1047873-1047904 8 0.75
NC_016110_2 2.12|52815|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 52815-52846 32 NZ_CP016289 Rhizobium leguminosarum strain Vaf10 plasmid unnamed2, complete sequence 488955-488986 8 0.75
NC_016110_2 2.12|52815|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 52815-52846 32 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 903684-903715 8 0.75
NC_016110_3 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT 134017-134048 32 NZ_AP022602 Mycobacterium gallinarum strain JCM 6399 plasmid pJCM6399 10899-10930 8 0.75
NC_016110_3 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT 134017-134048 32 NZ_AP022602 Mycobacterium gallinarum strain JCM 6399 plasmid pJCM6399 196144-196175 8 0.75
NC_016110_3 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT 134017-134048 32 CP054917 Streptomyces sp. NA02950 plasmid unnamed, complete sequence 32832-32863 8 0.75
NC_016110_3 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT 134017-134048 32 NZ_CP027239 Dietzia sp. oral taxon 368 strain W5195 plasmid unnamed1, complete sequence 92582-92613 8 0.75
NC_016110_3 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT 134017-134048 32 NZ_CP033739 Enterococcus sp. FDAARGOS_553 plasmid unnamed1, complete sequence 11119-11150 8 0.75
NC_016110_3 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT 134017-134048 32 KJ019064 Synechococcus phage ACG-2014c isolate Syn7803C98, complete genome 31155-31186 8 0.75
NC_016110_3 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT 134017-134048 32 MH479913 Gordonia phage Fryberger, complete genome 30941-30972 8 0.75
NC_016110_3 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT 134017-134048 32 MG945660 UNVERIFIED: Microviridae sp. isolate 21385-1502, partial genome 3314-3345 8 0.75
NC_016110_3 3.9|134444|32|NC_016110|CRISPRCasFinder,CRT 134444-134475 32 NZ_CP030864 Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence 60414-60445 8 0.75
NC_016110_3 3.9|134444|32|NC_016110|CRISPRCasFinder,CRT 134444-134475 32 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 381529-381560 8 0.75
NC_016110_3 3.9|134444|32|NC_016110|CRISPRCasFinder,CRT 134444-134475 32 NZ_CP012917 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence 346666-346697 8 0.75
NC_016110_4 4.2|144364|32|NC_016110|PILER-CR,CRISPRCasFinder,CRT 144364-144395 32 NZ_CP049033 Fluviibacterium aquatile strain SC52 plasmid pSC52_5, complete sequence 5805-5836 8 0.75
NC_016110_4 4.3|144425|32|NC_016110|PILER-CR,CRISPRCasFinder,CRT 144425-144456 32 NZ_CP009294 Novosphingobium pentaromativorans US6-1 plasmid pLA1, complete sequence 45966-45997 8 0.75
NC_016110_4 4.3|144425|32|NC_016110|PILER-CR,CRISPRCasFinder,CRT 144425-144456 32 NZ_CP011771 Croceicoccus naphthovorans strain PQ-2 plasmid p1, complete sequence 96718-96749 8 0.75
NC_016110_4 4.5|144547|32|NC_016110|CRISPRCasFinder,CRT 144547-144578 32 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 1373310-1373341 8 0.75
NC_016110_4 4.5|144547|32|NC_016110|CRISPRCasFinder,CRT 144547-144578 32 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 759060-759091 8 0.75
NC_016110_4 4.7|144669|32|NC_016110|CRISPRCasFinder,CRT 144669-144700 32 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 1736857-1736888 8 0.75
NC_016110_4 4.10|144852|32|NC_016110|CRISPRCasFinder,CRT 144852-144883 32 MH153804 Rhodococcus phage Jace, complete genome 25760-25791 8 0.75
NC_016110_4 4.12|144974|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 144974-145005 32 MH153804 Rhodococcus phage Jace, complete genome 25760-25791 8 0.75
NC_016110_4 4.14|145097|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 145097-145128 32 NZ_CP020040 Streptomyces sp. 3211 isolate 3 plasmid p3211-1, complete sequence 256218-256249 8 0.75
NC_016110_4 4.14|145097|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 145097-145128 32 NZ_CP020040 Streptomyces sp. 3211 isolate 3 plasmid p3211-1, complete sequence 266913-266944 8 0.75
NC_016110_4 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 145158-145189 32 MH316566 Gordonia phage Nedarya, complete genome 30434-30465 8 0.75
NC_016110_4 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 145158-145189 32 MF140403 Mycobacterium phage Changeling, complete genome 33099-33130 8 0.75
NC_016110_4 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 145158-145189 32 MK524530 Mycobacterium phage Pharaoh, complete genome 32256-32287 8 0.75
NC_016110_1 1.6|44999|31|NC_016110|CRISPRCasFinder 44999-45029 31 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 194214-194244 9 0.71
NC_016110_1 1.6|44999|31|NC_016110|CRISPRCasFinder 44999-45029 31 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 1007869-1007899 9 0.71
NC_016110_1 1.6|44999|31|NC_016110|CRISPRCasFinder 44999-45029 31 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 697402-697432 9 0.71
NC_016110_1 1.6|44999|31|NC_016110|CRISPRCasFinder 44999-45029 31 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 1434983-1435013 9 0.71
NC_016110_1 1.6|44999|31|NC_016110|CRISPRCasFinder 44999-45029 31 NC_019847 Sinorhizobium meliloti GR4 plasmid pRmeGR4b, complete sequence 170121-170151 9 0.71
NC_016110_1 1.6|44999|31|NC_016110|CRISPRCasFinder 44999-45029 31 NZ_CP031163 Deinococcus wulumuqiensis strain NEB 479 plasmid pDrdI, complete sequence 355937-355967 9 0.71
NC_016110_1 1.6|44999|31|NC_016110|CRISPRCasFinder 44999-45029 31 LZ998054 JP 2017534684-A/1: Phage Therapy 49692-49722 9 0.71
NC_016110_1 1.6|44999|31|NC_016110|CRISPRCasFinder 44999-45029 31 NC_048097 Arthrobacter phage Yang, complete genome 26401-26431 9 0.71
NC_016110_1 1.6|44999|31|NC_016110|CRISPRCasFinder 44999-45029 31 MK967377 Gordonia phage MagicMan, complete genome 7109-7139 9 0.71
NC_016110_1 1.6|44999|31|NC_016110|CRISPRCasFinder 44999-45029 31 NC_011165 Pseudomonas phage LBL3, complete genome 49181-49211 9 0.71
NC_016110_1 1.6|44999|31|NC_016110|CRISPRCasFinder 44999-45029 31 MT108729 Pseudomonas phage Epa22, complete genome 13303-13333 9 0.71
NC_016110_1 1.6|44999|31|NC_016110|CRISPRCasFinder 44999-45029 31 MT491205 Pseudomonas phage vB_PaeM_USP_2, complete genome 49829-49859 9 0.71
NC_016110_1 1.6|44999|31|NC_016110|CRISPRCasFinder 44999-45029 31 MN813694 Gordonia phage Opie, complete genome 7124-7154 9 0.71
NC_016110_1 1.6|44999|31|NC_016110|CRISPRCasFinder 44999-45029 31 LC102730 Pseudomonas phage S12-1 DNA, complete genome 49210-49240 9 0.71
NC_016110_1 1.6|44999|31|NC_016110|CRISPRCasFinder 44999-45029 31 LC472883 Pseudomonas phage S12-3 DNA, complete genome 49210-49240 9 0.71
NC_016110_1 1.6|44999|31|NC_016110|CRISPRCasFinder 44999-45029 31 MN871454 UNVERIFIED: Pseudomonas phage Pa-A, complete genome 44487-44517 9 0.71
NC_016110_1 1.6|44999|31|NC_016110|CRISPRCasFinder 44999-45029 31 FM201281 Pseudomonas phage LBL3 complete genome 49181-49211 9 0.71
NC_016110_1 1.6|44999|31|NC_016110|CRISPRCasFinder 44999-45029 31 KU198331 Pseudomonas phage NP3, complete genome 50486-50516 9 0.71
NC_016110_1 1.6|44999|31|NC_016110|CRISPRCasFinder 44999-45029 31 MN615701 Pseudomonas phage vB_PaeM_SMS21, complete genome 50890-50920 9 0.71
NC_016110_1 1.6|44999|31|NC_016110|CRISPRCasFinder 44999-45029 31 KM434184 Pseudomonas phage vB_Pae_PS44, complete genome 52028-52058 9 0.71
NC_016110_1 1.6|44999|31|NC_016110|CRISPRCasFinder 44999-45029 31 MT118290 Pseudomonas phage Epa10, complete genome 3106-3136 9 0.71
NC_016110_1 1.6|44999|31|NC_016110|CRISPRCasFinder 44999-45029 31 NC_007810 Pseudomonas phage F8, complete genome 50297-50327 9 0.71
NC_016110_1 1.6|44999|31|NC_016110|CRISPRCasFinder 44999-45029 31 MN062704 Gordonia phage JuJu, complete genome 44749-44779 9 0.71
NC_016110_1 1.6|44999|31|NC_016110|CRISPRCasFinder 44999-45029 31 NC_048676 Pseudomonas phage SL1, complete genome 21690-21720 9 0.71
NC_016110_1 1.6|44999|31|NC_016110|CRISPRCasFinder 44999-45029 31 MT119376 Pseudomonas phage chunk, complete genome 49785-49815 9 0.71
NC_016110_1 1.6|44999|31|NC_016110|CRISPRCasFinder 44999-45029 31 MT108727 Pseudomonas phage Epa11, complete genome 35430-35460 9 0.71
NC_016110_1 1.6|44999|31|NC_016110|CRISPRCasFinder 44999-45029 31 LQ277706 Sequence 1 from Patent WO2016071503 49692-49722 9 0.71
NC_016110_1 1.6|44999|31|NC_016110|CRISPRCasFinder 44999-45029 31 MN131141 Pseudomonas virus PaP1_EPu-2019, complete genome 57815-57845 9 0.71
NC_016110_1 1.6|44999|31|NC_016110|CRISPRCasFinder 44999-45029 31 MT119370 Pseudomonas phage steven, complete genome 49345-49375 9 0.71
NC_016110_1 1.6|44999|31|NC_016110|CRISPRCasFinder 44999-45029 31 MN615700 Pseudomonas phage vB_PaeM_SMS12, complete genome 50588-50618 9 0.71
NC_016110_1 1.6|44999|31|NC_016110|CRISPRCasFinder 44999-45029 31 MT108726 Pseudomonas phage Epa6, complete genome 50038-50068 9 0.71
NC_016110_1 1.6|44999|31|NC_016110|CRISPRCasFinder 44999-45029 31 KR054033 Pseudomonas phage DL68, complete genome 24826-24856 9 0.71
NC_016110_1 1.6|44999|31|NC_016110|CRISPRCasFinder 44999-45029 31 LN610579 Pseudomonas phage vB_PaeM_PAO1_Ab27, complete genome 57730-57760 9 0.71
NC_016110_1 1.6|44999|31|NC_016110|CRISPRCasFinder 44999-45029 31 MK318076 Pseudomonas phage vB_PaeM_fHoPae01, complete genome 57571-57601 9 0.71
NC_016110_1 1.6|44999|31|NC_016110|CRISPRCasFinder 44999-45029 31 NC_031255 Gordonia phage Schwabeltier, complete genome 7110-7140 9 0.71
NC_016110_1 1.6|44999|31|NC_016110|CRISPRCasFinder 44999-45029 31 MT119366 Pseudomonas phage jett, complete genome 49836-49866 9 0.71
NC_016110_1 1.6|44999|31|NC_016110|CRISPRCasFinder 44999-45029 31 NC_011756 Pseudomonas phage SN, complete genome 50481-50511 9 0.71
NC_016110_1 1.6|44999|31|NC_016110|CRISPRCasFinder 44999-45029 31 NC_011703 Pseudomonas phage 14-1, complete genome 50408-50438 9 0.71
NC_016110_1 1.6|44999|31|NC_016110|CRISPRCasFinder 44999-45029 31 MK317959 Pseudomonas phage EPa61, complete genome 18185-18215 9 0.71
NC_016110_1 1.6|44999|31|NC_016110|CRISPRCasFinder 44999-45029 31 MN131143 Pseudomonas virus PA11P1, complete genome 57396-57426 9 0.71
NC_016110_1 1.6|44999|31|NC_016110|CRISPRCasFinder 44999-45029 31 DQ163917 Bacteriophage F8, complete genome 50297-50327 9 0.71
NC_016110_1 1.6|44999|31|NC_016110|CRISPRCasFinder 44999-45029 31 MT119369 Pseudomonas phage sortsol, complete genome 50211-50241 9 0.71
NC_016110_1 1.6|44999|31|NC_016110|CRISPRCasFinder 44999-45029 31 MN615702 Pseudomonas phage vB_PaeM_SMS29, complete genome 50715-50745 9 0.71
NC_016110_1 1.6|44999|31|NC_016110|CRISPRCasFinder 44999-45029 31 NC_026600 Pseudomonas phage vB_PaeM_C1-14_Ab28, complete genome 57472-57502 9 0.71
NC_016110_1 1.6|44999|31|NC_016110|CRISPRCasFinder 44999-45029 31 NC_050147 Pseudomonas phage Epa13, complete genome 44410-44440 9 0.71
NC_016110_1 1.14|44815|32|NC_016110|PILER-CR 44815-44846 32 NZ_CP020399 Burkholderia multivorans strain FDAARGOS_246 plasmid unnamed, complete sequence 68957-68988 9 0.719
NC_016110_1 1.14|44815|32|NC_016110|PILER-CR 44815-44846 32 NZ_LR699556 Paraburkholderia sp. Msb3 isolate PDMSB31 plasmid pII 52737-52768 9 0.719
NC_016110_1 1.14|44815|32|NC_016110|PILER-CR 44815-44846 32 NC_023136 Leisingera methylohalidivorans DSM 14336 plasmid unnamed, complete sequence 264963-264994 9 0.719
NC_016110_1 1.15|44876|32|NC_016110|PILER-CR 44876-44907 32 NZ_CP012664 Defluviimonas alba strain cai42 plasmid pcai42C, complete sequence 100-131 9 0.719
NC_016110_1 1.16|44937|32|NC_016110|PILER-CR 44937-44968 32 NZ_CP035710 Sphaerotilus natans subsp. sulfidivorans strain D-507 plasmid pSna507_unt10, complete sequence 121206-121237 9 0.719
NC_016110_1 1.17|44998|32|NC_016110|PILER-CR 44998-45029 32 NZ_CP029362 Streptomyces globisporus strain TFH56 plasmid pTFSG1, complete sequence 76972-77003 9 0.719
NC_016110_1 1.17|44998|32|NC_016110|PILER-CR 44998-45029 32 NZ_CP013739 Streptomyces globisporus C-1027 plasmid SGLP1, complete sequence 44103-44134 9 0.719
NC_016110_1 1.17|44998|32|NC_016110|PILER-CR 44998-45029 32 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 194214-194245 9 0.719
NC_016110_1 1.17|44998|32|NC_016110|PILER-CR 44998-45029 32 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 1007868-1007899 9 0.719
NC_016110_1 1.17|44998|32|NC_016110|PILER-CR 44998-45029 32 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 697402-697433 9 0.719
NC_016110_1 1.17|44998|32|NC_016110|PILER-CR 44998-45029 32 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 1434982-1435013 9 0.719
NC_016110_1 1.17|44998|32|NC_016110|PILER-CR 44998-45029 32 NC_019847 Sinorhizobium meliloti GR4 plasmid pRmeGR4b, complete sequence 170121-170152 9 0.719
NC_016110_1 1.17|44998|32|NC_016110|PILER-CR 44998-45029 32 NZ_CP017148 Bosea vaviloviae strain Vaf18 plasmid unnamed1, complete sequence 15436-15467 9 0.719
NC_016110_1 1.17|44998|32|NC_016110|PILER-CR 44998-45029 32 NZ_CP031163 Deinococcus wulumuqiensis strain NEB 479 plasmid pDrdI, complete sequence 355937-355968 9 0.719
NC_016110_1 1.17|44998|32|NC_016110|PILER-CR 44998-45029 32 LZ998054 JP 2017534684-A/1: Phage Therapy 49691-49722 9 0.719
NC_016110_1 1.17|44998|32|NC_016110|PILER-CR 44998-45029 32 NC_048097 Arthrobacter phage Yang, complete genome 26400-26431 9 0.719
NC_016110_1 1.17|44998|32|NC_016110|PILER-CR 44998-45029 32 NC_011165 Pseudomonas phage LBL3, complete genome 49180-49211 9 0.719
NC_016110_1 1.17|44998|32|NC_016110|PILER-CR 44998-45029 32 MT108729 Pseudomonas phage Epa22, complete genome 13302-13333 9 0.719
NC_016110_1 1.17|44998|32|NC_016110|PILER-CR 44998-45029 32 MT491205 Pseudomonas phage vB_PaeM_USP_2, complete genome 49828-49859 9 0.719
NC_016110_1 1.17|44998|32|NC_016110|PILER-CR 44998-45029 32 LC102730 Pseudomonas phage S12-1 DNA, complete genome 49209-49240 9 0.719
NC_016110_1 1.17|44998|32|NC_016110|PILER-CR 44998-45029 32 LC472883 Pseudomonas phage S12-3 DNA, complete genome 49209-49240 9 0.719
NC_016110_1 1.17|44998|32|NC_016110|PILER-CR 44998-45029 32 MN871454 UNVERIFIED: Pseudomonas phage Pa-A, complete genome 44487-44518 9 0.719
NC_016110_1 1.17|44998|32|NC_016110|PILER-CR 44998-45029 32 FM201281 Pseudomonas phage LBL3 complete genome 49180-49211 9 0.719
NC_016110_1 1.17|44998|32|NC_016110|PILER-CR 44998-45029 32 KU198331 Pseudomonas phage NP3, complete genome 50485-50516 9 0.719
NC_016110_1 1.17|44998|32|NC_016110|PILER-CR 44998-45029 32 MN615701 Pseudomonas phage vB_PaeM_SMS21, complete genome 50889-50920 9 0.719
NC_016110_1 1.17|44998|32|NC_016110|PILER-CR 44998-45029 32 KM434184 Pseudomonas phage vB_Pae_PS44, complete genome 52027-52058 9 0.719
NC_016110_1 1.17|44998|32|NC_016110|PILER-CR 44998-45029 32 MT118290 Pseudomonas phage Epa10, complete genome 3106-3137 9 0.719
NC_016110_1 1.17|44998|32|NC_016110|PILER-CR 44998-45029 32 NC_007810 Pseudomonas phage F8, complete genome 50296-50327 9 0.719
NC_016110_1 1.17|44998|32|NC_016110|PILER-CR 44998-45029 32 MN062704 Gordonia phage JuJu, complete genome 44749-44780 9 0.719
NC_016110_1 1.17|44998|32|NC_016110|PILER-CR 44998-45029 32 NC_048676 Pseudomonas phage SL1, complete genome 21690-21721 9 0.719
NC_016110_1 1.17|44998|32|NC_016110|PILER-CR 44998-45029 32 MT119376 Pseudomonas phage chunk, complete genome 49784-49815 9 0.719
NC_016110_1 1.17|44998|32|NC_016110|PILER-CR 44998-45029 32 MT108727 Pseudomonas phage Epa11, complete genome 35429-35460 9 0.719
NC_016110_1 1.17|44998|32|NC_016110|PILER-CR 44998-45029 32 LQ277706 Sequence 1 from Patent WO2016071503 49691-49722 9 0.719
NC_016110_1 1.17|44998|32|NC_016110|PILER-CR 44998-45029 32 MN131141 Pseudomonas virus PaP1_EPu-2019, complete genome 57814-57845 9 0.719
NC_016110_1 1.17|44998|32|NC_016110|PILER-CR 44998-45029 32 MT119370 Pseudomonas phage steven, complete genome 49344-49375 9 0.719
NC_016110_1 1.17|44998|32|NC_016110|PILER-CR 44998-45029 32 MN615700 Pseudomonas phage vB_PaeM_SMS12, complete genome 50587-50618 9 0.719
NC_016110_1 1.17|44998|32|NC_016110|PILER-CR 44998-45029 32 MT108726 Pseudomonas phage Epa6, complete genome 50037-50068 9 0.719
NC_016110_1 1.17|44998|32|NC_016110|PILER-CR 44998-45029 32 KR054033 Pseudomonas phage DL68, complete genome 24826-24857 9 0.719
NC_016110_1 1.17|44998|32|NC_016110|PILER-CR 44998-45029 32 LN610579 Pseudomonas phage vB_PaeM_PAO1_Ab27, complete genome 57729-57760 9 0.719
NC_016110_1 1.17|44998|32|NC_016110|PILER-CR 44998-45029 32 MK318076 Pseudomonas phage vB_PaeM_fHoPae01, complete genome 57570-57601 9 0.719
NC_016110_1 1.17|44998|32|NC_016110|PILER-CR 44998-45029 32 MT119366 Pseudomonas phage jett, complete genome 49835-49866 9 0.719
NC_016110_1 1.17|44998|32|NC_016110|PILER-CR 44998-45029 32 NC_011756 Pseudomonas phage SN, complete genome 50480-50511 9 0.719
NC_016110_1 1.17|44998|32|NC_016110|PILER-CR 44998-45029 32 NC_011703 Pseudomonas phage 14-1, complete genome 50407-50438 9 0.719
NC_016110_1 1.17|44998|32|NC_016110|PILER-CR 44998-45029 32 MK317959 Pseudomonas phage EPa61, complete genome 18185-18216 9 0.719
NC_016110_1 1.17|44998|32|NC_016110|PILER-CR 44998-45029 32 MN131143 Pseudomonas virus PA11P1, complete genome 57395-57426 9 0.719
NC_016110_1 1.17|44998|32|NC_016110|PILER-CR 44998-45029 32 DQ163917 Bacteriophage F8, complete genome 50296-50327 9 0.719
NC_016110_1 1.17|44998|32|NC_016110|PILER-CR 44998-45029 32 MT119369 Pseudomonas phage sortsol, complete genome 50210-50241 9 0.719
NC_016110_1 1.17|44998|32|NC_016110|PILER-CR 44998-45029 32 MN615702 Pseudomonas phage vB_PaeM_SMS29, complete genome 50714-50745 9 0.719
NC_016110_1 1.17|44998|32|NC_016110|PILER-CR 44998-45029 32 NC_026600 Pseudomonas phage vB_PaeM_C1-14_Ab28, complete genome 57471-57502 9 0.719
NC_016110_1 1.17|44998|32|NC_016110|PILER-CR 44998-45029 32 NC_050147 Pseudomonas phage Epa13, complete genome 44410-44441 9 0.719
NC_016110_2 2.2|52199|32|NC_016110|CRISPRCasFinder,CRT 52199-52230 32 NZ_CP023039 Komagataeibacter saccharivorans strain CV1 plasmid unnamed3, complete sequence 78584-78615 9 0.719
NC_016110_2 2.2|52199|32|NC_016110|CRISPRCasFinder,CRT 52199-52230 32 MG099947 Mycobacterium phage Ph8s, complete genome 2110-2141 9 0.719
NC_016110_2 2.2|52199|32|NC_016110|CRISPRCasFinder,CRT 52199-52230 32 NC_022043 Paracoccus aminophilus JCM 7686 plasmid pAMI5, complete sequence 79129-79160 9 0.719
NC_016110_2 2.2|52199|32|NC_016110|CRISPRCasFinder,CRT 52199-52230 32 NZ_CP025552 Streptomyces rimosus strain WT5260 plasmid unnamed, complete sequence 114080-114111 9 0.719
NC_016110_2 2.2|52199|32|NC_016110|CRISPRCasFinder,CRT 52199-52230 32 LN997843 Streptomyces reticuli genome assembly TUE45, plasmid : II 447686-447717 9 0.719
NC_016110_2 2.4|52321|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 52321-52352 32 NZ_CP020926 Sphingobium yanoikuyae strain SHJ plasmid pSES220, complete sequence 161991-162022 9 0.719
NC_016110_2 2.8|52571|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 52571-52602 32 NZ_CP030074 Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence 438558-438589 9 0.719
NC_016110_2 2.9|52632|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 52632-52663 32 NZ_CP015032 Burkholderia cenocepacia strain 842 plasmid pBcn842-1, complete sequence 24786-24817 9 0.719
NC_016110_2 2.9|52632|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 52632-52663 32 NZ_CP025505 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvC, complete sequence 358978-359009 9 0.719
NC_016110_2 2.9|52632|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 52632-52663 32 NZ_CP030762 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed2, complete sequence 178947-178978 9 0.719
NC_016110_2 2.11|52754|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 52754-52785 32 MN586029 Mycobacterium phage Hannaconda, complete genome 7725-7756 9 0.719
NC_016110_2 2.11|52754|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 52754-52785 32 MF072690 Mycobacterium phage Porcelain, complete genome 8864-8895 9 0.719
NC_016110_2 2.11|52754|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 52754-52785 32 MF919534 Mycobacterium phage Superphikiman, complete genome 9045-9076 9 0.719
NC_016110_2 2.11|52754|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 52754-52785 32 NC_023690 Mycobacterium phage Courthouse, complete genome 9045-9076 9 0.719
NC_016110_2 2.11|52754|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 52754-52785 32 NC_028953 Mycobacterium phage MiaZeal, complete genome 8864-8895 9 0.719
NC_016110_2 2.12|52815|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 52815-52846 32 NZ_CP032685 Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence 296161-296192 9 0.719
NC_016110_2 2.12|52815|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 52815-52846 32 NZ_CP032690 Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence 296160-296191 9 0.719
NC_016110_3 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT 134017-134048 32 KU985096 Mycobacterium phage Kazan, complete genome 2860-2891 9 0.719
NC_016110_3 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT 134017-134048 32 MG099952 Mycobacterium phage WunderPhul, complete genome 2860-2891 9 0.719
NC_016110_3 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT 134017-134048 32 MK359352 Mycobacterium phage JewelBug, complete genome 2861-2892 9 0.719
NC_016110_3 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT 134017-134048 32 KX375815 Mycobacterium phage ToneTone, complete genome 2860-2891 9 0.719
NC_016110_3 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT 134017-134048 32 MK494090 Mycobacterium phage Jordennis, complete genome 2860-2891 9 0.719
NC_016110_3 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT 134017-134048 32 KX641261 Mycobacterium phage Isiphiwo, complete genome 2860-2891 9 0.719
NC_016110_3 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT 134017-134048 32 KF560333 Mycobacterium phage Artemis2UCLA, complete genome 2860-2891 9 0.719
NC_016110_3 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT 134017-134048 32 KU695582 Mycobacterium phage McFly, complete genome 2860-2891 9 0.719
NC_016110_3 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT 134017-134048 32 MT024861 Mycobacterium phage Pmask, complete genome 2860-2891 9 0.719
NC_016110_3 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT 134017-134048 32 MH155876 Mycobacterium phage Priamo, complete genome 2875-2906 9 0.719
NC_016110_3 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT 134017-134048 32 MK359360 Mycobacterium phage Hexamo, complete genome 2860-2891 9 0.719
NC_016110_3 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT 134017-134048 32 MH051253 Mycobacterium phage GreedyLawyer, complete genome 2860-2891 9 0.719
NC_016110_3 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT 134017-134048 32 MT657338 Mycobacterium phage SuperCallie99, complete genome 2861-2892 9 0.719
NC_016110_3 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT 134017-134048 32 NC_042334 Mycobacterium virus Jeffabunny, complete genome 2860-2891 9 0.719
NC_016110_3 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT 134017-134048 32 MN728683 Mycobacterium phage Yokurt, complete genome 2860-2891 9 0.719
NC_016110_3 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT 134017-134048 32 NC_022965 Mycobacterium phage CloudWang3, complete genome 2860-2891 9 0.719
NC_016110_3 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT 134017-134048 32 JF937092 Mycobacterium phage DaVinci, complete genome 2861-2892 9 0.719
NC_016110_3 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT 134017-134048 32 MF668288 Mycobacterium phage Wiks, complete genome 2860-2891 9 0.719
NC_016110_3 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT 134017-134048 32 MH020240 Mycobacterium phage SuperAwesome, complete genome 2860-2891 9 0.719
NC_016110_3 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT 134017-134048 32 MG099945 Mycobacterium phage Koko, complete genome 2860-2891 9 0.719
NC_016110_3 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT 134017-134048 32 MK894433 Mycobacterium phage Kipper29, complete genome 2860-2891 9 0.719
NC_016110_3 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT 134017-134048 32 NC_022985 Mycobacterium phage Zaka, complete genome 2860-2891 9 0.719
NC_016110_3 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT 134017-134048 32 JN049605 Mycobacterium virus EricB, complete genome 2861-2892 9 0.719
NC_016110_3 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT 134017-134048 32 MN586039 Mycobacterium phage Blinn1, complete genome 2860-2891 9 0.719
NC_016110_3 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT 134017-134048 32 MH779517 Mycobacterium phage Zulu, complete genome 2860-2891 9 0.719
NC_016110_3 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT 134017-134048 32 NC_029077 Mycobacterium phage VohminGhazi, complete genome 2860-2891 9 0.719
NC_016110_3 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT 134017-134048 32 KR053201 Gordonia phage GTE8, complete genome 42447-42478 9 0.719
NC_016110_3 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT 134017-134048 32 NC_019937 Pseudomonas stutzeri RCH2 plasmid pPSEST01, complete sequence 8762-8793 9 0.719
NC_016110_3 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT 134017-134048 32 CP003958 Rhodococcus opacus PD630 plasmid 9, complete sequence 25930-25961 9 0.719
NC_016110_3 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT 134017-134048 32 MN234221 Arthrobacter phage Shepard, complete genome 15367-15398 9 0.719
NC_016110_3 3.9|134444|32|NC_016110|CRISPRCasFinder,CRT 134444-134475 32 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 634603-634634 9 0.719
NC_016110_3 3.9|134444|32|NC_016110|CRISPRCasFinder,CRT 134444-134475 32 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 1178468-1178499 9 0.719
NC_016110_3 3.9|134444|32|NC_016110|CRISPRCasFinder,CRT 134444-134475 32 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 155758-155789 9 0.719
NC_016110_3 3.9|134444|32|NC_016110|CRISPRCasFinder,CRT 134444-134475 32 NZ_CP032324 Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence 396383-396414 9 0.719
NC_016110_3 3.9|134444|32|NC_016110|CRISPRCasFinder,CRT 134444-134475 32 NZ_CP007797 Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence 544565-544596 9 0.719
NC_016110_3 3.10|134505|32|NC_016110|CRISPRCasFinder,CRT 134505-134536 32 NZ_CP050953 Rhodococcus sp. DMU1 plasmid unnamed 689206-689237 9 0.719
NC_016110_4 4.3|144425|32|NC_016110|PILER-CR,CRISPRCasFinder,CRT 144425-144456 32 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 110570-110601 9 0.719
NC_016110_4 4.3|144425|32|NC_016110|PILER-CR,CRISPRCasFinder,CRT 144425-144456 32 NZ_CP012917 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence 618012-618043 9 0.719
NC_016110_4 4.10|144852|32|NC_016110|CRISPRCasFinder,CRT 144852-144883 32 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 772580-772611 9 0.719
NC_016110_4 4.10|144852|32|NC_016110|CRISPRCasFinder,CRT 144852-144883 32 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 270226-270257 9 0.719
NC_016110_4 4.10|144852|32|NC_016110|CRISPRCasFinder,CRT 144852-144883 32 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 1978131-1978162 9 0.719
NC_016110_4 4.10|144852|32|NC_016110|CRISPRCasFinder,CRT 144852-144883 32 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 632115-632146 9 0.719
NC_016110_4 4.10|144852|32|NC_016110|CRISPRCasFinder,CRT 144852-144883 32 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 632115-632146 9 0.719
NC_016110_4 4.10|144852|32|NC_016110|CRISPRCasFinder,CRT 144852-144883 32 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 622356-622387 9 0.719
NC_016110_4 4.10|144852|32|NC_016110|CRISPRCasFinder,CRT 144852-144883 32 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 632116-632147 9 0.719
NC_016110_4 4.10|144852|32|NC_016110|CRISPRCasFinder,CRT 144852-144883 32 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 622356-622387 9 0.719
NC_016110_4 4.10|144852|32|NC_016110|CRISPRCasFinder,CRT 144852-144883 32 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 632118-632149 9 0.719
NC_016110_4 4.10|144852|32|NC_016110|CRISPRCasFinder,CRT 144852-144883 32 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 622356-622387 9 0.719
NC_016110_4 4.10|144852|32|NC_016110|CRISPRCasFinder,CRT 144852-144883 32 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 622356-622387 9 0.719
NC_016110_4 4.10|144852|32|NC_016110|CRISPRCasFinder,CRT 144852-144883 32 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 622356-622387 9 0.719
NC_016110_4 4.10|144852|32|NC_016110|CRISPRCasFinder,CRT 144852-144883 32 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 632118-632149 9 0.719
NC_016110_4 4.10|144852|32|NC_016110|CRISPRCasFinder,CRT 144852-144883 32 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 1404330-1404361 9 0.719
NC_016110_4 4.10|144852|32|NC_016110|CRISPRCasFinder,CRT 144852-144883 32 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 1477196-1477227 9 0.719
NC_016110_4 4.10|144852|32|NC_016110|CRISPRCasFinder,CRT 144852-144883 32 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 632118-632149 9 0.719
NC_016110_4 4.10|144852|32|NC_016110|CRISPRCasFinder,CRT 144852-144883 32 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 619551-619582 9 0.719
NC_016110_4 4.10|144852|32|NC_016110|CRISPRCasFinder,CRT 144852-144883 32 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 622343-622374 9 0.719
NC_016110_4 4.10|144852|32|NC_016110|CRISPRCasFinder,CRT 144852-144883 32 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 632118-632149 9 0.719
NC_016110_4 4.10|144852|32|NC_016110|CRISPRCasFinder,CRT 144852-144883 32 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 632112-632143 9 0.719
NC_016110_4 4.10|144852|32|NC_016110|CRISPRCasFinder,CRT 144852-144883 32 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 632118-632149 9 0.719
NC_016110_4 4.10|144852|32|NC_016110|CRISPRCasFinder,CRT 144852-144883 32 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 622358-622389 9 0.719
NC_016110_4 4.10|144852|32|NC_016110|CRISPRCasFinder,CRT 144852-144883 32 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 632118-632149 9 0.719
NC_016110_4 4.10|144852|32|NC_016110|CRISPRCasFinder,CRT 144852-144883 32 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 632118-632149 9 0.719
NC_016110_4 4.12|144974|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 144974-145005 32 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 772580-772611 9 0.719
NC_016110_4 4.12|144974|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 144974-145005 32 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 270226-270257 9 0.719
NC_016110_4 4.12|144974|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 144974-145005 32 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 1978131-1978162 9 0.719
NC_016110_4 4.12|144974|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 144974-145005 32 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 632115-632146 9 0.719
NC_016110_4 4.12|144974|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 144974-145005 32 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 632115-632146 9 0.719
NC_016110_4 4.12|144974|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 144974-145005 32 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 622356-622387 9 0.719
NC_016110_4 4.12|144974|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 144974-145005 32 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 632116-632147 9 0.719
NC_016110_4 4.12|144974|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 144974-145005 32 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 622356-622387 9 0.719
NC_016110_4 4.12|144974|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 144974-145005 32 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 632118-632149 9 0.719
NC_016110_4 4.12|144974|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 144974-145005 32 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 622356-622387 9 0.719
NC_016110_4 4.12|144974|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 144974-145005 32 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 622356-622387 9 0.719
NC_016110_4 4.12|144974|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 144974-145005 32 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 622356-622387 9 0.719
NC_016110_4 4.12|144974|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 144974-145005 32 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 632118-632149 9 0.719
NC_016110_4 4.12|144974|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 144974-145005 32 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 1404330-1404361 9 0.719
NC_016110_4 4.12|144974|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 144974-145005 32 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 1477196-1477227 9 0.719
NC_016110_4 4.12|144974|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 144974-145005 32 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 632118-632149 9 0.719
NC_016110_4 4.12|144974|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 144974-145005 32 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 619551-619582 9 0.719
NC_016110_4 4.12|144974|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 144974-145005 32 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 622343-622374 9 0.719
NC_016110_4 4.12|144974|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 144974-145005 32 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 632118-632149 9 0.719
NC_016110_4 4.12|144974|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 144974-145005 32 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 632112-632143 9 0.719
NC_016110_4 4.12|144974|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 144974-145005 32 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 632118-632149 9 0.719
NC_016110_4 4.12|144974|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 144974-145005 32 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 622358-622389 9 0.719
NC_016110_4 4.12|144974|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 144974-145005 32 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 632118-632149 9 0.719
NC_016110_4 4.12|144974|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 144974-145005 32 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 632118-632149 9 0.719
NC_016110_4 4.14|145097|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 145097-145128 32 NZ_CP014769 Hymenobacter sp. PAMC 26554 plasmid unnamed1, complete sequence 10971-11002 9 0.719
NC_016110_4 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 145158-145189 32 NZ_LR134451 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence 276240-276271 9 0.719
NC_016110_4 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 145158-145189 32 NC_008826 Methylibium petroleiphilum PM1 plasmid RPME01, complete sequence 347188-347219 9 0.719
NC_016110_4 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 145158-145189 32 KU985096 Mycobacterium phage Kazan, complete genome 31523-31554 9 0.719
NC_016110_4 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 145158-145189 32 MH051254 Mycobacterium phage Jabiru, complete genome 31018-31049 9 0.719
NC_016110_4 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 145158-145189 32 NC_028802 Mycobacterium phage UnionJack, complete genome 30706-30737 9 0.719
NC_016110_4 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 145158-145189 32 NC_008203 Mycobacterium phage Che12, complete genome 31531-31562 9 0.719
NC_016110_4 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 145158-145189 32 MG099947 Mycobacterium phage Ph8s, complete genome 31879-31910 9 0.719
NC_016110_4 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 145158-145189 32 NC_022087 Mycobacterium phage AnnaL29, complete genome 33519-33550 9 0.719
NC_016110_4 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 145158-145189 32 MT310878 Mycobacterium phage MK4, complete genome 31925-31956 9 0.719
NC_016110_4 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 145158-145189 32 MK359352 Mycobacterium phage JewelBug, complete genome 31687-31718 9 0.719
NC_016110_4 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 145158-145189 32 MN585989 Mycobacterium phage Superchunk, complete genome 31097-31128 9 0.719
NC_016110_4 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 145158-145189 32 KX641260 Mycobacterium phage Stasia, complete genome 32096-32127 9 0.719
NC_016110_4 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 145158-145189 32 MN234188 Mycobacterium phage Anthony, complete genome 30376-30407 9 0.719
NC_016110_4 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 145158-145189 32 NC_022058 Mycobacterium phage Adzzy, complete genome 31444-31475 9 0.719
NC_016110_4 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 145158-145189 32 KU695582 Mycobacterium phage McFly, complete genome 31517-31548 9 0.719
NC_016110_4 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 145158-145189 32 KF017927 Mycobacterium phage Odin, complete genome 31246-31277 9 0.719
NC_016110_4 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 145158-145189 32 NC_042036 Mycobacterium phage Rockstar, complete genome 31934-31965 9 0.719
NC_016110_4 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 145158-145189 32 MN586063 Mycobacterium phage Isca, complete genome 31940-31971 9 0.719
NC_016110_4 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 145158-145189 32 DQ398043 Mycobacterium virus Che12, complete genome 31531-31562 9 0.719
NC_016110_4 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 145158-145189 32 NC_023597 Mycobacterium phage 20ES, complete genome 33047-33078 9 0.719
NC_016110_4 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 145158-145189 32 KU761558 Mycobacterium phage Loser, complete genome 33468-33499 9 0.719
NC_016110_4 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 145158-145189 32 JF937092 Mycobacterium phage DaVinci, complete genome 30967-30998 9 0.719
NC_016110_4 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 145158-145189 32 GU339467 Mycobacterium phage RedRock, complete genome 33681-33712 9 0.719
NC_016110_4 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 145158-145189 32 NC_023564 Mycobacterium phage EagleEye, complete genome 32044-32075 9 0.719
NC_016110_4 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 145158-145189 32 KC172839 Mycobacterium phage BTCU-1, complete genome 32086-32117 9 0.719
NC_016110_4 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 145158-145189 32 MK894433 Mycobacterium phage Kipper29, complete genome 31536-31567 9 0.719
NC_016110_4 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 145158-145189 32 KJ510415 Mycobacterium phage Phantastic, complete genome 32129-32160 9 0.719
NC_016110_4 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 145158-145189 32 JN049605 Mycobacterium virus EricB, complete genome 31510-31541 9 0.719
NC_016110_4 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 145158-145189 32 MN224566 Mycobacterium phage Herbertwm, complete genome 32349-32380 9 0.719
NC_016110_4 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 145158-145189 32 NC_029077 Mycobacterium phage VohminGhazi, complete genome 31518-31549 9 0.719
NC_016110_4 4.16|145219|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 145219-145250 32 NZ_CP025114 Bradyrhizobium sp. SK17 strain CBNU plasmid unnamed, complete sequence 20746-20777 9 0.719
NC_016110_4 4.16|145219|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 145219-145250 32 NZ_CP025114 Bradyrhizobium sp. SK17 strain CBNU plasmid unnamed, complete sequence 283487-283518 9 0.719
NC_016110_4 4.17|145280|32|NC_016110|CRISPRCasFinder,CRT 145280-145311 32 NZ_LR134460 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 18, complete sequence 181819-181850 9 0.719
NC_016110_1 1.6|44999|31|NC_016110|CRISPRCasFinder 44999-45029 31 NZ_CP041045 Paracoccus sp. AK26 plasmid pAK1, complete sequence 41739-41769 10 0.677
NC_016110_1 1.17|44998|32|NC_016110|PILER-CR 44998-45029 32 NZ_CP041045 Paracoccus sp. AK26 plasmid pAK1, complete sequence 41739-41770 10 0.688
NC_016110_1 1.17|44998|32|NC_016110|PILER-CR 44998-45029 32 MK967377 Gordonia phage MagicMan, complete genome 7108-7139 10 0.688
NC_016110_1 1.17|44998|32|NC_016110|PILER-CR 44998-45029 32 MN813694 Gordonia phage Opie, complete genome 7123-7154 10 0.688
NC_016110_1 1.17|44998|32|NC_016110|PILER-CR 44998-45029 32 NC_031255 Gordonia phage Schwabeltier, complete genome 7109-7140 10 0.688
NC_016110_2 2.7|52510|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 52510-52541 32 MN018232 Synechococcus phage S-B43, complete genome 44680-44711 10 0.688
NC_016110_2 2.7|52510|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 52510-52541 32 MH920638 Synechoccus phage S-B05, partial genome 22216-22247 10 0.688
NC_016110_2 2.7|52510|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 52510-52541 32 MK799832 Synechococcus phage S-B05, complete genome 22216-22247 10 0.688
NC_016110_2 2.9|52632|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 52632-52663 32 NC_010905 Amycolatopsis benzoatilytica strain DSM 43387 plasmid pA387, complete sequence 26722-26753 10 0.688
NC_016110_2 2.9|52632|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 52632-52663 32 NZ_CP050096 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b3, complete sequence 26807-26838 10 0.688
NC_016110_2 2.9|52632|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 52632-52663 32 NZ_CP017077 Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence 828345-828376 10 0.688
NC_016110_2 2.9|52632|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 52632-52663 32 NZ_CP050102 Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b2, complete sequence 26811-26842 10 0.688
NC_016110_2 2.9|52632|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 52632-52663 32 NZ_CP050107 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b1, complete sequence 26810-26841 10 0.688
NC_016110_2 2.9|52632|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 52632-52663 32 NZ_CP023150 Mycobacterium intracellulare strain FLAC0181 plasmid pFLAC0181, complete sequence 23673-23704 10 0.688
NC_016110_2 2.9|52632|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 52632-52663 32 NZ_CP040254 Mycobacterium avium subsp. hominissuis strain 101115 plasmid pFLAC0181_CHOP101, complete sequence 7690-7721 10 0.688
NC_016110_2 2.9|52632|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 52632-52663 32 NZ_CP053444 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eB, complete sequence 57851-57882 10 0.688
NC_016110_2 2.9|52632|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 52632-52663 32 NZ_CP016287 Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence 298995-299026 10 0.688
NC_016110_2 2.9|52632|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 52632-52663 32 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 1233322-1233353 10 0.688
NC_016110_2 2.9|52632|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 52632-52663 32 NZ_CP040246 Mycobacterium avium subsp. hominissuis strain 101034 plasmid pFLAC0181_CHOP1, complete sequence 4378-4409 10 0.688
NC_016110_2 2.9|52632|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 52632-52663 32 NZ_CP040248 Mycobacterium avium subsp. hominissuis strain 101174 plasmid pFLAC0181_CHOP101, complete sequence 13588-13619 10 0.688
NC_016110_2 2.9|52632|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 52632-52663 32 NZ_CP050112 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b5, complete sequence 26809-26840 10 0.688
NC_016110_2 2.9|52632|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 52632-52663 32 NZ_CP021355 Rhodococcus sp. S2-17 plasmid pRB98, complete sequence 415555-415586 10 0.688
NC_016110_2 2.9|52632|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 52632-52663 32 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 1242793-1242824 10 0.688
NC_016110_2 2.9|52632|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 52632-52663 32 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 1312233-1312264 10 0.688
NC_016110_2 2.9|52632|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 52632-52663 32 NZ_CP012918 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p4, complete sequence 172053-172084 10 0.688
NC_016110_2 2.9|52632|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 52632-52663 32 MK937607 Gordonia phage Zipp, complete genome 3420-3451 10 0.688
NC_016110_2 2.12|52815|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 52815-52846 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 5208756-5208787 10 0.688
NC_016110_2 2.12|52815|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 52815-52846 32 NZ_AP014580 Burkholderia sp. RPE67 plasmid p2, complete sequence 77656-77687 10 0.688
NC_016110_2 2.12|52815|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 52815-52846 32 NZ_AP014803 Rhodovulum sulfidophilum plasmid Plasmid3 DNA, complete genome, strain: DSM 2351 48352-48383 10 0.688
NC_016110_2 2.12|52815|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 52815-52846 32 NZ_CP020386 Rhodovulum sp. MB263 plasmid pRSMBB, complete sequence 37801-37832 10 0.688
NC_016110_3 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT 134017-134048 32 NZ_CP032325 Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence 149473-149504 10 0.688
NC_016110_3 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT 134017-134048 32 NC_016623 Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence 571509-571540 10 0.688
NC_016110_3 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT 134017-134048 32 NC_015583 Novosphingobium sp. PP1Y plasmid Mpl, complete sequence 1156523-1156554 10 0.688
NC_016110_3 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT 134017-134048 32 NC_022090 Staphylococcus phage vB_SauM_Remus, complete genome 29616-29647 10 0.688
NC_016110_3 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT 134017-134048 32 MT080595 UNVERIFIED: Staphylococcus phage vB_SauM_EW41, partial genome 22293-22324 10 0.688
NC_016110_3 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT 134017-134048 32 NC_020877 Staphylococcus phage vB_SauM_Romulus, complete genome 29616-29647 10 0.688
NC_016110_3 3.4|134139|32|NC_016110|CRISPRCasFinder,CRT 134139-134170 32 NZ_CP009572 Sphingomonas taxi strain ATCC 55669 plasmid STP1, complete sequence 143391-143422 10 0.688
NC_016110_3 3.10|134505|32|NC_016110|CRISPRCasFinder,CRT 134505-134536 32 NC_008269 Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence 563242-563273 10 0.688
NC_016110_3 3.10|134505|32|NC_016110|CRISPRCasFinder,CRT 134505-134536 32 NZ_CP032676 Rhodococcus rhodochrous strain ATCC BAA870 plasmid pNit, complete sequence 163159-163190 10 0.688
NC_016110_3 3.10|134505|32|NC_016110|CRISPRCasFinder,CRT 134505-134536 32 CP003954 Rhodococcus opacus PD630 plasmid 5, complete sequence 72002-72033 10 0.688
NC_016110_4 4.3|144425|32|NC_016110|PILER-CR,CRISPRCasFinder,CRT 144425-144456 32 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 312687-312718 10 0.688
NC_016110_4 4.8|144730|32|NC_016110|CRISPRCasFinder,CRT 144730-144761 32 NZ_CP005085 Sphingobium sp. TKS plasmid pTK1, complete sequence 298049-298080 10 0.688
NC_016110_4 4.8|144730|32|NC_016110|CRISPRCasFinder,CRT 144730-144761 32 NZ_CP025188 Roseomonas mucosa strain AD2 plasmid p1-AD2, complete sequence 302077-302108 10 0.688
NC_016110_4 4.14|145097|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 145097-145128 32 NC_008713 Paenarthrobacter aurescens TC1 plasmid pTC2, complete sequence 169689-169720 10 0.688
NC_016110_4 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 145158-145189 32 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 1075177-1075208 10 0.688
NC_016110_4 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 145158-145189 32 NZ_CP024310 Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence 993542-993573 10 0.688
NC_016110_4 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 145158-145189 32 NZ_CP023064 Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence 812361-812392 10 0.688
NC_016110_4 4.17|145280|32|NC_016110|CRISPRCasFinder,CRT 145280-145311 32 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 446626-446657 10 0.688
NC_016110_4 4.17|145280|32|NC_016110|CRISPRCasFinder,CRT 145280-145311 32 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 1366442-1366473 10 0.688
NC_016110_4 4.17|145280|32|NC_016110|CRISPRCasFinder,CRT 145280-145311 32 NZ_CP024313 Rhizobium sp. NXC24 plasmid pRspNXC24b, complete sequence 39586-39617 10 0.688
NC_016110_2 2.5|52382|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 52382-52413 32 LT599585 Pseudomonas veronii 1YdBTEX2 genome assembly, plasmid: PVE_plasmid 53566-53597 11 0.656
NC_016110_2 2.12|52815|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 52815-52846 32 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 1589202-1589233 11 0.656
NC_016110_3 3.6|134261|32|NC_016110|CRISPRCasFinder,CRT 134261-134292 32 CP053577 Salmonella enterica strain 2012K-0845 plasmid unnamed2, complete sequence 154175-154206 11 0.656
NC_016110_3 3.6|134261|32|NC_016110|CRISPRCasFinder,CRT 134261-134292 32 NZ_CP022661 Salmonella enterica subsp. enterica strain RM11065 plasmid pRM11065-1, complete sequence 48928-48959 11 0.656
NC_016110_3 3.6|134261|32|NC_016110|CRISPRCasFinder,CRT 134261-134292 32 NZ_CP032697 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525a, complete sequence 260358-260389 11 0.656
NC_016110_4 4.6|144608|32|NC_016110|CRISPRCasFinder,CRT 144608-144639 32 NC_019848 Sinorhizobium meliloti GR4 plasmid pRmeGR4c, complete sequence 243641-243672 11 0.656
NC_016110_4 4.6|144608|32|NC_016110|CRISPRCasFinder,CRT 144608-144639 32 NC_003037 Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence 1007248-1007279 11 0.656
NC_016110_4 4.6|144608|32|NC_016110|CRISPRCasFinder,CRT 144608-144639 32 NZ_CP019585 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence 1031380-1031411 11 0.656
NC_016110_4 4.6|144608|32|NC_016110|CRISPRCasFinder,CRT 144608-144639 32 NC_017327 Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence 577596-577627 11 0.656
NC_016110_4 4.6|144608|32|NC_016110|CRISPRCasFinder,CRT 144608-144639 32 NZ_CP021798 Sinorhizobium meliloti strain USDA1106 plasmid psymA, complete sequence 1073551-1073582 11 0.656
NC_016110_4 4.6|144608|32|NC_016110|CRISPRCasFinder,CRT 144608-144639 32 NC_017324 Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence 1584512-1584543 11 0.656
NC_016110_4 4.6|144608|32|NC_016110|CRISPRCasFinder,CRT 144608-144639 32 NZ_CP021827 Sinorhizobium meliloti strain KH35c plasmid psymA, complete sequence 1072706-1072737 11 0.656
NC_016110_4 4.6|144608|32|NC_016110|CRISPRCasFinder,CRT 144608-144639 32 NZ_CP021801 Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence 517518-517549 11 0.656
NC_016110_4 4.6|144608|32|NC_016110|CRISPRCasFinder,CRT 144608-144639 32 NZ_CP021830 Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence 31066-31097 11 0.656
NC_016110_4 4.6|144608|32|NC_016110|CRISPRCasFinder,CRT 144608-144639 32 NZ_CP021794 Sinorhizobium meliloti strain USDA1157 plasmid psymA, complete sequence 1014563-1014594 11 0.656
NC_016110_4 4.6|144608|32|NC_016110|CRISPRCasFinder,CRT 144608-144639 32 NZ_CP021805 Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence 1309771-1309802 11 0.656
NC_016110_4 4.6|144608|32|NC_016110|CRISPRCasFinder,CRT 144608-144639 32 NZ_CP021217 Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence 162512-162543 11 0.656
NC_016110_4 4.6|144608|32|NC_016110|CRISPRCasFinder,CRT 144608-144639 32 NZ_CP026526 Sinorhizobium meliloti strain AK21 plasmid pSymA, complete sequence 1296494-1296525 11 0.656
NC_016110_4 4.6|144608|32|NC_016110|CRISPRCasFinder,CRT 144608-144639 32 NZ_CP019483 Sinorhizobium meliloti strain B401 plasmid pSymA, complete sequence 865465-865496 11 0.656
NC_016110_4 4.6|144608|32|NC_016110|CRISPRCasFinder,CRT 144608-144639 32 NZ_CP019486 Sinorhizobium meliloti strain B399 plasmid pSymA, complete sequence 828217-828248 11 0.656
NC_016110_4 4.6|144608|32|NC_016110|CRISPRCasFinder,CRT 144608-144639 32 NC_020527 Sinorhizobium meliloti 2011 plasmid pSymA, complete sequence 1005587-1005618 11 0.656
NC_016110_4 4.16|145219|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR 145219-145250 32 MN234203 Mycobacterium phage SemperFi, complete genome 31730-31761 11 0.656
NC_016110_4 4.17|145280|32|NC_016110|CRISPRCasFinder,CRT 145280-145311 32 NC_048733 Microbacterium phage Burro, complete genome 45670-45701 15 0.531

1. spacer 1.1|44694|31|NC_016110|CRISPRCasFinder matches to NC_016110 (Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence) position: , mismatch: 0, identity: 1.0

ctgcagaaccgggtcatcacggtgacgacca	CRISPR spacer
ctgcagaaccgggtcatcacggtgacgacca	Protospacer
*******************************

2. spacer 1.2|44755|31|NC_016110|CRISPRCasFinder matches to NC_016110 (Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence) position: , mismatch: 0, identity: 1.0

accctgggcgccctgtagggcccgctgacgc	CRISPR spacer
accctgggcgccctgtagggcccgctgacgc	Protospacer
*******************************

3. spacer 1.3|44816|31|NC_016110|CRISPRCasFinder matches to NC_016110 (Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence) position: , mismatch: 0, identity: 1.0

tgcagatgagcgcgtcggcgcacgcggcatg	CRISPR spacer
tgcagatgagcgcgtcggcgcacgcggcatg	Protospacer
*******************************

4. spacer 1.4|44877|31|NC_016110|CRISPRCasFinder matches to NC_016110 (Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence) position: , mismatch: 0, identity: 1.0

gcaaggttcgcaaccgatcggagaagctcgg	CRISPR spacer
gcaaggttcgcaaccgatcggagaagctcgg	Protospacer
*******************************

5. spacer 1.5|44938|31|NC_016110|CRISPRCasFinder matches to NC_016110 (Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence) position: , mismatch: 0, identity: 1.0

tcatcatcacgccgcgcacggcggcgttgtc	CRISPR spacer
tcatcatcacgccgcgcacggcggcgttgtc	Protospacer
*******************************

6. spacer 1.6|44999|31|NC_016110|CRISPRCasFinder matches to NC_016110 (Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence) position: , mismatch: 0, identity: 1.0

cgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
cgttcgtcggcgccctggtcctcaccgcccc	Protospacer
*******************************

7. spacer 1.7|44693|39|NC_016110|CRT matches to NC_016110 (Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence) position: , mismatch: 0, identity: 1.0

tctgcagaaccgggtcatcacggtgacgaccagggacct	CRISPR spacer
tctgcagaaccgggtcatcacggtgacgaccagggacct	Protospacer
***************************************

8. spacer 1.8|44754|39|NC_016110|CRT matches to NC_016110 (Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence) position: , mismatch: 0, identity: 1.0

gaccctgggcgccctgtagggcccgctgacgcgggacca	CRISPR spacer
gaccctgggcgccctgtagggcccgctgacgcgggacca	Protospacer
***************************************

9. spacer 1.9|44815|39|NC_016110|CRT matches to NC_016110 (Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence) position: , mismatch: 0, identity: 1.0

atgcagatgagcgcgtcggcgcacgcggcatggggacca	CRISPR spacer
atgcagatgagcgcgtcggcgcacgcggcatggggacca	Protospacer
***************************************

10. spacer 1.10|44876|39|NC_016110|CRT matches to NC_016110 (Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence) position: , mismatch: 0, identity: 1.0

agcaaggttcgcaaccgatcggagaagctcgggggacca	CRISPR spacer
agcaaggttcgcaaccgatcggagaagctcgggggacca	Protospacer
***************************************

11. spacer 1.11|44937|39|NC_016110|CRT matches to NC_016110 (Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence) position: , mismatch: 0, identity: 1.0

gtcatcatcacgccgcgcacggcggcgttgtcgggacca	CRISPR spacer
gtcatcatcacgccgcgcacggcggcgttgtcgggacca	Protospacer
***************************************

12. spacer 1.12|44998|39|NC_016110|CRT matches to NC_016110 (Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence) position: , mismatch: 0, identity: 1.0

gcgttcgtcggcgccctggtcctcaccgccccgggacca	CRISPR spacer
gcgttcgtcggcgccctggtcctcaccgccccgggacca	Protospacer
***************************************

13. spacer 1.13|44754|32|NC_016110|PILER-CR matches to NC_016110 (Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence) position: , mismatch: 0, identity: 1.0

gaccctgggcgccctgtagggcccgctgacgc	CRISPR spacer
gaccctgggcgccctgtagggcccgctgacgc	Protospacer
********************************

14. spacer 1.14|44815|32|NC_016110|PILER-CR matches to NC_016110 (Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence) position: , mismatch: 0, identity: 1.0

atgcagatgagcgcgtcggcgcacgcggcatg	CRISPR spacer
atgcagatgagcgcgtcggcgcacgcggcatg	Protospacer
********************************

15. spacer 1.15|44876|32|NC_016110|PILER-CR matches to NC_016110 (Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence) position: , mismatch: 0, identity: 1.0

agcaaggttcgcaaccgatcggagaagctcgg	CRISPR spacer
agcaaggttcgcaaccgatcggagaagctcgg	Protospacer
********************************

16. spacer 1.16|44937|32|NC_016110|PILER-CR matches to NC_016110 (Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence) position: , mismatch: 0, identity: 1.0

gtcatcatcacgccgcgcacggcggcgttgtc	CRISPR spacer
gtcatcatcacgccgcgcacggcggcgttgtc	Protospacer
********************************

17. spacer 1.17|44998|32|NC_016110|PILER-CR matches to NC_016110 (Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence) position: , mismatch: 0, identity: 1.0

gcgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
gcgttcgtcggcgccctggtcctcaccgcccc	Protospacer
********************************

18. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to NC_016110 (Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence) position: , mismatch: 0, identity: 1.0

gacgcgacgcttcccgccggtcgccgcctg	CRISPR spacer
gacgcgacgcttcccgccggtcgccgcctg	Protospacer
******************************

19. spacer 2.2|52199|32|NC_016110|CRISPRCasFinder,CRT matches to NC_016110 (Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence) position: , mismatch: 0, identity: 1.0

ccggcgcgggtgccgcgcagagcggcggcccc	CRISPR spacer
ccggcgcgggtgccgcgcagagcggcggcccc	Protospacer
********************************

20. spacer 2.3|52260|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NC_016110 (Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence) position: , mismatch: 0, identity: 1.0

gtgttcgggtggcttcccgcccctgcgttgtt	CRISPR spacer
gtgttcgggtggcttcccgcccctgcgttgtt	Protospacer
********************************

21. spacer 2.4|52321|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NC_021056 (Streptomyces sp. PAMC 26508 plasmid pSP01, complete sequence) position: , mismatch: 0, identity: 1.0

ggtcggtcgctccagaccatcgagcgcaacgt	CRISPR spacer
ggtcggtcgctccagaccatcgagcgcaacgt	Protospacer
********************************

22. spacer 2.4|52321|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NC_016110 (Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence) position: , mismatch: 0, identity: 1.0

ggtcggtcgctccagaccatcgagcgcaacgt	CRISPR spacer
ggtcggtcgctccagaccatcgagcgcaacgt	Protospacer
********************************

23. spacer 2.5|52382|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NC_016110 (Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence) position: , mismatch: 0, identity: 1.0

gagtggcgttttggcatgctgcgggccgtgac	CRISPR spacer
gagtggcgttttggcatgctgcgggccgtgac	Protospacer
********************************

24. spacer 2.6|52443|38|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NC_016110 (Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence) position: , mismatch: 0, identity: 1.0

gcggtggacccgccaagcttgtcagcgttgatggcctt	CRISPR spacer
gcggtggacccgccaagcttgtcagcgttgatggcctt	Protospacer
**************************************

25. spacer 2.7|52510|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NC_016110 (Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence) position: , mismatch: 0, identity: 1.0

acccggaacgtctcatcgaacgatgctgcgat	CRISPR spacer
acccggaacgtctcatcgaacgatgctgcgat	Protospacer
********************************

26. spacer 2.8|52571|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NC_016110 (Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence) position: , mismatch: 0, identity: 1.0

tcacatccccggcaagcggcccaagatctact	CRISPR spacer
tcacatccccggcaagcggcccaagatctact	Protospacer
********************************

27. spacer 2.9|52632|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NC_016110 (Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence) position: , mismatch: 0, identity: 1.0

cgctcgacgacgatgccgagttcggtgttgga	CRISPR spacer
cgctcgacgacgatgccgagttcggtgttgga	Protospacer
********************************

28. spacer 2.10|52693|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NC_016110 (Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence) position: , mismatch: 0, identity: 1.0

ataccggcgacggggtaccacgcggcgagggc	CRISPR spacer
ataccggcgacggggtaccacgcggcgagggc	Protospacer
********************************

29. spacer 2.11|52754|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NC_016110 (Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence) position: , mismatch: 0, identity: 1.0

atccggtgtccggacccgaggtggcgtcctcg	CRISPR spacer
atccggtgtccggacccgaggtggcgtcctcg	Protospacer
********************************

30. spacer 2.12|52815|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NC_016110 (Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence) position: , mismatch: 0, identity: 1.0

gggagctgcgcaacgacttcgacgatgcgctt	CRISPR spacer
gggagctgcgcaacgacttcgacgatgcgctt	Protospacer
********************************

31. spacer 3.1|133953|35|NC_016110|CRISPRCasFinder,CRT matches to NC_016110 (Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtcctccacctgcttcctgccgctcggtccgga	CRISPR spacer
gcgtcctccacctgcttcctgccgctcggtccgga	Protospacer
***********************************

32. spacer 3.1|133953|35|NC_016110|CRISPRCasFinder,CRT matches to NZ_CP038146 (Streptomyces sp. S501 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtcctccacctgcttcctgccgctcggtccgga	CRISPR spacer
gcgtcctccacctgcttcctgccgctcggtccgga	Protospacer
***********************************

33. spacer 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT matches to NC_016110 (Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence) position: , mismatch: 0, identity: 1.0

gtcgcggtgtcggtggcggtggacttccgggt	CRISPR spacer
gtcgcggtgtcggtggcggtggacttccgggt	Protospacer
********************************

34. spacer 3.3|134078|32|NC_016110|CRISPRCasFinder,CRT matches to NC_016110 (Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence) position: , mismatch: 0, identity: 1.0

gtcggtctcgccgtaatcaatccaagcgggct	CRISPR spacer
gtcggtctcgccgtaatcaatccaagcgggct	Protospacer
********************************

35. spacer 3.4|134139|32|NC_016110|CRISPRCasFinder,CRT matches to NC_016110 (Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence) position: , mismatch: 0, identity: 1.0

aagggagggccggcggttgcacgcacgatggc	CRISPR spacer
aagggagggccggcggttgcacgcacgatggc	Protospacer
********************************

36. spacer 3.5|134200|32|NC_016110|CRISPRCasFinder,CRT matches to NC_016110 (Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence) position: , mismatch: 0, identity: 1.0

gcgctcagcacctccggagagtcccgggtggt	CRISPR spacer
gcgctcagcacctccggagagtcccgggtggt	Protospacer
********************************

37. spacer 3.6|134261|32|NC_016110|CRISPRCasFinder,CRT matches to NC_016110 (Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence) position: , mismatch: 0, identity: 1.0

ttgacaacggacttccagcgcttcggatacgc	CRISPR spacer
ttgacaacggacttccagcgcttcggatacgc	Protospacer
********************************

38. spacer 3.7|134322|32|NC_016110|CRISPRCasFinder,CRT matches to NC_016110 (Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence) position: , mismatch: 0, identity: 1.0

acgcctgcagcaggtacgtcgtccccgccttt	CRISPR spacer
acgcctgcagcaggtacgtcgtccccgccttt	Protospacer
********************************

39. spacer 3.8|134383|32|NC_016110|CRISPRCasFinder,CRT matches to NC_016110 (Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence) position: , mismatch: 0, identity: 1.0

acaagcgcacgttcccggtccgcgtacgtgat	CRISPR spacer
acaagcgcacgttcccggtccgcgtacgtgat	Protospacer
********************************

40. spacer 3.9|134444|32|NC_016110|CRISPRCasFinder,CRT matches to NC_016110 (Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence) position: , mismatch: 0, identity: 1.0

accgccccgccggtccccggacagctcggcat	CRISPR spacer
accgccccgccggtccccggacagctcggcat	Protospacer
********************************

41. spacer 3.10|134505|32|NC_016110|CRISPRCasFinder,CRT matches to NC_016110 (Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence) position: , mismatch: 0, identity: 1.0

tccttgaagtccacgccgtgccggtcggaggg	CRISPR spacer
tccttgaagtccacgccgtgccggtcggaggg	Protospacer
********************************

42. spacer 3.11|134566|32|NC_016110|CRISPRCasFinder,CRT matches to NC_016110 (Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence) position: , mismatch: 0, identity: 1.0

agcgggcagtggtagcgcattgtcgggccgta	CRISPR spacer
agcgggcagtggtagcgcattgtcgggccgta	Protospacer
********************************

43. spacer 3.12|134261|33|NC_016110|PILER-CR matches to NC_016110 (Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence) position: , mismatch: 0, identity: 1.0

ttgacaacggacttccagcgcttcggatacgcg	CRISPR spacer
ttgacaacggacttccagcgcttcggatacgcg	Protospacer
*********************************

44. spacer 3.13|134322|33|NC_016110|PILER-CR matches to NC_016110 (Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence) position: , mismatch: 0, identity: 1.0

acgcctgcagcaggtacgtcgtccccgcctttg	CRISPR spacer
acgcctgcagcaggtacgtcgtccccgcctttg	Protospacer
*********************************

45. spacer 3.14|134383|33|NC_016110|PILER-CR matches to NC_016110 (Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence) position: , mismatch: 0, identity: 1.0

acaagcgcacgttcccggtccgcgtacgtgatg	CRISPR spacer
acaagcgcacgttcccggtccgcgtacgtgatg	Protospacer
*********************************

46. spacer 3.15|134444|33|NC_016110|PILER-CR matches to NC_016110 (Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence) position: , mismatch: 0, identity: 1.0

accgccccgccggtccccggacagctcggcatg	CRISPR spacer
accgccccgccggtccccggacagctcggcatg	Protospacer
*********************************

47. spacer 3.16|134505|33|NC_016110|PILER-CR matches to NC_016110 (Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence) position: , mismatch: 0, identity: 1.0

tccttgaagtccacgccgtgccggtcggagggc	CRISPR spacer
tccttgaagtccacgccgtgccggtcggagggc	Protospacer
*********************************

48. spacer 3.17|134566|33|NC_016110|PILER-CR matches to NC_016110 (Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence) position: , mismatch: 0, identity: 1.0

agcgggcagtggtagcgcattgtcgggccgtag	CRISPR spacer
agcgggcagtggtagcgcattgtcgggccgtag	Protospacer
*********************************

49. spacer 4.1|144303|32|NC_016110|PILER-CR,CRISPRCasFinder,CRT matches to NC_016110 (Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence) position: , mismatch: 0, identity: 1.0

catcgtgaagatcctcggtcgggagcctgccg	CRISPR spacer
catcgtgaagatcctcggtcgggagcctgccg	Protospacer
********************************

50. spacer 4.2|144364|32|NC_016110|PILER-CR,CRISPRCasFinder,CRT matches to NC_016110 (Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence) position: , mismatch: 0, identity: 1.0

tgcggcgcgtcatcctccgggagcgcgccgcc	CRISPR spacer
tgcggcgcgtcatcctccgggagcgcgccgcc	Protospacer
********************************

51. spacer 4.3|144425|32|NC_016110|PILER-CR,CRISPRCasFinder,CRT matches to NC_016110 (Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence) position: , mismatch: 0, identity: 1.0

tgccgaccgacgcctggtcggccggttcgctc	CRISPR spacer
tgccgaccgacgcctggtcggccggttcgctc	Protospacer
********************************

52. spacer 4.4|144486|32|NC_016110|PILER-CR,CRISPRCasFinder,CRT matches to NC_016110 (Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence) position: , mismatch: 0, identity: 1.0

gtcacagtgacgccaccaaggggcccagaaga	CRISPR spacer
gtcacagtgacgccaccaaggggcccagaaga	Protospacer
********************************

53. spacer 4.5|144547|32|NC_016110|CRISPRCasFinder,CRT matches to NC_016110 (Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence) position: , mismatch: 0, identity: 1.0

gcggcacgtggtcacaggcctcgtcccaagcg	CRISPR spacer
gcggcacgtggtcacaggcctcgtcccaagcg	Protospacer
********************************

54. spacer 4.6|144608|32|NC_016110|CRISPRCasFinder,CRT matches to NC_016110 (Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence) position: , mismatch: 0, identity: 1.0

tgcacgacctggtcgtgggacgtgacccggct	CRISPR spacer
tgcacgacctggtcgtgggacgtgacccggct	Protospacer
********************************

55. spacer 4.7|144669|32|NC_016110|CRISPRCasFinder,CRT matches to NC_016110 (Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence) position: , mismatch: 0, identity: 1.0

cacctgcggggctcgctggttttccggaccgg	CRISPR spacer
cacctgcggggctcgctggttttccggaccgg	Protospacer
********************************

56. spacer 4.8|144730|32|NC_016110|CRISPRCasFinder,CRT matches to NC_016110 (Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagcccgtcccggccgatccgtaggaatgc	CRISPR spacer
ccgagcccgtcccggccgatccgtaggaatgc	Protospacer
********************************

57. spacer 4.9|144791|32|NC_016110|CRISPRCasFinder,CRT matches to NC_016110 (Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence) position: , mismatch: 0, identity: 1.0

gccggcggctcctggtacgcagggctggtgca	CRISPR spacer
gccggcggctcctggtacgcagggctggtgca	Protospacer
********************************

58. spacer 4.9|144791|32|NC_016110|CRISPRCasFinder,CRT matches to NC_016110 (Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence) position: , mismatch: 0, identity: 1.0

gccggcggctcctggtacgcagggctggtgca	CRISPR spacer
gccggcggctcctggtacgcagggctggtgca	Protospacer
********************************

59. spacer 4.10|144852|32|NC_016110|CRISPRCasFinder,CRT matches to NC_016110 (Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence) position: , mismatch: 0, identity: 1.0

tccgaccacgccgaaacgcaggtccccggcgg	CRISPR spacer
tccgaccacgccgaaacgcaggtccccggcgg	Protospacer
********************************

60. spacer 4.10|144852|32|NC_016110|CRISPRCasFinder,CRT matches to NC_016110 (Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence) position: , mismatch: 0, identity: 1.0

tccgaccacgccgaaacgcaggtccccggcgg	CRISPR spacer
tccgaccacgccgaaacgcaggtccccggcgg	Protospacer
********************************

61. spacer 4.11|144913|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NC_016110 (Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence) position: , mismatch: 0, identity: 1.0

gccggcggctcctggtacgcagggctggtgca	CRISPR spacer
gccggcggctcctggtacgcagggctggtgca	Protospacer
********************************

62. spacer 4.11|144913|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NC_016110 (Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence) position: , mismatch: 0, identity: 1.0

gccggcggctcctggtacgcagggctggtgca	CRISPR spacer
gccggcggctcctggtacgcagggctggtgca	Protospacer
********************************

63. spacer 4.12|144974|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NC_016110 (Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence) position: , mismatch: 0, identity: 1.0

tccgaccacgccgaaacgcaggtccccggcgg	CRISPR spacer
tccgaccacgccgaaacgcaggtccccggcgg	Protospacer
********************************

64. spacer 4.12|144974|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NC_016110 (Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence) position: , mismatch: 0, identity: 1.0

tccgaccacgccgaaacgcaggtccccggcgg	CRISPR spacer
tccgaccacgccgaaacgcaggtccccggcgg	Protospacer
********************************

65. spacer 4.13|145035|33|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NC_016110 (Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence) position: , mismatch: 0, identity: 1.0

gccaccaagtcgtccgacgggcagacccgctcg	CRISPR spacer
gccaccaagtcgtccgacgggcagacccgctcg	Protospacer
*********************************

66. spacer 4.14|145097|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NC_016110 (Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence) position: , mismatch: 0, identity: 1.0

agcttggcgtaggtgccttcgccgggtccgac	CRISPR spacer
agcttggcgtaggtgccttcgccgggtccgac	Protospacer
********************************

67. spacer 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NC_016110 (Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence) position: , mismatch: 0, identity: 1.0

accgccgcgaacatgaccagctgcccgatgat	CRISPR spacer
accgccgcgaacatgaccagctgcccgatgat	Protospacer
********************************

68. spacer 4.16|145219|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NC_016110 (Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence) position: , mismatch: 0, identity: 1.0

tacaacacccgaggactgatccaggtcaagaa	CRISPR spacer
tacaacacccgaggactgatccaggtcaagaa	Protospacer
********************************

69. spacer 4.17|145280|32|NC_016110|CRISPRCasFinder,CRT matches to NC_016110 (Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence) position: , mismatch: 0, identity: 1.0

gacggagcgatcggccggtaccggttgaaggg	CRISPR spacer
gacggagcgatcggccggtaccggttgaaggg	Protospacer
********************************

70. spacer 4.17|145280|32|NC_016110|CRISPRCasFinder,CRT matches to NZ_CP038146 (Streptomyces sp. S501 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gacggagcgatcggccggtaccggttgaaggg	CRISPR spacer
gacggagcgatcggccggtaccggttgaaggg	Protospacer
********************************

71. spacer 3.5|134200|32|NC_016110|CRISPRCasFinder,CRT matches to NC_001387 (Streptomyces lividans plasmid pIJ101, complete sequence) position: , mismatch: 2, identity: 0.938

gcgctcagcacctccggagagtcccgggtggt	CRISPR spacer
gcgctcagcacctccggggagtcccgcgtggt	Protospacer
*****************.******** *****

72. spacer 1.3|44816|31|NC_016110|CRISPRCasFinder matches to NZ_CP052758 (Cellulosimicrobium sp. BI34T plasmid pCPRO01, complete sequence) position: , mismatch: 3, identity: 0.903

tgcagatgagcgcgtcggcgcacgcggcatg	CRISPR spacer
tgcagatgggcgcgtcggcgcgcgcggcagg	Protospacer
********.************.******* *

73. spacer 1.14|44815|32|NC_016110|PILER-CR matches to NZ_CP052758 (Cellulosimicrobium sp. BI34T plasmid pCPRO01, complete sequence) position: , mismatch: 3, identity: 0.906

atgcagatgagcgcgtcggcgcacgcggcatg	CRISPR spacer
atgcagatgggcgcgtcggcgcgcgcggcagg	Protospacer
*********.************.******* *

74. spacer 3.10|134505|32|NC_016110|CRISPRCasFinder,CRT matches to NZ_CP048398 (Streptomyces sp. S4.7 plasmid pSSPS4.7a, complete sequence) position: , mismatch: 3, identity: 0.906

tccttgaagtccacgccgtgccggtcggaggg	CRISPR spacer
ttcttgaagtcgacgccgtgccggtcggacgg	Protospacer
*.********* ***************** **

75. spacer 3.16|134505|33|NC_016110|PILER-CR matches to NZ_CP048398 (Streptomyces sp. S4.7 plasmid pSSPS4.7a, complete sequence) position: , mismatch: 3, identity: 0.909

tccttgaagtccacgccgtgccggtcggagggc	CRISPR spacer
ttcttgaagtcgacgccgtgccggtcggacggc	Protospacer
*.********* ***************** ***

76. spacer 1.5|44938|31|NC_016110|CRISPRCasFinder matches to NC_049489 (Arthrobacter phage DrYang, complete genome) position: , mismatch: 4, identity: 0.871

tcatcatcacgccgcgcacggcgg-cgttgtc	CRISPR spacer
tcaccatcacgcagcgcacggcggaggttgt-	Protospacer
***.******** ***********  ***** 

77. spacer 1.16|44937|32|NC_016110|PILER-CR matches to NC_049489 (Arthrobacter phage DrYang, complete genome) position: , mismatch: 4, identity: 0.875

gtcatcatcacgccgcgcacggcgg-cgttgtc	CRISPR spacer
gtcaccatcacgcagcgcacggcggaggttgt-	Protospacer
****.******** ***********  ***** 

78. spacer 2.2|52199|32|NC_016110|CRISPRCasFinder,CRT matches to KY092484 (Streptomyces phage Raleigh, complete genome) position: , mismatch: 4, identity: 0.875

ccggcgcgggtgccgcgcagagcggcggcccc	CRISPR spacer
ccggtgcgggtgccgcgcagtgcggcggtgcc	Protospacer
****.*************** *******. **

79. spacer 1.3|44816|31|NC_016110|CRISPRCasFinder matches to NZ_LR134460 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 18, complete sequence) position: , mismatch: 5, identity: 0.839

tgcagatgagcgcgtcggcgcacgcggcatg	CRISPR spacer
ggacgatgagcgcgtcggcgcccgcggcgtg	Protospacer
 *  ***************** ******.**

80. spacer 1.5|44938|31|NC_016110|CRISPRCasFinder matches to NZ_CP015008 (Aminobacter aminovorans strain KCTC 2477 plasmid pAA03, complete sequence) position: , mismatch: 5, identity: 0.839

tcatc-atcacgccgcgcacggcggcgttgtc	CRISPR spacer
-cgtcgagcgcgccgcgcacggcggcgatgtc	Protospacer
 *.** * *.***************** ****

81. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833

gacgcgacgcttcccgccggtcgccgcctg	CRISPR spacer
gtggcaacgcttcccgccggtcgccggccg	Protospacer
*  **.******************** *.*

82. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 5, identity: 0.833

gacgcgacgcttcccgccggtcgccgcctg	CRISPR spacer
gtggcaacgcttcccgccggtcgccggccg	Protospacer
*  **.******************** *.*

83. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833

gacgcgacgcttcccgccggtcgccgcctg	CRISPR spacer
gtggcaacgcttcccgccggtcgccggccg	Protospacer
*  **.******************** *.*

84. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833

gacgcgacgcttcccgccggtcgccgcctg	CRISPR spacer
gtggcaacgcttcccgccggtcgccggccg	Protospacer
*  **.******************** *.*

85. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833

gacgcgacgcttcccgccggtcgccgcctg	CRISPR spacer
gtggcaacgcttcccgccggtcgccggccg	Protospacer
*  **.******************** *.*

86. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 5, identity: 0.833

gacgcgacgcttcccgccggtcgccgcctg	CRISPR spacer
gtggcaacgcttcccgccggtcgccggccg	Protospacer
*  **.******************** *.*

87. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 5, identity: 0.833

gacgcgacgcttcccgccggtcgccgcctg	CRISPR spacer
gtggcaacgcttcccgccggtcgccggccg	Protospacer
*  **.******************** *.*

88. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 5, identity: 0.833

gacgcgacgcttcccgccggtcgccgcctg	CRISPR spacer
gtggcaacgcttcccgccggtcgccggccg	Protospacer
*  **.******************** *.*

89. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833

gacgcgacgcttcccgccggtcgccgcctg	CRISPR spacer
gtggcaacgcttcccgccggtcgccggccg	Protospacer
*  **.******************** *.*

90. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.833

gacgcgacgcttcccgccggtcgccgcctg	CRISPR spacer
gtggcaacgcttcccgccggtcgccggccg	Protospacer
*  **.******************** *.*

91. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.833

gacgcgacgcttcccgccggtcgccgcctg	CRISPR spacer
gtggcaacgcttcccgccggtcgccggccg	Protospacer
*  **.******************** *.*

92. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833

gacgcgacgcttcccgccggtcgccgcctg	CRISPR spacer
gtggcaacgcttcccgccggtcgccggccg	Protospacer
*  **.******************** *.*

93. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833

gacgcgacgcttcccgccggtcgccgcctg	CRISPR spacer
gtggcaacgcttcccgccggtcgccggccg	Protospacer
*  **.******************** *.*

94. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833

gacgcgacgcttcccgccggtcgccgcctg	CRISPR spacer
gtggcaacgcttcccgccggtcgccggccg	Protospacer
*  **.******************** *.*

95. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833

gacgcgacgcttcccgccggtcgccgcctg	CRISPR spacer
gtggcaacgcttcccgccggtcgccggccg	Protospacer
*  **.******************** *.*

96. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833

gacgcgacgcttcccgccggtcgccgcctg	CRISPR spacer
gtggcaacgcttcccgccggtcgccggccg	Protospacer
*  **.******************** *.*

97. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 5, identity: 0.833

gacgcgacgcttcccgccggtcgccgcctg	CRISPR spacer
gtggcaacgcttcccgccggtcgccggccg	Protospacer
*  **.******************** *.*

98. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.833

gacgcgacgcttcccgccggtcgccgcctg	CRISPR spacer
gtggcaacgcttcccgccggtcgccggccg	Protospacer
*  **.******************** *.*

99. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833

gacgcgacgcttcccgccggtcgccgcctg	CRISPR spacer
gtggcaacgcttcccgccggtcgccggccg	Protospacer
*  **.******************** *.*

100. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 5, identity: 0.833

gacgcgacgcttcccgccggtcgccgcctg	CRISPR spacer
gtggcaacgcttcccgccggtcgccggccg	Protospacer
*  **.******************** *.*

101. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833

gacgcgacgcttcccgccggtcgccgcctg	CRISPR spacer
gtggcaacgcttcccgccggtcgccggccg	Protospacer
*  **.******************** *.*

102. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833

gacgcgacgcttcccgccggtcgccgcctg	CRISPR spacer
gtggcaacgcttcccgccggtcgccggccg	Protospacer
*  **.******************** *.*

103. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833

gacgcgacgcttcccgccggtcgccgcctg	CRISPR spacer
gtggcaacgcttcccgccggtcgccggccg	Protospacer
*  **.******************** *.*

104. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833

gacgcgacgcttcccgccggtcgccgcctg	CRISPR spacer
gtggcaacgcttcccgccggtcgccggccg	Protospacer
*  **.******************** *.*

105. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833

gacgcgacgcttcccgccggtcgccgcctg	CRISPR spacer
gtggcaacgcttcccgccggtcgccggccg	Protospacer
*  **.******************** *.*

106. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.833

gacgcgacgcttcccgccggtcgccgcctg	CRISPR spacer
gtggcaacgcttcccgccggtcgccggccg	Protospacer
*  **.******************** *.*

107. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833

gacgcgacgcttcccgccggtcgccgcctg	CRISPR spacer
gtggcaacgcttcccgccggtcgccggccg	Protospacer
*  **.******************** *.*

108. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833

gacgcgacgcttcccgccggtcgccgcctg	CRISPR spacer
gtggcaacgcttcccgccggtcgccggccg	Protospacer
*  **.******************** *.*

109. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833

gacgcgacgcttcccgccggtcgccgcctg	CRISPR spacer
gtggcaacgcttcccgccggtcgccggccg	Protospacer
*  **.******************** *.*

110. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.833

gacgcgacgcttcccgccggtcgccgcctg	CRISPR spacer
gtggcaacgcttcccgccggtcgccggccg	Protospacer
*  **.******************** *.*

111. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.833

gacgcgacgcttcccgccggtcgccgcctg	CRISPR spacer
gtggcaacgcttcccgccggtcgccggccg	Protospacer
*  **.******************** *.*

112. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.833

gacgcgacgcttcccgccggtcgccgcctg	CRISPR spacer
gtggcaacgcttcccgccggtcgccggccg	Protospacer
*  **.******************** *.*

113. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.833

gacgcgacgcttcccgccggtcgccgcctg	CRISPR spacer
gtggcaacgcttcccgccggtcgccggccg	Protospacer
*  **.******************** *.*

114. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833

gacgcgacgcttcccgccggtcgccgcctg	CRISPR spacer
gtggcaacgcttcccgccggtcgccggccg	Protospacer
*  **.******************** *.*

115. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.833

gacgcgacgcttcccgccggtcgccgcctg	CRISPR spacer
gtggcaacgcttcccgccggtcgccggccg	Protospacer
*  **.******************** *.*

116. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.833

gacgcgacgcttcccgccggtcgccgcctg	CRISPR spacer
gtggcaacgcttcccgccggtcgccggccg	Protospacer
*  **.******************** *.*

117. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.833

gacgcgacgcttcccgccggtcgccgcctg	CRISPR spacer
gtggcaacgcttcccgccggtcgccggccg	Protospacer
*  **.******************** *.*

118. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.833

gacgcgacgcttcccgccggtcgccgcctg	CRISPR spacer
gtggcaacgcttcccgccggtcgccggccg	Protospacer
*  **.******************** *.*

119. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.833

gacgcgacgcttcccgccggtcgccgcctg	CRISPR spacer
gtggcaacgcttcccgccggtcgccggccg	Protospacer
*  **.******************** *.*

120. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.833

gacgcgacgcttcccgccggtcgccgcctg	CRISPR spacer
gtggcaacgcttcccgccggtcgccggccg	Protospacer
*  **.******************** *.*

121. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.833

gacgcgacgcttcccgccggtcgccgcctg	CRISPR spacer
gtggcaacgcttcccgccggtcgccggccg	Protospacer
*  **.******************** *.*

122. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.833

gacgcgacgcttcccgccggtcgccgcctg	CRISPR spacer
gtggcaacgcttcccgccggtcgccggccg	Protospacer
*  **.******************** *.*

123. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.833

gacgcgacgcttcccgccggtcgccgcctg	CRISPR spacer
gtggcaacgcttcccgccggtcgccggccg	Protospacer
*  **.******************** *.*

124. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.833

gacgcgacgcttcccgccggtcgccgcctg	CRISPR spacer
gtggcaacgcttcccgccggtcgccggccg	Protospacer
*  **.******************** *.*

125. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.833

gacgcgacgcttcccgccggtcgccgcctg	CRISPR spacer
gtggcaacgcttcccgccggtcgccggccg	Protospacer
*  **.******************** *.*

126. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.833

gacgcgacgcttcccgccggtcgccgcctg	CRISPR spacer
gtggcaacgcttcccgccggtcgccggccg	Protospacer
*  **.******************** *.*

127. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.833

gacgcgacgcttcccgccggtcgccgcctg	CRISPR spacer
gtggcaacgcttcccgccggtcgccggccg	Protospacer
*  **.******************** *.*

128. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833

gacgcgacgcttcccgccggtcgccgcctg	CRISPR spacer
gtggcaacgcttcccgccggtcgccggccg	Protospacer
*  **.******************** *.*

129. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833

gacgcgacgcttcccgccggtcgccgcctg	CRISPR spacer
gtggcaacgcttcccgccggtcgccggccg	Protospacer
*  **.******************** *.*

130. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833

gacgcgacgcttcccgccggtcgccgcctg	CRISPR spacer
gtggcaacgcttcccgccggtcgccggccg	Protospacer
*  **.******************** *.*

131. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833

gacgcgacgcttcccgccggtcgccgcctg	CRISPR spacer
gtggcaacgcttcccgccggtcgccggccg	Protospacer
*  **.******************** *.*

132. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.833

gacgcgacgcttcccgccggtcgccgcctg	CRISPR spacer
gtggcaacgcttcccgccggtcgccggccg	Protospacer
*  **.******************** *.*

133. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.833

gacgcgacgcttcccgccggtcgccgcctg	CRISPR spacer
gtggcaacgcttcccgccggtcgccggccg	Protospacer
*  **.******************** *.*

134. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.833

gacgcgacgcttcccgccggtcgccgcctg	CRISPR spacer
gtggcaacgcttcccgccggtcgccggccg	Protospacer
*  **.******************** *.*

135. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.833

gacgcgacgcttcccgccggtcgccgcctg	CRISPR spacer
gtggcaacgcttcccgccggtcgccggccg	Protospacer
*  **.******************** *.*

136. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 5, identity: 0.833

gacgcgacgcttcccgccggtcgccgcctg	CRISPR spacer
gtggcaacgcttcccgccggtcgccggccg	Protospacer
*  **.******************** *.*

137. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.833

gacgcgacgcttcccgccggtcgccgcctg	CRISPR spacer
gtggcaacgcttcccgccggtcgccggccg	Protospacer
*  **.******************** *.*

138. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.833

gacgcgacgcttcccgccggtcgccgcctg	CRISPR spacer
gtggcaacgcttcccgccggtcgccggccg	Protospacer
*  **.******************** *.*

139. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.833

gacgcgacgcttcccgccggtcgccgcctg	CRISPR spacer
gtggcaacgcttcccgccggtcgccggccg	Protospacer
*  **.******************** *.*

140. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.833

gacgcgacgcttcccgccggtcgccgcctg	CRISPR spacer
gtggcaacgcttcccgccggtcgccggccg	Protospacer
*  **.******************** *.*

141. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.833

gacgcgacgcttcccgccggtcgccgcctg	CRISPR spacer
gtggcaacgcttcccgccggtcgccggccg	Protospacer
*  **.******************** *.*

142. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.833

gacgcgacgcttcccgccggtcgccgcctg	CRISPR spacer
gtggcaacgcttcccgccggtcgccggccg	Protospacer
*  **.******************** *.*

143. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.833

gacgcgacgcttcccgccggtcgccgcctg	CRISPR spacer
gtggcaacgcttcccgccggtcgccggccg	Protospacer
*  **.******************** *.*

144. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to NZ_CP019938 (Ketogulonicigenium robustum strain SPU_B003 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833

gacgcgacgcttcccgccggtcgccgcctg	CRISPR spacer
gccccgctgctgcccgccggtcgccgcctg	Protospacer
* * ** .*** ******************

145. spacer 2.2|52199|32|NC_016110|CRISPRCasFinder,CRT matches to NZ_CP034352 (Streptomyces sp. W1SF4 plasmid p2, complete sequence) position: , mismatch: 5, identity: 0.844

ccggcgcgggtgccgcgcagagcggcggcccc	CRISPR spacer
ccggcgcggctgccgcgcagggcggcggggtc	Protospacer
********* **********.*******  .*

146. spacer 2.4|52321|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NC_009507 (Sphingomonas wittichii RW1 plasmid pSWIT01, complete sequence) position: , mismatch: 5, identity: 0.844

-ggtcggtcgctccagaccatcgagcgcaacgt	CRISPR spacer
cggacgg-cgctccagttcatcgagcgcaacgg	Protospacer
 ** *** ******** .************** 

147. spacer 3.7|134322|32|NC_016110|CRISPRCasFinder,CRT matches to MN657146 (Cryobacterium sp. strain ANT_H28B plasmid pA28BH2, complete sequence) position: , mismatch: 5, identity: 0.844

acgcctgcagcaggtacgtcgtccccgccttt-	CRISPR spacer
acgcctgcagcaggtacggcg-cccagccgtcg	Protospacer
****************** ** *** *** *. 

148. spacer 3.13|134322|33|NC_016110|PILER-CR matches to MN657146 (Cryobacterium sp. strain ANT_H28B plasmid pA28BH2, complete sequence) position: , mismatch: 5, identity: 0.848

acgcctgcagcaggtacgtcgtccccgcctttg-	CRISPR spacer
acgcctgcagcaggtacggcg-cccagccgtcgc	Protospacer
****************** ** *** *** *.* 

149. spacer 1.3|44816|31|NC_016110|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.806

tgcagatgagcgcgtcggcgcacgcggcatg	CRISPR spacer
ggatgatcagcgcgtcggcgcccgcggcacg	Protospacer
 *  *** ************* *******.*

150. spacer 1.3|44816|31|NC_016110|CRISPRCasFinder matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 6, identity: 0.806

tgcagatgagcgcgtcggcgcacgcggcatg	CRISPR spacer
tgcagacgagcgcgtcggcgcaatgggcgtt	Protospacer
******.***************   ***.* 

151. spacer 1.3|44816|31|NC_016110|CRISPRCasFinder matches to NC_023136 (Leisingera methylohalidivorans DSM 14336 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

tgcagat---gagcgcgtcggcgcacgcggcatg	CRISPR spacer
---agatcagcagcgcgccggcgcccgcggcatg	Protospacer
   ****    ******.****** *********

152. spacer 1.6|44999|31|NC_016110|CRISPRCasFinder matches to NZ_CP021356 (Rhodococcus sp. S2-17 plasmid pRB29, complete sequence) position: , mismatch: 6, identity: 0.806

cgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
ccgccgccggcgccctggtactcaccgccgc	Protospacer
*  .**.************ ********* *

153. spacer 1.6|44999|31|NC_016110|CRISPRCasFinder matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.806

cgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
cggccggacgcgcccgggtcctcaccgcccc	Protospacer
** .**   ****** ***************

154. spacer 1.6|44999|31|NC_016110|CRISPRCasFinder matches to NZ_CP021083 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI2, complete sequence) position: , mismatch: 6, identity: 0.806

cgttcg---tcggcgccctggtcctcaccgcccc	CRISPR spacer
---tcggactcggcgccctgctgctcaccgccct	Protospacer
   ***   *********** * **********.

155. spacer 1.9|44815|39|NC_016110|CRT matches to NZ_CP052758 (Cellulosimicrobium sp. BI34T plasmid pCPRO01, complete sequence) position: , mismatch: 6, identity: 0.846

atgcagatgagcgcgtcggcgcacgcggcatggg-gacca	CRISPR spacer
atgcagatgggcgcgtcggcgcgcgcggcaggagcgagc-	Protospacer
*********.************.******* *.* ** * 

156. spacer 1.14|44815|32|NC_016110|PILER-CR matches to NZ_LR134460 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 18, complete sequence) position: , mismatch: 6, identity: 0.812

atgcagatgagcgcgtcggcgcacgcggcatg	CRISPR spacer
cggacgatgagcgcgtcggcgcccgcggcgtg	Protospacer
  *  ***************** ******.**

157. spacer 1.14|44815|32|NC_016110|PILER-CR matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 6, identity: 0.812

atgcagatgagcgcgtcggcgcacgcggcatg	CRISPR spacer
atgcagacgagcgcgtcggcgcaatgggcgtt	Protospacer
*******.***************   ***.* 

158. spacer 1.17|44998|32|NC_016110|PILER-CR matches to NZ_CP021356 (Rhodococcus sp. S2-17 plasmid pRB29, complete sequence) position: , mismatch: 6, identity: 0.812

gcgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
gccgccgccggcgccctggtactcaccgccgc	Protospacer
**  .**.************ ********* *

159. spacer 1.17|44998|32|NC_016110|PILER-CR matches to NZ_CP021083 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI2, complete sequence) position: , mismatch: 6, identity: 0.812

gcgttcg---tcggcgccctggtcctcaccgcccc	CRISPR spacer
---ttcggactcggcgccctgctgctcaccgccct	Protospacer
   ****   *********** * **********.

160. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 6, identity: 0.8

gacgcgacgcttcccgccggtcgccgcctg	CRISPR spacer
ggcggtgcgcttcccgccggtcaacgcctg	Protospacer
*.**  .***************. ******

161. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.8

gacgcgacgcttcccgccggtcgccgcctg	CRISPR spacer
ggcggtgcgcttcccgccggtcaacgcctg	Protospacer
*.**  .***************. ******

162. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.8

gacgcgacgcttcccgccggtcgccgcctg	CRISPR spacer
ggcggtgcgcttcccgccggtcaacgcctg	Protospacer
*.**  .***************. ******

163. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to NZ_CP029358 (Azospirillum sp. CFH 70021 plasmid unnamed3) position: , mismatch: 6, identity: 0.8

gacgcgacgcttcccgccggtcgccgcctg	CRISPR spacer
ggcggtccgcatcccgccgctcgccgcctg	Protospacer
*.**   *** ******** **********

164. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 6, identity: 0.8

gacg-cgacgcttcccgccggtcgccgcctg	CRISPR spacer
-acgttgacggttcccgccggtcgccggttc	Protospacer
 *** .**** **************** .* 

165. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 6, identity: 0.8

gacgcgacgcttcccgccggtcgccgcctg	CRISPR spacer
ggcggtgcgcttcccgccggtcaacgcctg	Protospacer
*.**  .***************. ******

166. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 6, identity: 0.8

gacgcgacgcttcccgccggtcgccgcctg	CRISPR spacer
ggcggtgcgcttcccgccggtcaacgcctg	Protospacer
*.**  .***************. ******

167. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.8

gacgcgacgcttcccgccggtcgccgcctg	CRISPR spacer
ggcggtgcgcttcccgccggtcaacgcctg	Protospacer
*.**  .***************. ******

168. spacer 2.2|52199|32|NC_016110|CRISPRCasFinder,CRT matches to NZ_CP026950 (Mycetocola sp. 449 strain CGMCC 1.16372 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812

ccggcgcgggtgccgcgcagagcggcggcccc	CRISPR spacer
cagccgcgggtgccgcgcagcgcggcggaatc	Protospacer
* * **************** *******  .*

169. spacer 2.4|52321|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022747 (Sphingobium hydrophobicum strain C1 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.812

-ggtcggtcgctccagaccatcgagcgcaacgt	CRISPR spacer
cagacgg-cgctccagttcatcgagcgcaacgg	Protospacer
 .* *** ******** .************** 

170. spacer 2.4|52321|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022749 (Sphingobium hydrophobicum strain C1 plasmid p3, complete sequence) position: , mismatch: 6, identity: 0.812

-ggtcggtcgctccagaccatcgagcgcaacgt	CRISPR spacer
cagacgg-cgctccagttcatcgagcgcaacgg	Protospacer
 .* *** ******** .************** 

171. spacer 2.9|52632|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812

-cgctcgacgacgatgccgagttcggtgttgga	CRISPR spacer
gcggt-gccgacgatgccgagttcggagatggg	Protospacer
 ** * * ****************** * ***.

172. spacer 2.12|52815|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 6, identity: 0.812

gggagctgcgcaacgacttcgacg-atgcgctt	CRISPR spacer
gggagtcgcgcaacgacttcgacatctgcgcg-	Protospacer
*****..****************.  *****  

173. spacer 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to MH513984 (Mycobacterium phage Steamy, complete genome) position: , mismatch: 6, identity: 0.812

--accgccgcgaacatgaccagctgcccgatgat	CRISPR spacer
gtgctgc--cgaacatgaccagctccccgatggt	Protospacer
  .*.**  *************** *******.*

174. spacer 1.3|44816|31|NC_016110|CRISPRCasFinder matches to NZ_CP046258 (Gordonia sp. 135 plasmid pG135, complete sequence) position: , mismatch: 7, identity: 0.774

tgcagatgagcgcgtcggcgcacgcggcatg	CRISPR spacer
tggtgatgagcgcgtcggcgcgctcggtcag	Protospacer
**  *****************.* ***.  *

175. spacer 1.3|44816|31|NC_016110|CRISPRCasFinder matches to NZ_CP038257 (Microbacterium sediminis strain YLB-01 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774

tgcagatgagcgcgtcggcgcacgcggcatg	CRISPR spacer
agctcacgatcgcgtctgcgcacgcggcatc	Protospacer
 **  *.** ****** ************* 

176. spacer 1.4|44877|31|NC_016110|CRISPRCasFinder matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 7, identity: 0.774

gcaaggttcgcaaccgatcggagaagctcgg	CRISPR spacer
gcttggttcgcatccgatcgcagaagcgaag	Protospacer
**  ******** ******* ******  .*

177. spacer 1.5|44938|31|NC_016110|CRISPRCasFinder matches to NZ_CP024940 (Paraburkholderia hospita strain mHSR1 plasmid pmHSR1_P, complete sequence) position: , mismatch: 7, identity: 0.774

tcatcatcacgccgcgcacggcggcgttgtc	CRISPR spacer
tccgtatcacgccgcgcacagcggcattgcg	Protospacer
**  .**************.*****.***. 

178. spacer 1.5|44938|31|NC_016110|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.774

tcatcatcacgccgcgcacggcggcgttgtc	CRISPR spacer
cctccgtcacgccgcgaacggcggcgatggc	Protospacer
.* .*.********** ********* ** *

179. spacer 1.5|44938|31|NC_016110|CRISPRCasFinder matches to NZ_CP051294 (Mesorhizobium sp. NZP2077 plasmid pMSNZP2077A, complete sequence) position: , mismatch: 7, identity: 0.774

tcatcatcacgccgcgcacggcggcgttgtc-	CRISPR spacer
tcatcatctcgccgcgcac-gccgcgcaacct	Protospacer
******** ********** ** ***. ..* 

180. spacer 1.5|44938|31|NC_016110|CRISPRCasFinder matches to NZ_CP033363 (Mesorhizobium sp. NZP2077 plasmid pMSNZP2077NSa, complete sequence) position: , mismatch: 7, identity: 0.774

tcatcatcacgccgcgcacggcggcgttgtc-	CRISPR spacer
tcatcatctcgccgcgcac-gccgcgcaacct	Protospacer
******** ********** ** ***. ..* 

181. spacer 1.6|44999|31|NC_016110|CRISPRCasFinder matches to MH001458 (Mycobacterium phage Smeagol, complete genome) position: , mismatch: 7, identity: 0.774

cgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
ccgccgtaggcgccctggtccttaccgccga	Protospacer
*  .*** **************.******  

182. spacer 1.6|44999|31|NC_016110|CRISPRCasFinder matches to NZ_CP013588 (Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence) position: , mismatch: 7, identity: 0.774

cgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
atctcgtcggcgccctcgtcctcagcgacac	Protospacer
  .************* ******* ** * *

183. spacer 1.6|44999|31|NC_016110|CRISPRCasFinder matches to NZ_CP013560 (Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence) position: , mismatch: 7, identity: 0.774

cgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
atctcgtcggcgccctcgtcctcagcgacac	Protospacer
  .************* ******* ** * *

184. spacer 1.6|44999|31|NC_016110|CRISPRCasFinder matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 7, identity: 0.774

cgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
atctcgtcggcgccctcgtcctcagcgacac	Protospacer
  .************* ******* ** * *

185. spacer 1.6|44999|31|NC_016110|CRISPRCasFinder matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 7, identity: 0.774

cgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
atctcgtcggcgccctcgtcctcagcgacac	Protospacer
  .************* ******* ** * *

186. spacer 1.6|44999|31|NC_016110|CRISPRCasFinder matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 7, identity: 0.774

cgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
atctcgtcggcgccctcgtcctcagcgacac	Protospacer
  .************* ******* ** * *

187. spacer 1.6|44999|31|NC_016110|CRISPRCasFinder matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 7, identity: 0.774

cgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
atctcgtcggcgccctcgtcctcagcgacac	Protospacer
  .************* ******* ** * *

188. spacer 1.6|44999|31|NC_016110|CRISPRCasFinder matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 7, identity: 0.774

cgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
atctcgtcggcgccctcgtcctcagcgacac	Protospacer
  .************* ******* ** * *

189. spacer 1.6|44999|31|NC_016110|CRISPRCasFinder matches to NC_010998 (Rhizobium etli CIAT 652 plasmid pA, complete sequence) position: , mismatch: 7, identity: 0.774

cgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
atctcgtcggcgccctcgtcctcagcgacac	Protospacer
  .************* ******* ** * *

190. spacer 1.6|44999|31|NC_016110|CRISPRCasFinder matches to NC_048046 (Caulobacter phage CcrPW, complete genome) position: , mismatch: 7, identity: 0.774

cgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
tggtcgtcggcgccctggtcgtcagcgtact	Protospacer
.* ***************** *** **. *.

191. spacer 1.6|44999|31|NC_016110|CRISPRCasFinder matches to NZ_AP022622 (Mycobacteroides abscessus strain JCM 30620 plasmid pJCM30620_1) position: , mismatch: 7, identity: 0.774

cgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
cgtcgcacggcgcgctggccctcaccgccct	Protospacer
***.   ****** ****.***********.

192. spacer 1.6|44999|31|NC_016110|CRISPRCasFinder matches to NZ_AP022622 (Mycobacteroides abscessus strain JCM 30620 plasmid pJCM30620_1) position: , mismatch: 7, identity: 0.774

cgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
cgtcgcacggcgcgctggccctcaccgccct	Protospacer
***.   ****** ****.***********.

193. spacer 1.6|44999|31|NC_016110|CRISPRCasFinder matches to NZ_AP014706 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_2p, complete sequence) position: , mismatch: 7, identity: 0.774

cgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
aggtcgtcggctccctggtcctcgccacacg	Protospacer
 * ******** ***********.**.* * 

194. spacer 1.6|44999|31|NC_016110|CRISPRCasFinder matches to NZ_CP020371 (Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs417, complete sequence) position: , mismatch: 7, identity: 0.774

-cgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
gcgggc-tcgacgccctggtcttcaccgccgg	Protospacer
 **  * ***.**********.********  

195. spacer 1.6|44999|31|NC_016110|CRISPRCasFinder matches to NC_021279 (Mycobacteroides abscessus subsp. bolletii 50594 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.774

cgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
cgtcgcacggcgcgctggccctcaccgccct	Protospacer
***.   ****** ****.***********.

196. spacer 1.14|44815|32|NC_016110|PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.781

atgcagatgagcgcgtcggcgcacgcggcatg	CRISPR spacer
cggatgatcagcgcgtcggcgcccgcggcacg	Protospacer
  *  *** ************* *******.*

197. spacer 1.14|44815|32|NC_016110|PILER-CR matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781

atgcagatgagcgcgtcggcgcacgcggcatg	CRISPR spacer
atgcagaccagcgcgtcggcgcagtgggcgtt	Protospacer
*******. **************   ***.* 

198. spacer 1.14|44815|32|NC_016110|PILER-CR matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 7, identity: 0.781

atgcagatgagcgcgtcggcgcacgcggcatg	CRISPR spacer
atgcagaccagcgcgtcggcgcaatgggcgtt	Protospacer
*******. **************   ***.* 

199. spacer 1.14|44815|32|NC_016110|PILER-CR matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 7, identity: 0.781

atgcagatgagcgcgtcggcgcacgcggcatg	CRISPR spacer
atgcagaccagcgcgtcggcgcaatgggcgtt	Protospacer
*******. **************   ***.* 

200. spacer 1.14|44815|32|NC_016110|PILER-CR matches to NZ_CP024424 (Paracoccus yeei strain TT13 plasmid pTT13-2, complete sequence) position: , mismatch: 7, identity: 0.781

atgcagatgagcgcgtcggcgcacgcggcatg	CRISPR spacer
atgcagaccagcgcgtcggcgcaatgggcgtt	Protospacer
*******. **************   ***.* 

201. spacer 1.14|44815|32|NC_016110|PILER-CR matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 7, identity: 0.781

atgcagatgagcgcgtcggcgcacgcggcatg	CRISPR spacer
atgcagaccagcgcgtcggcgcagtgggcgtt	Protospacer
*******. **************   ***.* 

202. spacer 1.14|44815|32|NC_016110|PILER-CR matches to NZ_CP020440 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781

atgcagatgagcgcgtcggcgcacgcggcatg	CRISPR spacer
atgcagaccagcgcgtcggcgcaatgggcgtt	Protospacer
*******. **************   ***.* 

203. spacer 1.14|44815|32|NC_016110|PILER-CR matches to NZ_CP029833 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.781

atgcagatgagcgcgtcggcgcacgcggcatg	CRISPR spacer
atgcagaccagcgcgtcggcgcaatgggcgtt	Protospacer
*******. **************   ***.* 

204. spacer 1.14|44815|32|NC_016110|PILER-CR matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781

atgcagatgagcgcgtcggcgcacgcggcatg	CRISPR spacer
atgcagaccagcgcgtcggcgcagtgggcgtt	Protospacer
*******. **************   ***.* 

205. spacer 1.14|44815|32|NC_016110|PILER-CR matches to NZ_CP044082 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.781

atgcagatgagcgcgtcggcgcacgcggcatg	CRISPR spacer
atgcagaccagcgcgtcggcgcaatgggcgtt	Protospacer
*******. **************   ***.* 

206. spacer 1.14|44815|32|NC_016110|PILER-CR matches to NZ_CP031080 (Paracoccus yeei strain CCUG 32053 plasmid pYEE2, complete sequence) position: , mismatch: 7, identity: 0.781

atgcagatgagcgcgtcggcgcacgcggcatg	CRISPR spacer
atgcagaccagcgcgtcggcgcaatgggcgtt	Protospacer
*******. **************   ***.* 

207. spacer 1.14|44815|32|NC_016110|PILER-CR matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781

atgcagatgagcgcgtcggcgcacgcggcatg	CRISPR spacer
atgcagaccagcgcgtcggcgcaatgggcgtt	Protospacer
*******. **************   ***.* 

208. spacer 1.14|44815|32|NC_016110|PILER-CR matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 7, identity: 0.781

atgcagatgagcgcgtcggcgcacgcggcatg	CRISPR spacer
atgcagaccagcgcgtcggcgcagtgggcgtt	Protospacer
*******. **************   ***.* 

209. spacer 1.14|44815|32|NC_016110|PILER-CR matches to NZ_CP038257 (Microbacterium sediminis strain YLB-01 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

atgcagatgagcgcgtcggcgcacgcggcatg	CRISPR spacer
aagctcacgatcgcgtctgcgcacgcggcatc	Protospacer
* **  *.** ****** ************* 

210. spacer 1.16|44937|32|NC_016110|PILER-CR matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.781

gtcatcatcacgccgcgcacggcggcgttgtc	CRISPR spacer
gcctccgtcacgccgcgaacggcggcgatggc	Protospacer
*.* .*.********** ********* ** *

211. spacer 1.17|44998|32|NC_016110|PILER-CR matches to MH001458 (Mycobacterium phage Smeagol, complete genome) position: , mismatch: 7, identity: 0.781

gcgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
gccgccgtaggcgccctggtccttaccgccga	Protospacer
**  .*** **************.******  

212. spacer 1.17|44998|32|NC_016110|PILER-CR matches to NZ_CP013588 (Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence) position: , mismatch: 7, identity: 0.781

gcgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
gatctcgtcggcgccctcgtcctcagcgacac	Protospacer
*  .************* ******* ** * *

213. spacer 1.17|44998|32|NC_016110|PILER-CR matches to NZ_CP013560 (Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence) position: , mismatch: 7, identity: 0.781

gcgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
gatctcgtcggcgccctcgtcctcagcgacac	Protospacer
*  .************* ******* ** * *

214. spacer 1.17|44998|32|NC_016110|PILER-CR matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 7, identity: 0.781

gcgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
gatctcgtcggcgccctcgtcctcagcgacac	Protospacer
*  .************* ******* ** * *

215. spacer 1.17|44998|32|NC_016110|PILER-CR matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 7, identity: 0.781

gcgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
gatctcgtcggcgccctcgtcctcagcgacac	Protospacer
*  .************* ******* ** * *

216. spacer 1.17|44998|32|NC_016110|PILER-CR matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 7, identity: 0.781

gcgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
gatctcgtcggcgccctcgtcctcagcgacac	Protospacer
*  .************* ******* ** * *

217. spacer 1.17|44998|32|NC_016110|PILER-CR matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 7, identity: 0.781

gcgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
gatctcgtcggcgccctcgtcctcagcgacac	Protospacer
*  .************* ******* ** * *

218. spacer 1.17|44998|32|NC_016110|PILER-CR matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 7, identity: 0.781

gcgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
gatctcgtcggcgccctcgtcctcagcgacac	Protospacer
*  .************* ******* ** * *

219. spacer 1.17|44998|32|NC_016110|PILER-CR matches to NC_010998 (Rhizobium etli CIAT 652 plasmid pA, complete sequence) position: , mismatch: 7, identity: 0.781

gcgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
gatctcgtcggcgccctcgtcctcagcgacac	Protospacer
*  .************* ******* ** * *

220. spacer 1.17|44998|32|NC_016110|PILER-CR matches to NZ_CP020371 (Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs417, complete sequence) position: , mismatch: 7, identity: 0.781

-gcgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
ggcgggc-tcgacgccctggtcttcaccgccgg	Protospacer
 ***  * ***.**********.********  

221. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 7, identity: 0.767

gacgcgacgcttcccgccggtcgccgcctg	CRISPR spacer
aaatcggcgcttcccgccggtccccgccca	Protospacer
.*  **.*************** *****..

222. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.767

gacgcgacgcttcccgccggtcgccgcctg	CRISPR spacer
aaatcggcgcttcccgccggtccccgccca	Protospacer
.*  **.*************** *****..

223. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 7, identity: 0.767

gacgcgacgcttcccgccggtcgccgcctg	CRISPR spacer
gccctcacgcgtcccgccggtcgccgccgc	Protospacer
* * . **** *****************  

224. spacer 2.1|52140|30|NC_016110|CRISPRCasFinder matches to CP043032 (Dermacoccus abyssi strain HZAU 226 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

gacgcgacgcttcccgccggtcgccgcctg	CRISPR spacer
gacgcgaccgttcccgccggtcgtagtcgc	Protospacer
********  *************. *.*  

225. spacer 2.4|52321|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to MT451980 (Streptomyces phage Ignacio, complete genome) position: , mismatch: 7, identity: 0.781

ggtcggtcgctccagaccatcgagcgcaacgt	CRISPR spacer
gggcgcagcctccagacgatcgaacgcaacgt	Protospacer
** **    ******** *****.********

226. spacer 2.7|52510|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017564 (Paraburkholderia sprentiae WSM5005 plasmid pl3WSM5005, complete sequence) position: , mismatch: 7, identity: 0.781

acccggaacgtctcatcgaacgatgctgcgat	CRISPR spacer
actcggaacgtctcattgaacgaagacgatat	Protospacer
**.*************.****** * .*  **

227. spacer 2.8|52571|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023977 (Streptomyces alboflavus strain MDJK44 plasmid pMDJK44.2, complete sequence) position: , mismatch: 7, identity: 0.781

tcacatcc-ccggcaagcggcccaagatctact	CRISPR spacer
-cacgttcaccggcaagcggcccaagctccgcg	Protospacer
 ***.*.* ***************** **..* 

228. spacer 2.9|52632|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 7, identity: 0.781

-cgctcgacgacgatgccgagttcggtgttgga	CRISPR spacer
acgc-cgacgacgatgccgatatcggtggccgt	Protospacer
 *** ***************  ****** . * 

229. spacer 2.9|52632|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020539 (Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence) position: , mismatch: 7, identity: 0.781

cgctcgacgacgatgccgagttc--ggtgttgga	CRISPR spacer
tgctggccgacgatgccgagttcgaggcgctg--	Protospacer
.*** * ****************  **.*.**  

230. spacer 2.9|52632|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 7, identity: 0.781

-cgctcgacgacgatgccgagttcggtgttgga	CRISPR spacer
acgc-cgacgacgatgccgatatcggtggccgt	Protospacer
 *** ***************  ****** . * 

231. spacer 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT matches to NZ_LR134467 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 25, complete sequence) position: , mismatch: 7, identity: 0.781

gtcgcggtgtcggtggcggtggacttccgggt	CRISPR spacer
gtcgcggtgtcggtggcggtgcccttctctcc	Protospacer
*********************  ****.   .

232. spacer 3.9|134444|32|NC_016110|CRISPRCasFinder,CRT matches to NZ_CP021375 (Rhizobium sp. ACO-34A plasmid pRACO34Aa, complete sequence) position: , mismatch: 7, identity: 0.781

accgccccgccggtccccggacag-ctcggcat	CRISPR spacer
ggcgccccgccgggcaccggacagcctctgcg-	Protospacer
. *********** * ******** *** **. 

233. spacer 3.9|134444|32|NC_016110|CRISPRCasFinder,CRT matches to NZ_CP035710 (Sphaerotilus natans subsp. sulfidivorans strain D-507 plasmid pSna507_unt10, complete sequence) position: , mismatch: 7, identity: 0.781

accgccc--cgccggtccccggacagctcggcat	CRISPR spacer
--cgctcagtgccggtcgccggacggctcggcac	Protospacer
  ***.*  .******* ******.********.

234. spacer 4.3|144425|32|NC_016110|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029833 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.781

tgccgaccgacgcctggtcggccggttcgctc	CRISPR spacer
cgtccaccgacgcccggtcggccggatcgcgt	Protospacer
.*.* *********.********** **** .

235. spacer 4.4|144486|32|NC_016110|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 7, identity: 0.781

gtcacagtgacgccaccaaggggcccagaaga	CRISPR spacer
gcccgcctgacgccaccaaacggcccagaaga	Protospacer
*.*    ************. ***********

236. spacer 4.4|144486|32|NC_016110|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 7, identity: 0.781

gtcacagtgacgccaccaaggggcccagaaga	CRISPR spacer
gcccgcctgacgccaccaaacggcccagaaga	Protospacer
*.*    ************. ***********

237. spacer 4.8|144730|32|NC_016110|CRISPRCasFinder,CRT matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 7, identity: 0.781

ccgagcccgtcccggccgatccgtaggaatgc	CRISPR spacer
cggccccactccccgccgatccgtaggaaggc	Protospacer
* *  **  **** *************** **

238. spacer 4.10|144852|32|NC_016110|CRISPRCasFinder,CRT matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.781

tccgaccacgccgaaacgcaggtccccggcgg	CRISPR spacer
caggaccacgccgatacgcaggtcaccggcac	Protospacer
.  *********** ********* *****. 

239. spacer 4.12|144974|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.781

tccgaccacgccgaaacgcaggtccccggcgg	CRISPR spacer
caggaccacgccgatacgcaggtcaccggcac	Protospacer
.  *********** ********* *****. 

240. spacer 4.13|145035|33|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 7, identity: 0.788

gccaccaagtcgtccgacgggcagacccgctcg	CRISPR spacer
gctggcaaatcgtccgacgggcagagccgcgag	Protospacer
**.. ***.**************** ****  *

241. spacer 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028970 (Aminobacter sp. MSH1 plasmid pUSP2, complete sequence) position: , mismatch: 7, identity: 0.781

accgccgcgaacatgaccagctgcccgatgat	CRISPR spacer
agcaccgcgaacatgatcagcagcccgaaggg	Protospacer
* *.************.**** ****** *. 

242. spacer 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to MK494113 (Mycobacterium phage Refuge, complete genome) position: , mismatch: 7, identity: 0.781

--accgccgcgaacatgaccagctgcccgatgat	CRISPR spacer
gtgctgc--cgaacatgaccagctcaccgatggt	Protospacer
  .*.**  ***************  ******.*

243. spacer 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NC_028662 (Mycobacterium phage Phlei, complete genome) position: , mismatch: 7, identity: 0.781

--accgccgcgaacatgaccagctgcccgatgat	CRISPR spacer
gtgctgc--cgaacatgaccaactccccgatggt	Protospacer
  .*.**  ************.** *******.*

244. spacer 1.1|44694|31|NC_016110|CRISPRCasFinder matches to NZ_LR134450 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 8, complete sequence) position: , mismatch: 8, identity: 0.742

ctgcagaaccgggtcatcacggtgacgacca	CRISPR spacer
taccagaaccgcgtcatcacgctgacgtcgt	Protospacer
.  ******** ********* ***** *  

245. spacer 1.2|44755|31|NC_016110|CRISPRCasFinder matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.742

accctgggcgccctgtagggcccgctgacgc	CRISPR spacer
gctctgggcgccctgtcgggcccgcatcatc	Protospacer
.*.************* ********     *

246. spacer 1.3|44816|31|NC_016110|CRISPRCasFinder matches to NZ_CP020399 (Burkholderia multivorans strain FDAARGOS_246 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

tgcagatgagcgcgtcggcgcacgcggcatg	CRISPR spacer
gatgggcgagcgcgtcggcgtacgcggcatc	Protospacer
 ...*..*************.********* 

247. spacer 1.3|44816|31|NC_016110|CRISPRCasFinder matches to NZ_LR699556 (Paraburkholderia sp. Msb3 isolate PDMSB31 plasmid pII) position: , mismatch: 8, identity: 0.742

tgcagatgagcgcgtcggcgcacgcggcatg	CRISPR spacer
aacgctcgagcgcgtcggcgctcgccgcatg	Protospacer
 .*.  .************** *** *****

248. spacer 1.4|44877|31|NC_016110|CRISPRCasFinder matches to NZ_CP012664 (Defluviimonas alba strain cai42 plasmid pcai42C, complete sequence) position: , mismatch: 8, identity: 0.742

gcaaggttcgcaaccgatcggagaagctcgg	CRISPR spacer
gagaagttcgcaagcgttcggagaagctgtc	Protospacer
* .*.******** ** ***********   

249. spacer 1.5|44938|31|NC_016110|CRISPRCasFinder matches to NZ_CP035710 (Sphaerotilus natans subsp. sulfidivorans strain D-507 plasmid pSna507_unt10, complete sequence) position: , mismatch: 8, identity: 0.742

tcatcatcacgccgcgcacggcggcgttgtc	CRISPR spacer
tgaagcgcacgccgcgcacgccggcgtcgtg	Protospacer
* *    ************* ******.** 

250. spacer 1.5|44938|31|NC_016110|CRISPRCasFinder matches to NZ_CP021115 (Rhodobacteraceae bacterium strain G7 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

tcatcatcacgccgcgcacggcggcgttgtc	CRISPR spacer
tcatcaccaccccgcgcacggcgaccgagcg	Protospacer
******.*** ************.*   *. 

251. spacer 1.6|44999|31|NC_016110|CRISPRCasFinder matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.742

cgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
acaacgtcggcgacctggtcgtcaccgccgg	Protospacer
    ******** ******* ********  

252. spacer 1.6|44999|31|NC_016110|CRISPRCasFinder matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.742

cgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
tcaccgtcggcgccccggtcctgaccgcctt	Protospacer
.  .***********.****** ******..

253. spacer 1.6|44999|31|NC_016110|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.742

cgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
tcaccgtcggcgccccggtcctgaccgcgct	Protospacer
.  .***********.****** ***** *.

254. spacer 1.6|44999|31|NC_016110|CRISPRCasFinder matches to NZ_CP029362 (Streptomyces globisporus strain TFH56 plasmid pTFSG1, complete sequence) position: , mismatch: 8, identity: 0.742

cgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
ccgccgtcggcggcctggtcctcgccgcgtt	Protospacer
*  .******** **********.**** ..

255. spacer 1.6|44999|31|NC_016110|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 8, identity: 0.742

cgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
tcaccgtcggcgccccggtcctgaccgcgct	Protospacer
.  .***********.****** ***** *.

256. spacer 1.6|44999|31|NC_016110|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 8, identity: 0.742

cgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
tcaccgtcggcgccccggtcctgaccgcgct	Protospacer
.  .***********.****** ***** *.

257. spacer 1.6|44999|31|NC_016110|CRISPRCasFinder matches to NZ_CP013739 (Streptomyces globisporus C-1027 plasmid SGLP1, complete sequence) position: , mismatch: 8, identity: 0.742

cgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
ccgccgtcggcggcctggtcctcgccgcgtt	Protospacer
*  .******** **********.**** ..

258. spacer 1.6|44999|31|NC_016110|CRISPRCasFinder matches to NZ_CP017148 (Bosea vaviloviae strain Vaf18 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

cgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
ccttcgtcggcgccctgatcctgacgctcgt	Protospacer
* ***************.**** **  .* .

259. spacer 1.6|44999|31|NC_016110|CRISPRCasFinder matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 8, identity: 0.742

cgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
ggatcgtcggcgccttcgtcctcacctcgtt	Protospacer
 * ***********.* ********* * ..

260. spacer 1.6|44999|31|NC_016110|CRISPRCasFinder matches to NC_028745 (Pseudomonas phage DL60, complete genome) position: , mismatch: 8, identity: 0.742

cgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
gaaccgtcggcgccctgatcatcaccgtcgc	Protospacer
 . .*************.** ******.* *

261. spacer 1.13|44754|32|NC_016110|PILER-CR matches to NC_008010 (Deinococcus geothermalis DSM 11300 plasmid pDGEO01, complete sequence) position: , mismatch: 8, identity: 0.75

gaccctgggcgccctgtagggcccgctgacgc-----	CRISPR spacer
gaccctgggcgacctggagggcc-----gcgcgttct	Protospacer
*********** **** ******     .***     

262. spacer 1.14|44815|32|NC_016110|PILER-CR matches to NZ_CP046258 (Gordonia sp. 135 plasmid pG135, complete sequence) position: , mismatch: 8, identity: 0.75

atgcagatgagcgcgtcggcgcacgcggcatg	CRISPR spacer
gtggtgatgagcgcgtcggcgcgctcggtcag	Protospacer
.**  *****************.* ***.  *

263. spacer 1.14|44815|32|NC_016110|PILER-CR matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75

atgcagatgagcgcgtcggcgcacgcggcatg	CRISPR spacer
atgcagaccagcgcgtcggcgcagtgcgcgtt	Protospacer
*******. **************    **.* 

264. spacer 1.15|44876|32|NC_016110|PILER-CR matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 8, identity: 0.75

agcaaggttcgcaaccgatcggagaagctcgg	CRISPR spacer
tgcttggttcgcatccgatcgcagaagcgaag	Protospacer
 **  ******** ******* ******  .*

265. spacer 1.16|44937|32|NC_016110|PILER-CR matches to NZ_CP024940 (Paraburkholderia hospita strain mHSR1 plasmid pmHSR1_P, complete sequence) position: , mismatch: 8, identity: 0.75

gtcatcatcacgccgcgcacggcggcgttgtc	CRISPR spacer
atccgtatcacgccgcgcacagcggcattgcg	Protospacer
.**  .**************.*****.***. 

266. spacer 1.16|44937|32|NC_016110|PILER-CR matches to NZ_CP021115 (Rhodobacteraceae bacterium strain G7 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

gtcatcatcacgccgcgcacggcggcgttgtc	CRISPR spacer
gtcatcaccaccccgcgcacggcgaccgagcg	Protospacer
*******.*** ************.*   *. 

267. spacer 1.16|44937|32|NC_016110|PILER-CR matches to NZ_CP051294 (Mesorhizobium sp. NZP2077 plasmid pMSNZP2077A, complete sequence) position: , mismatch: 8, identity: 0.75

gtcatcatcacgccgcgcacggcggcgttgtc-	CRISPR spacer
atcatcatctcgccgcgcac-gccgcgcaacct	Protospacer
.******** ********** ** ***. ..* 

268. spacer 1.16|44937|32|NC_016110|PILER-CR matches to NZ_CP033363 (Mesorhizobium sp. NZP2077 plasmid pMSNZP2077NSa, complete sequence) position: , mismatch: 8, identity: 0.75

gtcatcatcacgccgcgcacggcggcgttgtc-	CRISPR spacer
atcatcatctcgccgcgcac-gccgcgcaacct	Protospacer
.******** ********** ** ***. ..* 

269. spacer 1.17|44998|32|NC_016110|PILER-CR matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75

gcgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
gacaacgtcggcgacctggtcgtcaccgccgg	Protospacer
*    ******** ******* ********  

270. spacer 1.17|44998|32|NC_016110|PILER-CR matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75

gcgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
gtcaccgtcggcgccccggtcctgaccgcctt	Protospacer
*.  .***********.****** ******..

271. spacer 1.17|44998|32|NC_016110|PILER-CR matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75

gcgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
gtcaccgtcggcgccccggtcctgaccgcgct	Protospacer
*.  .***********.****** ***** *.

272. spacer 1.17|44998|32|NC_016110|PILER-CR matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 8, identity: 0.75

gcgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
gtcaccgtcggcgccccggtcctgaccgcgct	Protospacer
*.  .***********.****** ***** *.

273. spacer 1.17|44998|32|NC_016110|PILER-CR matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 8, identity: 0.75

gcgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
gtcaccgtcggcgccccggtcctgaccgcgct	Protospacer
*.  .***********.****** ***** *.

274. spacer 1.17|44998|32|NC_016110|PILER-CR matches to NC_048046 (Caulobacter phage CcrPW, complete genome) position: , mismatch: 8, identity: 0.75

gcgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
ctggtcgtcggcgccctggtcgtcagcgtact	Protospacer
 .* ***************** *** **. *.

275. spacer 1.17|44998|32|NC_016110|PILER-CR matches to NZ_AP022622 (Mycobacteroides abscessus strain JCM 30620 plasmid pJCM30620_1) position: , mismatch: 8, identity: 0.75

gcgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
ccgtcgcacggcgcgctggccctcaccgccct	Protospacer
 ***.   ****** ****.***********.

276. spacer 1.17|44998|32|NC_016110|PILER-CR matches to NZ_AP022622 (Mycobacteroides abscessus strain JCM 30620 plasmid pJCM30620_1) position: , mismatch: 8, identity: 0.75

gcgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
ccgtcgcacggcgcgctggccctcaccgccct	Protospacer
 ***.   ****** ****.***********.

277. spacer 1.17|44998|32|NC_016110|PILER-CR matches to NZ_AP014706 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_2p, complete sequence) position: , mismatch: 8, identity: 0.75

gcgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
aaggtcgtcggctccctggtcctcgccacacg	Protospacer
. * ******** ***********.**.* * 

278. spacer 1.17|44998|32|NC_016110|PILER-CR matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 8, identity: 0.75

gcgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
gggatcgtcggcgccttcgtcctcacctcgtt	Protospacer
* * ***********.* ********* * ..

279. spacer 1.17|44998|32|NC_016110|PILER-CR matches to NC_021279 (Mycobacteroides abscessus subsp. bolletii 50594 plasmid 2, complete sequence) position: , mismatch: 8, identity: 0.75

gcgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
ccgtcgcacggcgcgctggccctcaccgccct	Protospacer
 ***.   ****** ****.***********.

280. spacer 1.17|44998|32|NC_016110|PILER-CR matches to NC_028745 (Pseudomonas phage DL60, complete genome) position: , mismatch: 8, identity: 0.75

gcgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
ggaaccgtcggcgccctgatcatcaccgtcgc	Protospacer
* . .*************.** ******.* *

281. spacer 2.2|52199|32|NC_016110|CRISPRCasFinder,CRT matches to NZ_CP015739 (Shinella sp. HZN7 plasmid pShin-03, complete sequence) position: , mismatch: 8, identity: 0.75

ccggcgcgggtgccgcgcagagcggcggcccc	CRISPR spacer
tcggcgcggatgccgcgcagatcgaggccgcg	Protospacer
.********.*********** **. * * * 

282. spacer 2.2|52199|32|NC_016110|CRISPRCasFinder,CRT matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 8, identity: 0.75

ccggcgcgggtgccgcgcagagcggcggcccc	CRISPR spacer
agcaggcgggtgccgagcagggcggcggcccg	Protospacer
   . ********** ****.********** 

283. spacer 2.2|52199|32|NC_016110|CRISPRCasFinder,CRT matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 8, identity: 0.75

ccggcgcgggtgccgcgcagagcggcggcccc	CRISPR spacer
gcggcgccggtgccgcgcagcgcgggtggggc	Protospacer
 ****** ************ ****  *   *

284. spacer 2.2|52199|32|NC_016110|CRISPRCasFinder,CRT matches to NZ_CP054618 (Azospirillum oryzae strain KACC 14407 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.75

ccggcgcgggtgccgcgcagagcggcggcccc	CRISPR spacer
agcaggcgggtgccgagcagagccgcggcccg	Protospacer
   . ********** ******* ******* 

285. spacer 2.2|52199|32|NC_016110|CRISPRCasFinder,CRT matches to NZ_CP035001 (Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence) position: , mismatch: 8, identity: 0.75

ccggcgcgggtgccgcgcagagcggcggcccc	CRISPR spacer
gcctcatgggtccggcgcagagcggcggcccg	Protospacer
 *  *..**** * ***************** 

286. spacer 2.2|52199|32|NC_016110|CRISPRCasFinder,CRT matches to NZ_CP034186 (Deinococcus sp. S14-83 strain S14-83T plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

ccggcgcgggtgccgcgcagagcggcggcccc	CRISPR spacer
aggttgcgggtgccgcgccgggcggcggcgcg	Protospacer
  * .************* *.******** * 

287. spacer 2.2|52199|32|NC_016110|CRISPRCasFinder,CRT matches to NZ_CP006370 (Aureimonas sp. AU20 plasmid pAU20c, complete sequence) position: , mismatch: 8, identity: 0.75

ccggcgcgggtgccgcgcagagcggcggcccc	CRISPR spacer
gcggcgcgggcgccgcgcagaccgtcttcttc	Protospacer
 *********.********** ** *  *..*

288. spacer 2.9|52632|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NC_049850 (Burkholderia phage BcepSaruman, complete genome) position: , mismatch: 8, identity: 0.75

cgctcgacgacgatgccgagttcggtgttgga	CRISPR spacer
acctcgacgatgatgccgacttcggtgacgag	Protospacer
  ********.******** ******* .*..

289. spacer 2.9|52632|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 8, identity: 0.75

cgctcgacgacgatgccgagttcggtgttgga	CRISPR spacer
cgcccgatgacgatgccgagttcgacctccca	Protospacer
***.***.****************.. *.  *

290. spacer 2.9|52632|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 8, identity: 0.75

cgctcgacgacgatgccgagttcggtgttgga	CRISPR spacer
cgcccgatgacgatgccgagttcgacctccca	Protospacer
***.***.****************.. *.  *

291. spacer 2.9|52632|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.75

cgctcgacgacgatgccgagttcggtgttgga---	CRISPR spacer
cggtcgacgacggtgccgagttc---ctcgggcac	Protospacer
** *********.**********    *.**.   

292. spacer 2.9|52632|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 8, identity: 0.75

cgctcgacgacgatgccgagttcggtgttgga	CRISPR spacer
agcgcgccgacgatgccgagttcggagaagcg	Protospacer
 ** ** ****************** *  * .

293. spacer 2.9|52632|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP018235 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed7, complete sequence) position: , mismatch: 8, identity: 0.75

cgctcgacgacgatgccgagttcg---gtgttgga	CRISPR spacer
agctcgacgacaatgccgagctcgcccgcttt---	Protospacer
 **********.********.***   *. **   

294. spacer 2.9|52632|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016290 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75

cgctcgacgacgatgccgagttcg---gtgttgga	CRISPR spacer
agctcgacgacaatgccgagctcgcccgcttt---	Protospacer
 **********.********.***   *. **   

295. spacer 2.9|52632|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_HG938356 (Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence) position: , mismatch: 8, identity: 0.75

cgctcgacgacgatgccgagttcggtgttgga	CRISPR spacer
tcctcgacggcgatgccgaggtcggcgaggaa	Protospacer
. *******.********** ****.*  *.*

296. spacer 2.9|52632|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021813 (Sinorhizobium meliloti strain M270 plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.75

cgctcgacgacgatgccgagttcggtgttgga	CRISPR spacer
atttcatcggcgatgccgagttcggtgatgaa	Protospacer
  .**. **.***************** **.*

297. spacer 2.12|52815|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75

gggagctgcgcaacgacttcgacgatgcgctt	CRISPR spacer
tcgcgtcgcgcaacgacttccgcgatgcgctc	Protospacer
  * *..************* .*********.

298. spacer 2.12|52815|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016289 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

gggagctgcgcaacgacttcgacgatgcgctt	CRISPR spacer
acggcctgcgcaacgaattcgccgatgcggtg	Protospacer
. *. *********** **** ******* * 

299. spacer 2.12|52815|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 8, identity: 0.75

gggagctgcgcaacgacttcgacgatgcgctt	CRISPR spacer
tcgcgtcgcgcaacgacttccgcgatgcgctc	Protospacer
  * *..************* .*********.

300. spacer 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT matches to NZ_AP022602 (Mycobacterium gallinarum strain JCM 6399 plasmid pJCM6399) position: , mismatch: 8, identity: 0.75

gtcgcggtgtcggtggcggtggacttccgggt	CRISPR spacer
atggcggtgtcggtggcggtggcctcccacag	Protospacer
.* ******************* **.**. . 

301. spacer 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT matches to NZ_AP022602 (Mycobacterium gallinarum strain JCM 6399 plasmid pJCM6399) position: , mismatch: 8, identity: 0.75

gtcgcggtgtcggtggcggtggacttccgggt	CRISPR spacer
atggcggtgtcggtggcggtggcctcccacag	Protospacer
.* ******************* **.**. . 

302. spacer 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT matches to CP054917 (Streptomyces sp. NA02950 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

---gtcgcggtgtcggtggcggtggacttccgggt	CRISPR spacer
tagatcgtgg---cggtggcggtgtacttccggcc	Protospacer
   .***.**   *********** ******** .

303. spacer 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT matches to NZ_CP027239 (Dietzia sp. oral taxon 368 strain W5195 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

gtcgcggtgtcggtggcggtggacttccgggt	CRISPR spacer
gcgggggtctcggtggcggtggagttcctgca	Protospacer
*. * *** ************** **** *  

304. spacer 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT matches to NZ_CP033739 (Enterococcus sp. FDAARGOS_553 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

--gtcgcggtgtcggtggcggtggacttccgggt	CRISPR spacer
cgattgc--tgccggtggcggtggaattccggta	Protospacer
  .*.**  **.************* ******  

305. spacer 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT matches to KJ019064 (Synechococcus phage ACG-2014c isolate Syn7803C98, complete genome) position: , mismatch: 8, identity: 0.75

gtcgcggtgtcggtggcggtggacttccgggt	CRISPR spacer
gtggcggtggcggtggcggtggaaaaggtggt	Protospacer
** ****** *************      ***

306. spacer 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT matches to MH479913 (Gordonia phage Fryberger, complete genome) position: , mismatch: 8, identity: 0.75

gtcgcggtgtcggtggcggtggacttccgggt	CRISPR spacer
gtggcggtggcggtggcggtggatcacgaagt	Protospacer
** ****** *************.. * ..**

307. spacer 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT matches to MG945660 (UNVERIFIED: Microviridae sp. isolate 21385-1502, partial genome) position: , mismatch: 8, identity: 0.75

gtcgcggtgtcggtggcggtggacttccgggt	CRISPR spacer
gtagcggtggcggtggcggtggaagtgcagca	Protospacer
** ****** *************  * *.*  

308. spacer 3.9|134444|32|NC_016110|CRISPRCasFinder,CRT matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

accgccccgccggtccccggac---agctcggcat	CRISPR spacer
gccgccccgccggcccccgggcaggagtccgg---	Protospacer
.************.******.*   **..***   

309. spacer 3.9|134444|32|NC_016110|CRISPRCasFinder,CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 8, identity: 0.75

accgccccgccggtccccggacagctcggcat	CRISPR spacer
ggcgccccggcggtccccggccagcgcatcaa	Protospacer
. ******* ********** **** *. ** 

310. spacer 3.9|134444|32|NC_016110|CRISPRCasFinder,CRT matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 8, identity: 0.75

accgccccgccggtccccggacagctcggcat	CRISPR spacer
ggcgccccggcggtccccggccagcgcatcaa	Protospacer
. ******* ********** **** *. ** 

311. spacer 4.2|144364|32|NC_016110|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049033 (Fluviibacterium aquatile strain SC52 plasmid pSC52_5, complete sequence) position: , mismatch: 8, identity: 0.75

tgcggcg-cgtcatcctccgggagcgcgccgcc	CRISPR spacer
-ccatcatcctcatcctccggcagggcgccgcc	Protospacer
  *. *. * *********** ** ********

312. spacer 4.3|144425|32|NC_016110|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009294 (Novosphingobium pentaromativorans US6-1 plasmid pLA1, complete sequence) position: , mismatch: 8, identity: 0.75

tgccgaccgacgcctggtcggccggttcgctc	CRISPR spacer
agcgtcccgacgcctgatccgccggttcggcc	Protospacer
 **   **********.** ********* .*

313. spacer 4.3|144425|32|NC_016110|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP011771 (Croceicoccus naphthovorans strain PQ-2 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75

tgccgaccgacgcctggtcggccggttcgctc	CRISPR spacer
agcgtcccgacgcctgatccgccggttcggcc	Protospacer
 **   **********.** ********* .*

314. spacer 4.5|144547|32|NC_016110|CRISPRCasFinder,CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75

gcggcacgtggtcacaggcctcgtcccaagcg	CRISPR spacer
cgcgcacgcggtcaccggcctcgtccacggcg	Protospacer
   *****.****** **********  .***

315. spacer 4.5|144547|32|NC_016110|CRISPRCasFinder,CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 8, identity: 0.75

gcggcacgtggtcacaggcctcgtcccaagcg	CRISPR spacer
cgcgcacgcggtcaccggcctcgtccacggcg	Protospacer
   *****.****** **********  .***

316. spacer 4.7|144669|32|NC_016110|CRISPRCasFinder,CRT matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75

cacctgcggggctcgctggttttccggaccgg	CRISPR spacer
cggctgcgggcatcgctggttttccgtatgtg	Protospacer
*. *******  ************** *.  *

317. spacer 4.10|144852|32|NC_016110|CRISPRCasFinder,CRT matches to MH153804 (Rhodococcus phage Jace, complete genome) position: , mismatch: 8, identity: 0.75

tccgaccacgccgaaacgcaggtccccggcgg	CRISPR spacer
cccgaccacgccgaactgcaggtccagacagg	Protospacer
.************** .********  .  **

318. spacer 4.12|144974|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to MH153804 (Rhodococcus phage Jace, complete genome) position: , mismatch: 8, identity: 0.75

tccgaccacgccgaaacgcaggtccccggcgg	CRISPR spacer
cccgaccacgccgaactgcaggtccagacagg	Protospacer
.************** .********  .  **

319. spacer 4.14|145097|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020040 (Streptomyces sp. 3211 isolate 3 plasmid p3211-1, complete sequence) position: , mismatch: 8, identity: 0.75

agcttggcgtaggtgccttcgccgggtccgac	CRISPR spacer
tgcttggcgttggcgccttcgccggcccacag	Protospacer
 ********* **.*********** .*  * 

320. spacer 4.14|145097|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020040 (Streptomyces sp. 3211 isolate 3 plasmid p3211-1, complete sequence) position: , mismatch: 8, identity: 0.75

agcttggcgtaggtgccttcgccgggtccgac	CRISPR spacer
tgcttggcgttggcgccttcgccggcccacag	Protospacer
 ********* **.*********** .*  * 

321. spacer 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to MH316566 (Gordonia phage Nedarya, complete genome) position: , mismatch: 8, identity: 0.75

accgccgcgaacatgaccagctgcccgatgat	CRISPR spacer
gtcctcccgaacatgaccaactccccgatggt	Protospacer
..* .* ************.** *******.*

322. spacer 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to MF140403 (Mycobacterium phage Changeling, complete genome) position: , mismatch: 8, identity: 0.75

accgccgcgaacatgaccagctgcccgatgat	CRISPR spacer
gccctgccgaacatgaccaactccccgatggt	Protospacer
.** .  ************.** *******.*

323. spacer 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to MK524530 (Mycobacterium phage Pharaoh, complete genome) position: , mismatch: 8, identity: 0.75

accgccgcgaacatgaccagctgcccgatgat	CRISPR spacer
gtcctcccgaacatgaccaactccccgatggt	Protospacer
..* .* ************.** *******.*

324. spacer 1.6|44999|31|NC_016110|CRISPRCasFinder matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 9, identity: 0.71

cgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
tcacggtcggtgccccggtcctcaccgccat	Protospacer
.  . *****.****.************* .

325. spacer 1.6|44999|31|NC_016110|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 9, identity: 0.71

cgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
atggtggcggcgccctgttcctgaccgccca	Protospacer
    .* ********** **** ******* 

326. spacer 1.6|44999|31|NC_016110|CRISPRCasFinder matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.71

cgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
tcaccgtcggcgccccggtcctgaccgcgtt	Protospacer
.  .***********.****** ***** ..

327. spacer 1.6|44999|31|NC_016110|CRISPRCasFinder matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 9, identity: 0.71

cgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
tcaccgtcggcgccccggtcctgaccgcgtt	Protospacer
.  .***********.****** ***** ..

328. spacer 1.6|44999|31|NC_016110|CRISPRCasFinder matches to NC_019847 (Sinorhizobium meliloti GR4 plasmid pRmeGR4b, complete sequence) position: , mismatch: 9, identity: 0.71

cgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
atctcgacggcgacctggtcctcacccatcg	Protospacer
  .*** ***** *************  .* 

329. spacer 1.6|44999|31|NC_016110|CRISPRCasFinder matches to NZ_CP031163 (Deinococcus wulumuqiensis strain NEB 479 plasmid pDrdI, complete sequence) position: , mismatch: 9, identity: 0.71

cgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
tgggtctcgccgccctggtcatcaccgccgt	Protospacer
.*  . *** ********** ******** .

330. spacer 1.6|44999|31|NC_016110|CRISPRCasFinder matches to LZ998054 (JP 2017534684-A/1: Phage Therapy) position: , mismatch: 9, identity: 0.71

cgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
gaaccgtcggcgccctgatcttcaccgtcgt	Protospacer
 . .*************.**.******.* .

331. spacer 1.6|44999|31|NC_016110|CRISPRCasFinder matches to NC_048097 (Arthrobacter phage Yang, complete genome) position: , mismatch: 9, identity: 0.71

cgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
acgtcgtcgccgccctgggcctcaccatgcg	Protospacer
   ****** ******** *******.. * 

332. spacer 1.6|44999|31|NC_016110|CRISPRCasFinder matches to MK967377 (Gordonia phage MagicMan, complete genome) position: , mismatch: 9, identity: 0.71

cgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
accccggcggcgccctggtgctcaccgacta	Protospacer
  ..** ************ ******* *. 

333. spacer 1.6|44999|31|NC_016110|CRISPRCasFinder matches to NC_011165 (Pseudomonas phage LBL3, complete genome) position: , mismatch: 9, identity: 0.71

cgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
gaaccatcggcgccctgatcttcaccgccgt	Protospacer
 . .*.***********.**.******** .

334. spacer 1.6|44999|31|NC_016110|CRISPRCasFinder matches to MT108729 (Pseudomonas phage Epa22, complete genome) position: , mismatch: 9, identity: 0.71

cgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
gaaccatcggcgccctgatcttcaccgccgt	Protospacer
 . .*.***********.**.******** .

335. spacer 1.6|44999|31|NC_016110|CRISPRCasFinder matches to MT491205 (Pseudomonas phage vB_PaeM_USP_2, complete genome) position: , mismatch: 9, identity: 0.71

cgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
gaaccgtcggcgccctgatcttcaccgtcgt	Protospacer
 . .*************.**.******.* .

336. spacer 1.6|44999|31|NC_016110|CRISPRCasFinder matches to MN813694 (Gordonia phage Opie, complete genome) position: , mismatch: 9, identity: 0.71

cgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
accccggcggcgccctggttctcaccgacta	Protospacer
  ..** ************.******* *. 

337. spacer 1.6|44999|31|NC_016110|CRISPRCasFinder matches to LC102730 (Pseudomonas phage S12-1 DNA, complete genome) position: , mismatch: 9, identity: 0.71

cgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
gaaccatcggcgccctgatcttcaccgccgt	Protospacer
 . .*.***********.**.******** .

338. spacer 1.6|44999|31|NC_016110|CRISPRCasFinder matches to LC472883 (Pseudomonas phage S12-3 DNA, complete genome) position: , mismatch: 9, identity: 0.71

cgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
gaaccatcggcgccctgatcttcaccgccgt	Protospacer
 . .*.***********.**.******** .

339. spacer 1.6|44999|31|NC_016110|CRISPRCasFinder matches to MN871454 (UNVERIFIED: Pseudomonas phage Pa-A, complete genome) position: , mismatch: 9, identity: 0.71

cgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
gaaccgtcggcgccctgatcatcaccgtcgt	Protospacer
 . .*************.** ******.* .

340. spacer 1.6|44999|31|NC_016110|CRISPRCasFinder matches to FM201281 (Pseudomonas phage LBL3 complete genome) position: , mismatch: 9, identity: 0.71

cgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
gaaccatcggcgccctgatcttcaccgccgt	Protospacer
 . .*.***********.**.******** .

341. spacer 1.6|44999|31|NC_016110|CRISPRCasFinder matches to KU198331 (Pseudomonas phage NP3, complete genome) position: , mismatch: 9, identity: 0.71

cgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
gaaccgtcggcgccctgatcttcaccgtcgt	Protospacer
 . .*************.**.******.* .

342. spacer 1.6|44999|31|NC_016110|CRISPRCasFinder matches to MN615701 (Pseudomonas phage vB_PaeM_SMS21, complete genome) position: , mismatch: 9, identity: 0.71

cgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
gaaccgtcggcgccctgatcttcaccgtcgt	Protospacer
 . .*************.**.******.* .

343. spacer 1.6|44999|31|NC_016110|CRISPRCasFinder matches to KM434184 (Pseudomonas phage vB_Pae_PS44, complete genome) position: , mismatch: 9, identity: 0.71

cgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
gaaccgtcggcgccctgatcttcaccgtcgt	Protospacer
 . .*************.**.******.* .

344. spacer 1.6|44999|31|NC_016110|CRISPRCasFinder matches to MT118290 (Pseudomonas phage Epa10, complete genome) position: , mismatch: 9, identity: 0.71

cgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
gaaccgtcggcgccctgatcttcaccgtcgt	Protospacer
 . .*************.**.******.* .

345. spacer 1.6|44999|31|NC_016110|CRISPRCasFinder matches to NC_007810 (Pseudomonas phage F8, complete genome) position: , mismatch: 9, identity: 0.71

cgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
gaaccatcggcgccctgatcttcaccgccgt	Protospacer
 . .*.***********.**.******** .

346. spacer 1.6|44999|31|NC_016110|CRISPRCasFinder matches to MN062704 (Gordonia phage JuJu, complete genome) position: , mismatch: 9, identity: 0.71

cgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
tcgacgtcgccgccctggtcctcgccgtcgg	Protospacer
.   ***** *************.***.*  

347. spacer 1.6|44999|31|NC_016110|CRISPRCasFinder matches to NC_048676 (Pseudomonas phage SL1, complete genome) position: , mismatch: 9, identity: 0.71

cgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
gaaccgtcggcgccctgatcttcaccgtcgt	Protospacer
 . .*************.**.******.* .

348. spacer 1.6|44999|31|NC_016110|CRISPRCasFinder matches to MT119376 (Pseudomonas phage chunk, complete genome) position: , mismatch: 9, identity: 0.71

cgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
gaaccatcggcgccctgatcttcaccgccgt	Protospacer
 . .*.***********.**.******** .

349. spacer 1.6|44999|31|NC_016110|CRISPRCasFinder matches to MT108727 (Pseudomonas phage Epa11, complete genome) position: , mismatch: 9, identity: 0.71

cgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
gaaccgtcggcgccctgatcttcaccgtcgt	Protospacer
 . .*************.**.******.* .

350. spacer 1.6|44999|31|NC_016110|CRISPRCasFinder matches to LQ277706 (Sequence 1 from Patent WO2016071503) position: , mismatch: 9, identity: 0.71

cgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
gaaccgtcggcgccctgatcttcaccgtcgt	Protospacer
 . .*************.**.******.* .

351. spacer 1.6|44999|31|NC_016110|CRISPRCasFinder matches to MN131141 (Pseudomonas virus PaP1_EPu-2019, complete genome) position: , mismatch: 9, identity: 0.71

cgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
gaaccgtcggcgccctgatcttcaccgtcgt	Protospacer
 . .*************.**.******.* .

352. spacer 1.6|44999|31|NC_016110|CRISPRCasFinder matches to MT119370 (Pseudomonas phage steven, complete genome) position: , mismatch: 9, identity: 0.71

cgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
gagccgtcggcgccctgatcttcaccggcgt	Protospacer
 . .*************.**.****** * .

353. spacer 1.6|44999|31|NC_016110|CRISPRCasFinder matches to MN615700 (Pseudomonas phage vB_PaeM_SMS12, complete genome) position: , mismatch: 9, identity: 0.71

cgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
gaaccgtcggcgccctgatcttcaccgtcgt	Protospacer
 . .*************.**.******.* .

354. spacer 1.6|44999|31|NC_016110|CRISPRCasFinder matches to MT108726 (Pseudomonas phage Epa6, complete genome) position: , mismatch: 9, identity: 0.71

cgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
gaaccgtcggcgccctgatcatcaccgtcgt	Protospacer
 . .*************.** ******.* .

355. spacer 1.6|44999|31|NC_016110|CRISPRCasFinder matches to KR054033 (Pseudomonas phage DL68, complete genome) position: , mismatch: 9, identity: 0.71

cgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
gaaccgtcggcgccctgatcttcaccgtcgt	Protospacer
 . .*************.**.******.* .

356. spacer 1.6|44999|31|NC_016110|CRISPRCasFinder matches to LN610579 (Pseudomonas phage vB_PaeM_PAO1_Ab27, complete genome) position: , mismatch: 9, identity: 0.71

cgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
gaaccatcggcgccctgatcttcaccgccgt	Protospacer
 . .*.***********.**.******** .

357. spacer 1.6|44999|31|NC_016110|CRISPRCasFinder matches to MK318076 (Pseudomonas phage vB_PaeM_fHoPae01, complete genome) position: , mismatch: 9, identity: 0.71

cgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
gaaccgtcggcgccctgatcttcaccgtcgt	Protospacer
 . .*************.**.******.* .

358. spacer 1.6|44999|31|NC_016110|CRISPRCasFinder matches to NC_031255 (Gordonia phage Schwabeltier, complete genome) position: , mismatch: 9, identity: 0.71

cgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
accccggcggcgccctggtgctcaccgacta	Protospacer
  ..** ************ ******* *. 

359. spacer 1.6|44999|31|NC_016110|CRISPRCasFinder matches to MT119366 (Pseudomonas phage jett, complete genome) position: , mismatch: 9, identity: 0.71

cgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
gaaccgtcggcgccctgatcttcaccgtcgt	Protospacer
 . .*************.**.******.* .

360. spacer 1.6|44999|31|NC_016110|CRISPRCasFinder matches to NC_011756 (Pseudomonas phage SN, complete genome) position: , mismatch: 9, identity: 0.71

cgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
gaaccgtcggcgccctgatcttcaccgtcgt	Protospacer
 . .*************.**.******.* .

361. spacer 1.6|44999|31|NC_016110|CRISPRCasFinder matches to NC_011703 (Pseudomonas phage 14-1, complete genome) position: , mismatch: 9, identity: 0.71

cgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
gaaccgtcggcgccctgatcttcaccgtcgt	Protospacer
 . .*************.**.******.* .

362. spacer 1.6|44999|31|NC_016110|CRISPRCasFinder matches to MK317959 (Pseudomonas phage EPa61, complete genome) position: , mismatch: 9, identity: 0.71

cgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
gaaccgtcggcgccctgatcatcaccgtcgt	Protospacer
 . .*************.** ******.* .

363. spacer 1.6|44999|31|NC_016110|CRISPRCasFinder matches to MN131143 (Pseudomonas virus PA11P1, complete genome) position: , mismatch: 9, identity: 0.71

cgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
gaaccgtcggcgccctgatcttcaccgtcgt	Protospacer
 . .*************.**.******.* .

364. spacer 1.6|44999|31|NC_016110|CRISPRCasFinder matches to DQ163917 (Bacteriophage F8, complete genome) position: , mismatch: 9, identity: 0.71

cgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
gaaccatcggcgccctgatcttcaccgccgt	Protospacer
 . .*.***********.**.******** .

365. spacer 1.6|44999|31|NC_016110|CRISPRCasFinder matches to MT119369 (Pseudomonas phage sortsol, complete genome) position: , mismatch: 9, identity: 0.71

cgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
gaaccgtcggcgccctgatcttcaccgtcgt	Protospacer
 . .*************.**.******.* .

366. spacer 1.6|44999|31|NC_016110|CRISPRCasFinder matches to MN615702 (Pseudomonas phage vB_PaeM_SMS29, complete genome) position: , mismatch: 9, identity: 0.71

cgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
gaaccgtcggcgccctgatcttcaccgtcgt	Protospacer
 . .*************.**.******.* .

367. spacer 1.6|44999|31|NC_016110|CRISPRCasFinder matches to NC_026600 (Pseudomonas phage vB_PaeM_C1-14_Ab28, complete genome) position: , mismatch: 9, identity: 0.71

cgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
gaaccgtcggcgccctgatcatcaccgtcgt	Protospacer
 . .*************.** ******.* .

368. spacer 1.6|44999|31|NC_016110|CRISPRCasFinder matches to NC_050147 (Pseudomonas phage Epa13, complete genome) position: , mismatch: 9, identity: 0.71

cgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
gaaccatcggcgccctgatcttcaccgccgt	Protospacer
 . .*.***********.**.******** .

369. spacer 1.14|44815|32|NC_016110|PILER-CR matches to NZ_CP020399 (Burkholderia multivorans strain FDAARGOS_246 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

atgcagatgagcgcgtcggcgcacgcggcatg	CRISPR spacer
cgatgggcgagcgcgtcggcgtacgcggcatc	Protospacer
  ...*..*************.********* 

370. spacer 1.14|44815|32|NC_016110|PILER-CR matches to NZ_LR699556 (Paraburkholderia sp. Msb3 isolate PDMSB31 plasmid pII) position: , mismatch: 9, identity: 0.719

atgcagatgagcgcgtcggcgcacgcggcatg	CRISPR spacer
taacgctcgagcgcgtcggcgctcgccgcatg	Protospacer
  .*.  .************** *** *****

371. spacer 1.14|44815|32|NC_016110|PILER-CR matches to NC_023136 (Leisingera methylohalidivorans DSM 14336 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

atgcagatgagcgcgtcggcgcacgcggcatg	CRISPR spacer
gagatcagcagcgcgccggcgcccgcggcatg	Protospacer
. *   *  ******.****** *********

372. spacer 1.15|44876|32|NC_016110|PILER-CR matches to NZ_CP012664 (Defluviimonas alba strain cai42 plasmid pcai42C, complete sequence) position: , mismatch: 9, identity: 0.719

agcaaggttcgcaaccgatcggagaagctcgg	CRISPR spacer
cgagaagttcgcaagcgttcggagaagctgtc	Protospacer
 * .*.******** ** ***********   

373. spacer 1.16|44937|32|NC_016110|PILER-CR matches to NZ_CP035710 (Sphaerotilus natans subsp. sulfidivorans strain D-507 plasmid pSna507_unt10, complete sequence) position: , mismatch: 9, identity: 0.719

gtcatcatcacgccgcgcacggcggcgttgtc	CRISPR spacer
ttgaagcgcacgccgcgcacgccggcgtcgtg	Protospacer
 * *    ************* ******.** 

374. spacer 1.17|44998|32|NC_016110|PILER-CR matches to NZ_CP029362 (Streptomyces globisporus strain TFH56 plasmid pTFSG1, complete sequence) position: , mismatch: 9, identity: 0.719

gcgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
cccgccgtcggcggcctggtcctcgccgcgtt	Protospacer
 *  .******** **********.**** ..

375. spacer 1.17|44998|32|NC_016110|PILER-CR matches to NZ_CP013739 (Streptomyces globisporus C-1027 plasmid SGLP1, complete sequence) position: , mismatch: 9, identity: 0.719

gcgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
cccgccgtcggcggcctggtcctcgccgcgtt	Protospacer
 *  .******** **********.**** ..

376. spacer 1.17|44998|32|NC_016110|PILER-CR matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 9, identity: 0.719

gcgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
gtcacggtcggtgccccggtcctcaccgccat	Protospacer
*.  . *****.****.************* .

377. spacer 1.17|44998|32|NC_016110|PILER-CR matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 9, identity: 0.719

gcgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
gatggtggcggcgccctgttcctgaccgccca	Protospacer
*    .* ********** **** ******* 

378. spacer 1.17|44998|32|NC_016110|PILER-CR matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719

gcgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
gtcaccgtcggcgccccggtcctgaccgcgtt	Protospacer
*.  .***********.****** ***** ..

379. spacer 1.17|44998|32|NC_016110|PILER-CR matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 9, identity: 0.719

gcgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
gtcaccgtcggcgccccggtcctgaccgcgtt	Protospacer
*.  .***********.****** ***** ..

380. spacer 1.17|44998|32|NC_016110|PILER-CR matches to NC_019847 (Sinorhizobium meliloti GR4 plasmid pRmeGR4b, complete sequence) position: , mismatch: 9, identity: 0.719

gcgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
gatctcgacggcgacctggtcctcacccatcg	Protospacer
*  .*** ***** *************  .* 

381. spacer 1.17|44998|32|NC_016110|PILER-CR matches to NZ_CP017148 (Bosea vaviloviae strain Vaf18 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

gcgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
accttcgtcggcgccctgatcctgacgctcgt	Protospacer
.* ***************.**** **  .* .

382. spacer 1.17|44998|32|NC_016110|PILER-CR matches to NZ_CP031163 (Deinococcus wulumuqiensis strain NEB 479 plasmid pDrdI, complete sequence) position: , mismatch: 9, identity: 0.719

gcgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
gtgggtctcgccgccctggtcatcaccgccgt	Protospacer
*.*  . *** ********** ******** .

383. spacer 1.17|44998|32|NC_016110|PILER-CR matches to LZ998054 (JP 2017534684-A/1: Phage Therapy) position: , mismatch: 9, identity: 0.719

gcgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
ggaaccgtcggcgccctgatcttcaccgtcgt	Protospacer
* . .*************.**.******.* .

384. spacer 1.17|44998|32|NC_016110|PILER-CR matches to NC_048097 (Arthrobacter phage Yang, complete genome) position: , mismatch: 9, identity: 0.719

gcgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
gacgtcgtcgccgccctgggcctcaccatgcg	Protospacer
*   ****** ******** *******.. * 

385. spacer 1.17|44998|32|NC_016110|PILER-CR matches to NC_011165 (Pseudomonas phage LBL3, complete genome) position: , mismatch: 9, identity: 0.719

gcgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
ggaaccatcggcgccctgatcttcaccgccgt	Protospacer
* . .*.***********.**.******** .

386. spacer 1.17|44998|32|NC_016110|PILER-CR matches to MT108729 (Pseudomonas phage Epa22, complete genome) position: , mismatch: 9, identity: 0.719

gcgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
ggaaccatcggcgccctgatcttcaccgccgt	Protospacer
* . .*.***********.**.******** .

387. spacer 1.17|44998|32|NC_016110|PILER-CR matches to MT491205 (Pseudomonas phage vB_PaeM_USP_2, complete genome) position: , mismatch: 9, identity: 0.719

gcgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
ggaaccgtcggcgccctgatcttcaccgtcgt	Protospacer
* . .*************.**.******.* .

388. spacer 1.17|44998|32|NC_016110|PILER-CR matches to LC102730 (Pseudomonas phage S12-1 DNA, complete genome) position: , mismatch: 9, identity: 0.719

gcgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
ggaaccatcggcgccctgatcttcaccgccgt	Protospacer
* . .*.***********.**.******** .

389. spacer 1.17|44998|32|NC_016110|PILER-CR matches to LC472883 (Pseudomonas phage S12-3 DNA, complete genome) position: , mismatch: 9, identity: 0.719

gcgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
ggaaccatcggcgccctgatcttcaccgccgt	Protospacer
* . .*.***********.**.******** .

390. spacer 1.17|44998|32|NC_016110|PILER-CR matches to MN871454 (UNVERIFIED: Pseudomonas phage Pa-A, complete genome) position: , mismatch: 9, identity: 0.719

gcgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
ggaaccgtcggcgccctgatcatcaccgtcgt	Protospacer
* . .*************.** ******.* .

391. spacer 1.17|44998|32|NC_016110|PILER-CR matches to FM201281 (Pseudomonas phage LBL3 complete genome) position: , mismatch: 9, identity: 0.719

gcgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
ggaaccatcggcgccctgatcttcaccgccgt	Protospacer
* . .*.***********.**.******** .

392. spacer 1.17|44998|32|NC_016110|PILER-CR matches to KU198331 (Pseudomonas phage NP3, complete genome) position: , mismatch: 9, identity: 0.719

gcgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
ggaaccgtcggcgccctgatcttcaccgtcgt	Protospacer
* . .*************.**.******.* .

393. spacer 1.17|44998|32|NC_016110|PILER-CR matches to MN615701 (Pseudomonas phage vB_PaeM_SMS21, complete genome) position: , mismatch: 9, identity: 0.719

gcgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
ggaaccgtcggcgccctgatcttcaccgtcgt	Protospacer
* . .*************.**.******.* .

394. spacer 1.17|44998|32|NC_016110|PILER-CR matches to KM434184 (Pseudomonas phage vB_Pae_PS44, complete genome) position: , mismatch: 9, identity: 0.719

gcgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
ggaaccgtcggcgccctgatcttcaccgtcgt	Protospacer
* . .*************.**.******.* .

395. spacer 1.17|44998|32|NC_016110|PILER-CR matches to MT118290 (Pseudomonas phage Epa10, complete genome) position: , mismatch: 9, identity: 0.719

gcgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
ggaaccgtcggcgccctgatcttcaccgtcgt	Protospacer
* . .*************.**.******.* .

396. spacer 1.17|44998|32|NC_016110|PILER-CR matches to NC_007810 (Pseudomonas phage F8, complete genome) position: , mismatch: 9, identity: 0.719

gcgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
ggaaccatcggcgccctgatcttcaccgccgt	Protospacer
* . .*.***********.**.******** .

397. spacer 1.17|44998|32|NC_016110|PILER-CR matches to MN062704 (Gordonia phage JuJu, complete genome) position: , mismatch: 9, identity: 0.719

gcgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
gtcgacgtcgccgccctggtcctcgccgtcgg	Protospacer
*.   ***** *************.***.*  

398. spacer 1.17|44998|32|NC_016110|PILER-CR matches to NC_048676 (Pseudomonas phage SL1, complete genome) position: , mismatch: 9, identity: 0.719

gcgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
ggaaccgtcggcgccctgatcttcaccgtcgt	Protospacer
* . .*************.**.******.* .

399. spacer 1.17|44998|32|NC_016110|PILER-CR matches to MT119376 (Pseudomonas phage chunk, complete genome) position: , mismatch: 9, identity: 0.719

gcgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
ggaaccatcggcgccctgatcttcaccgccgt	Protospacer
* . .*.***********.**.******** .

400. spacer 1.17|44998|32|NC_016110|PILER-CR matches to MT108727 (Pseudomonas phage Epa11, complete genome) position: , mismatch: 9, identity: 0.719

gcgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
ggaaccgtcggcgccctgatcttcaccgtcgt	Protospacer
* . .*************.**.******.* .

401. spacer 1.17|44998|32|NC_016110|PILER-CR matches to LQ277706 (Sequence 1 from Patent WO2016071503) position: , mismatch: 9, identity: 0.719

gcgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
ggaaccgtcggcgccctgatcttcaccgtcgt	Protospacer
* . .*************.**.******.* .

402. spacer 1.17|44998|32|NC_016110|PILER-CR matches to MN131141 (Pseudomonas virus PaP1_EPu-2019, complete genome) position: , mismatch: 9, identity: 0.719

gcgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
ggaaccgtcggcgccctgatcttcaccgtcgt	Protospacer
* . .*************.**.******.* .

403. spacer 1.17|44998|32|NC_016110|PILER-CR matches to MT119370 (Pseudomonas phage steven, complete genome) position: , mismatch: 9, identity: 0.719

gcgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
ggagccgtcggcgccctgatcttcaccggcgt	Protospacer
* . .*************.**.****** * .

404. spacer 1.17|44998|32|NC_016110|PILER-CR matches to MN615700 (Pseudomonas phage vB_PaeM_SMS12, complete genome) position: , mismatch: 9, identity: 0.719

gcgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
ggaaccgtcggcgccctgatcttcaccgtcgt	Protospacer
* . .*************.**.******.* .

405. spacer 1.17|44998|32|NC_016110|PILER-CR matches to MT108726 (Pseudomonas phage Epa6, complete genome) position: , mismatch: 9, identity: 0.719

gcgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
ggaaccgtcggcgccctgatcatcaccgtcgt	Protospacer
* . .*************.** ******.* .

406. spacer 1.17|44998|32|NC_016110|PILER-CR matches to KR054033 (Pseudomonas phage DL68, complete genome) position: , mismatch: 9, identity: 0.719

gcgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
ggaaccgtcggcgccctgatcttcaccgtcgt	Protospacer
* . .*************.**.******.* .

407. spacer 1.17|44998|32|NC_016110|PILER-CR matches to LN610579 (Pseudomonas phage vB_PaeM_PAO1_Ab27, complete genome) position: , mismatch: 9, identity: 0.719

gcgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
ggaaccatcggcgccctgatcttcaccgccgt	Protospacer
* . .*.***********.**.******** .

408. spacer 1.17|44998|32|NC_016110|PILER-CR matches to MK318076 (Pseudomonas phage vB_PaeM_fHoPae01, complete genome) position: , mismatch: 9, identity: 0.719

gcgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
ggaaccgtcggcgccctgatcttcaccgtcgt	Protospacer
* . .*************.**.******.* .

409. spacer 1.17|44998|32|NC_016110|PILER-CR matches to MT119366 (Pseudomonas phage jett, complete genome) position: , mismatch: 9, identity: 0.719

gcgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
ggaaccgtcggcgccctgatcttcaccgtcgt	Protospacer
* . .*************.**.******.* .

410. spacer 1.17|44998|32|NC_016110|PILER-CR matches to NC_011756 (Pseudomonas phage SN, complete genome) position: , mismatch: 9, identity: 0.719

gcgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
ggaaccgtcggcgccctgatcttcaccgtcgt	Protospacer
* . .*************.**.******.* .

411. spacer 1.17|44998|32|NC_016110|PILER-CR matches to NC_011703 (Pseudomonas phage 14-1, complete genome) position: , mismatch: 9, identity: 0.719

gcgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
ggaaccgtcggcgccctgatcttcaccgtcgt	Protospacer
* . .*************.**.******.* .

412. spacer 1.17|44998|32|NC_016110|PILER-CR matches to MK317959 (Pseudomonas phage EPa61, complete genome) position: , mismatch: 9, identity: 0.719

gcgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
ggaaccgtcggcgccctgatcatcaccgtcgt	Protospacer
* . .*************.** ******.* .

413. spacer 1.17|44998|32|NC_016110|PILER-CR matches to MN131143 (Pseudomonas virus PA11P1, complete genome) position: , mismatch: 9, identity: 0.719

gcgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
ggaaccgtcggcgccctgatcttcaccgtcgt	Protospacer
* . .*************.**.******.* .

414. spacer 1.17|44998|32|NC_016110|PILER-CR matches to DQ163917 (Bacteriophage F8, complete genome) position: , mismatch: 9, identity: 0.719

gcgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
ggaaccatcggcgccctgatcttcaccgccgt	Protospacer
* . .*.***********.**.******** .

415. spacer 1.17|44998|32|NC_016110|PILER-CR matches to MT119369 (Pseudomonas phage sortsol, complete genome) position: , mismatch: 9, identity: 0.719

gcgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
ggaaccgtcggcgccctgatcttcaccgtcgt	Protospacer
* . .*************.**.******.* .

416. spacer 1.17|44998|32|NC_016110|PILER-CR matches to MN615702 (Pseudomonas phage vB_PaeM_SMS29, complete genome) position: , mismatch: 9, identity: 0.719

gcgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
ggaaccgtcggcgccctgatcttcaccgtcgt	Protospacer
* . .*************.**.******.* .

417. spacer 1.17|44998|32|NC_016110|PILER-CR matches to NC_026600 (Pseudomonas phage vB_PaeM_C1-14_Ab28, complete genome) position: , mismatch: 9, identity: 0.719

gcgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
ggaaccgtcggcgccctgatcatcaccgtcgt	Protospacer
* . .*************.** ******.* .

418. spacer 1.17|44998|32|NC_016110|PILER-CR matches to NC_050147 (Pseudomonas phage Epa13, complete genome) position: , mismatch: 9, identity: 0.719

gcgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
ggaaccatcggcgccctgatcttcaccgccgt	Protospacer
* . .*.***********.**.******** .

419. spacer 2.2|52199|32|NC_016110|CRISPRCasFinder,CRT matches to NZ_CP023039 (Komagataeibacter saccharivorans strain CV1 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719

ccggcgcgggtgccgcgcagagcggcggcccc----	CRISPR spacer
tgcgcgcgggtgccgcgtagagcgg----ctcgaaa	Protospacer
.  **************.*******    *.*    

420. spacer 2.2|52199|32|NC_016110|CRISPRCasFinder,CRT matches to MG099947 (Mycobacterium phage Ph8s, complete genome) position: , mismatch: 9, identity: 0.719

ccggcgcgggtgccgcgcagagcggcggcccc	CRISPR spacer
tgcttgccggtgccgcgcagagctgcggcttc	Protospacer
.   .** *************** *****..*

421. spacer 2.2|52199|32|NC_016110|CRISPRCasFinder,CRT matches to NC_022043 (Paracoccus aminophilus JCM 7686 plasmid pAMI5, complete sequence) position: , mismatch: 9, identity: 0.719

ccggcgcgggtgccgcgcagagcggcggcccc	CRISPR spacer
agagggcgggtgccgcgcagcgcgccggaatc	Protospacer
  .* *************** *** ***  .*

422. spacer 2.2|52199|32|NC_016110|CRISPRCasFinder,CRT matches to NZ_CP025552 (Streptomyces rimosus strain WT5260 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

ccggcgcgggtgccgcgcagagcggcggcccc	CRISPR spacer
gtgacgcgggtgccgcgcagcgaggcgcggct	Protospacer
 .*.**************** * ****   *.

423. spacer 2.2|52199|32|NC_016110|CRISPRCasFinder,CRT matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 9, identity: 0.719

ccggcgcgggtgccgcgcagagcggcggcccc	CRISPR spacer
gcggcgtgggtgccgcgcagggcgttgagcat	Protospacer
 *****.*************.*** .*. * .

424. spacer 2.4|52321|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020926 (Sphingobium yanoikuyae strain SHJ plasmid pSES220, complete sequence) position: , mismatch: 9, identity: 0.719

ggtcggtcgctccagaccatcgagcgcaacgt	CRISPR spacer
cataccgcgctccagttcatcgagcgcaacgg	Protospacer
 .*    ******** .************** 

425. spacer 2.8|52571|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

tcaca-tccccggcaagcggcccaagatctact	CRISPR spacer
-cgcgttccccggcaagcggctcaagctcgtga	Protospacer
 *.*. ***************.**** **    

426. spacer 2.9|52632|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015032 (Burkholderia cenocepacia strain 842 plasmid pBcn842-1, complete sequence) position: , mismatch: 9, identity: 0.719

cgctcgacgacgatgccgagttcggtgttgga	CRISPR spacer
tcgccgacgtcgatgccgagttcgatgtgtgc	Protospacer
.  .***** **************.***  * 

427. spacer 2.9|52632|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025505 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvC, complete sequence) position: , mismatch: 9, identity: 0.719

cgctcgacgacgatgccgagttcg---gtgttgga	CRISPR spacer
agctcgacgacaatgccgagctcgcccgcttc---	Protospacer
 **********.********.***   *. *.   

428. spacer 2.9|52632|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030762 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

cgctcgacgacgatgccgagttcg---gtgttgga	CRISPR spacer
agctcgacgacaatgccgagctcgcccgcttc---	Protospacer
 **********.********.***   *. *.   

429. spacer 2.11|52754|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to MN586029 (Mycobacterium phage Hannaconda, complete genome) position: , mismatch: 9, identity: 0.719

atccggtgtccggacccgaggtggcgtcctcg	CRISPR spacer
acacgttgtccgaacccgaggtggcggtgatg	Protospacer
*. ** ******.************* .  .*

430. spacer 2.11|52754|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to MF072690 (Mycobacterium phage Porcelain, complete genome) position: , mismatch: 9, identity: 0.719

atccggtgtccggacccgaggtggcgtcctcg	CRISPR spacer
acacgttgtccgaacccgaggtggcggtgatg	Protospacer
*. ** ******.************* .  .*

431. spacer 2.11|52754|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to MF919534 (Mycobacterium phage Superphikiman, complete genome) position: , mismatch: 9, identity: 0.719

atccggtgtccggacccgaggtggcgtcctcg	CRISPR spacer
acacgttgtccgaacccgaggtggcggtgatg	Protospacer
*. ** ******.************* .  .*

432. spacer 2.11|52754|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NC_023690 (Mycobacterium phage Courthouse, complete genome) position: , mismatch: 9, identity: 0.719

atccggtgtccggacccgaggtggcgtcctcg	CRISPR spacer
acacgttgtccgaacccgaggtggcggtgatg	Protospacer
*. ** ******.************* .  .*

433. spacer 2.11|52754|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NC_028953 (Mycobacterium phage MiaZeal, complete genome) position: , mismatch: 9, identity: 0.719

atccggtgtccggacccgaggtggcgtcctcg	CRISPR spacer
acacgttgtccgaacccgaggtggcggtgatg	Protospacer
*. ** ******.************* .  .*

434. spacer 2.12|52815|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 9, identity: 0.719

gggagctgcgcaacgacttcgacgatgcgctt	CRISPR spacer
gtcttctgcgcaacgactgcgtcgatgcgacc	Protospacer
*    ************* ** ******* ..

435. spacer 2.12|52815|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 9, identity: 0.719

gggagctgcgcaacgacttcgacgatgcgctt	CRISPR spacer
gtcttctgcgcaacgactgcgtcgatgcgacc	Protospacer
*    ************* ** ******* ..

436. spacer 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT matches to KU985096 (Mycobacterium phage Kazan, complete genome) position: , mismatch: 9, identity: 0.719

gtcgcggtgtcggtggcggtggacttccgggt	CRISPR spacer
cctccggtgtcggggccggtggacttccgctc	Protospacer
 .. ********* * *************  .

437. spacer 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT matches to MG099952 (Mycobacterium phage WunderPhul, complete genome) position: , mismatch: 9, identity: 0.719

gtcgcggtgtcggtggcggtggacttccgggt	CRISPR spacer
cctccggtgtcggggccggtggacttccgctc	Protospacer
 .. ********* * *************  .

438. spacer 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT matches to MK359352 (Mycobacterium phage JewelBug, complete genome) position: , mismatch: 9, identity: 0.719

gtcgcggtgtcggtggcggtggacttccgggt	CRISPR spacer
cctccggtgtcggggccggtggacttccgctc	Protospacer
 .. ********* * *************  .

439. spacer 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT matches to KX375815 (Mycobacterium phage ToneTone, complete genome) position: , mismatch: 9, identity: 0.719

gtcgcggtgtcggtggcggtggacttccgggt	CRISPR spacer
cctccggtgtcggggccggtggacttccgctc	Protospacer
 .. ********* * *************  .

440. spacer 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT matches to MK494090 (Mycobacterium phage Jordennis, complete genome) position: , mismatch: 9, identity: 0.719

gtcgcggtgtcggtggcggtggacttccgggt	CRISPR spacer
cctccggtgtcggggccggtggacttccgctc	Protospacer
 .. ********* * *************  .

441. spacer 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT matches to KX641261 (Mycobacterium phage Isiphiwo, complete genome) position: , mismatch: 9, identity: 0.719

gtcgcggtgtcggtggcggtggacttccgggt	CRISPR spacer
cctccggtgtcggggccggtggacttccgctc	Protospacer
 .. ********* * *************  .

442. spacer 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT matches to KF560333 (Mycobacterium phage Artemis2UCLA, complete genome) position: , mismatch: 9, identity: 0.719

gtcgcggtgtcggtggcggtggacttccgggt	CRISPR spacer
cctccggtgtcggggccggtggacttccgctc	Protospacer
 .. ********* * *************  .

443. spacer 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT matches to KU695582 (Mycobacterium phage McFly, complete genome) position: , mismatch: 9, identity: 0.719

gtcgcggtgtcggtggcggtggacttccgggt	CRISPR spacer
cctccggtgtcggggccggtggacttccgctc	Protospacer
 .. ********* * *************  .

444. spacer 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT matches to MT024861 (Mycobacterium phage Pmask, complete genome) position: , mismatch: 9, identity: 0.719

gtcgcggtgtcggtggcggtggacttccgggt	CRISPR spacer
cctccggtgtcggggccggtggacttccgctc	Protospacer
 .. ********* * *************  .

445. spacer 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT matches to MH155876 (Mycobacterium phage Priamo, complete genome) position: , mismatch: 9, identity: 0.719

gtcgcggtgtcggtggcggtggacttccgggt	CRISPR spacer
cctccggtgtcggggccggtggacttccgctc	Protospacer
 .. ********* * *************  .

446. spacer 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT matches to MK359360 (Mycobacterium phage Hexamo, complete genome) position: , mismatch: 9, identity: 0.719

gtcgcggtgtcggtggcggtggacttccgggt	CRISPR spacer
cctccggtgtcggggccggtggacttccgctc	Protospacer
 .. ********* * *************  .

447. spacer 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT matches to MH051253 (Mycobacterium phage GreedyLawyer, complete genome) position: , mismatch: 9, identity: 0.719

gtcgcggtgtcggtggcggtggacttccgggt	CRISPR spacer
cctccggtgtcggggccggtggacttccgctc	Protospacer
 .. ********* * *************  .

448. spacer 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT matches to MT657338 (Mycobacterium phage SuperCallie99, complete genome) position: , mismatch: 9, identity: 0.719

gtcgcggtgtcggtggcggtggacttccgggt	CRISPR spacer
cctccggtgtcggggccggtggacttccgctc	Protospacer
 .. ********* * *************  .

449. spacer 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT matches to NC_042334 (Mycobacterium virus Jeffabunny, complete genome) position: , mismatch: 9, identity: 0.719

gtcgcggtgtcggtggcggtggacttccgggt	CRISPR spacer
cctccggtgtcggggccggtggacttccgctc	Protospacer
 .. ********* * *************  .

450. spacer 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT matches to MN728683 (Mycobacterium phage Yokurt, complete genome) position: , mismatch: 9, identity: 0.719

gtcgcggtgtcggtggcggtggacttccgggt	CRISPR spacer
cctccggtgtcggggccggtggacttccgctc	Protospacer
 .. ********* * *************  .

451. spacer 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT matches to NC_022965 (Mycobacterium phage CloudWang3, complete genome) position: , mismatch: 9, identity: 0.719

gtcgcggtgtcggtggcggtggacttccgggt	CRISPR spacer
cctccggtgtcggggccggtggacttccgctc	Protospacer
 .. ********* * *************  .

452. spacer 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT matches to JF937092 (Mycobacterium phage DaVinci, complete genome) position: , mismatch: 9, identity: 0.719

gtcgcggtgtcggtggcggtggacttccgggt	CRISPR spacer
cctccggtgtcggggccggtggacttccgctc	Protospacer
 .. ********* * *************  .

453. spacer 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT matches to MF668288 (Mycobacterium phage Wiks, complete genome) position: , mismatch: 9, identity: 0.719

gtcgcggtgtcggtggcggtggacttccgggt	CRISPR spacer
cctccggtgtcggggccggtggacttccgctc	Protospacer
 .. ********* * *************  .

454. spacer 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT matches to MH020240 (Mycobacterium phage SuperAwesome, complete genome) position: , mismatch: 9, identity: 0.719

gtcgcggtgtcggtggcggtggacttccgggt	CRISPR spacer
cctccggtgtcggggccggtggacttccgctc	Protospacer
 .. ********* * *************  .

455. spacer 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT matches to MG099945 (Mycobacterium phage Koko, complete genome) position: , mismatch: 9, identity: 0.719

gtcgcggtgtcggtggcggtggacttccgggt	CRISPR spacer
cctccggtgtcggggccggtggacttccgctc	Protospacer
 .. ********* * *************  .

456. spacer 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT matches to MK894433 (Mycobacterium phage Kipper29, complete genome) position: , mismatch: 9, identity: 0.719

gtcgcggtgtcggtggcggtggacttccgggt	CRISPR spacer
cctccggtgtcggggccggtggacttccgctc	Protospacer
 .. ********* * *************  .

457. spacer 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT matches to NC_022985 (Mycobacterium phage Zaka, complete genome) position: , mismatch: 9, identity: 0.719

gtcgcggtgtcggtggcggtggacttccgggt	CRISPR spacer
cctccggtgtcggggccggtggacttccgctc	Protospacer
 .. ********* * *************  .

458. spacer 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT matches to JN049605 (Mycobacterium virus EricB, complete genome) position: , mismatch: 9, identity: 0.719

gtcgcggtgtcggtggcggtggacttccgggt	CRISPR spacer
cctccggtgtcggggccggtggacttccgctc	Protospacer
 .. ********* * *************  .

459. spacer 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT matches to MN586039 (Mycobacterium phage Blinn1, complete genome) position: , mismatch: 9, identity: 0.719

gtcgcggtgtcggtggcggtggacttccgggt	CRISPR spacer
cctccggtgtcggggccggtggacttccgctc	Protospacer
 .. ********* * *************  .

460. spacer 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT matches to MH779517 (Mycobacterium phage Zulu, complete genome) position: , mismatch: 9, identity: 0.719

gtcgcggtgtcggtggcggtggacttccgggt	CRISPR spacer
cctccggtgtcggggccggtggacttccgctc	Protospacer
 .. ********* * *************  .

461. spacer 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT matches to NC_029077 (Mycobacterium phage VohminGhazi, complete genome) position: , mismatch: 9, identity: 0.719

gtcgcggtgtcggtggcggtggacttccgggt	CRISPR spacer
cctccggtgtcggggccggtggacttccgctc	Protospacer
 .. ********* * *************  .

462. spacer 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT matches to KR053201 (Gordonia phage GTE8, complete genome) position: , mismatch: 9, identity: 0.719

gtcgcggtgtcggtggcggtggacttccgggt	CRISPR spacer
gcggcggtgtcggcggcggtcgacttctacca	Protospacer
*. **********.****** ******..   

463. spacer 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT matches to NC_019937 (Pseudomonas stutzeri RCH2 plasmid pPSEST01, complete sequence) position: , mismatch: 9, identity: 0.719

gtcgcggtgtcggtggcggtggacttccgggt	CRISPR spacer
gtggcggtggcggtggcggtggagtatctacg	Protospacer
** ****** ************* * .* .  

464. spacer 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT matches to CP003958 (Rhodococcus opacus PD630 plasmid 9, complete sequence) position: , mismatch: 9, identity: 0.719

gtcgcggtgtcggtggcggtggacttccgggt	CRISPR spacer
ggaccggtgtcggtgtcggtggccttcagcac	Protospacer
*   *********** ****** **** * ..

465. spacer 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT matches to MN234221 (Arthrobacter phage Shepard, complete genome) position: , mismatch: 9, identity: 0.719

gtcgcggtgtcggtggcggtggacttccgggt	CRISPR spacer
gtggcggtggcggtggcggtggatattcatcc	Protospacer
** ****** *************. *.*.  .

466. spacer 3.9|134444|32|NC_016110|CRISPRCasFinder,CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 9, identity: 0.719

accgccccgccggtccccggacagctcggcat	CRISPR spacer
ggccacccgccggaccacggacagctcgacgc	Protospacer
. *  ******** ** ***********.*..

467. spacer 3.9|134444|32|NC_016110|CRISPRCasFinder,CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 9, identity: 0.719

accgccccgccggtccccggacagctcggcat	CRISPR spacer
ggccacccgccggaccacggacagctcgacgc	Protospacer
. *  ******** ** ***********.*..

468. spacer 3.9|134444|32|NC_016110|CRISPRCasFinder,CRT matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719

accgccccgccggtccccggacagctcggcat	CRISPR spacer
cacctcgcgcgggtccccgggcagctcggccg	Protospacer
  * .* *** *********.*********  

469. spacer 3.9|134444|32|NC_016110|CRISPRCasFinder,CRT matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 9, identity: 0.719

accgccccgccggtccccggacagctcggcat	CRISPR spacer
accgcccggccggtccccggccaccctctccc	Protospacer
******* ************ ** *..  * .

470. spacer 3.9|134444|32|NC_016110|CRISPRCasFinder,CRT matches to NZ_CP007797 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence) position: , mismatch: 9, identity: 0.719

accgccccgccggtccccggacagctcggcat	CRISPR spacer
accgcccggccggtccccggccaccctctccc	Protospacer
******* ************ ** *..  * .

471. spacer 3.10|134505|32|NC_016110|CRISPRCasFinder,CRT matches to NZ_CP050953 (Rhodococcus sp. DMU1 plasmid unnamed) position: , mismatch: 9, identity: 0.719

tccttgaagtccacgccgtgccggtcggaggg	CRISPR spacer
aacgtgaagtccacgccgggcaggtcgtcgtt	Protospacer
  * ************** ** *****  *  

472. spacer 4.3|144425|32|NC_016110|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 9, identity: 0.719

tgccgaccgacgcctggtcggccggttcgctc	CRISPR spacer
agccgaccgacgccggttcggccgtcggggcc	Protospacer
 ************* * ******* .  * .*

473. spacer 4.3|144425|32|NC_016110|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 9, identity: 0.719

tgccgaccgacgcctggtcggccggttcgctc	CRISPR spacer
agccgaccgacgccggttcggccgtcggggcc	Protospacer
 ************* * ******* .  * .*

474. spacer 4.10|144852|32|NC_016110|CRISPRCasFinder,CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tccgaccacgccgaaacgcaggtcc-----ccggcgg	CRISPR spacer
atcgcccacgccgaagcgcaggtccgagtgcc-----	Protospacer
 .** **********.*********     **     

475. spacer 4.10|144852|32|NC_016110|CRISPRCasFinder,CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tccgaccacgccgaaacgcaggtcc-----ccggcgg	CRISPR spacer
atcgcccacgccgaagcgcaggtccgagtgcc-----	Protospacer
 .** **********.*********     **     

476. spacer 4.10|144852|32|NC_016110|CRISPRCasFinder,CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tccgaccacgccgaaacgcaggtcc-----ccggcgg	CRISPR spacer
atcgcccacgccgaagcgcaggtccgagtgcc-----	Protospacer
 .** **********.*********     **     

477. spacer 4.10|144852|32|NC_016110|CRISPRCasFinder,CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tccgaccacgccgaaacgcaggtcc-----ccggcgg	CRISPR spacer
atcgcccacgccgaagcgcaggtccgagtgcc-----	Protospacer
 .** **********.*********     **     

478. spacer 4.10|144852|32|NC_016110|CRISPRCasFinder,CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tccgaccacgccgaaacgcaggtcc-----ccggcgg	CRISPR spacer
atcgcccacgccgaagcgcaggtccgagtgcc-----	Protospacer
 .** **********.*********     **     

479. spacer 4.10|144852|32|NC_016110|CRISPRCasFinder,CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tccgaccacgccgaaacgcaggtcc-----ccggcgg	CRISPR spacer
atcgcccacgccgaagcgcaggtccgagtgcc-----	Protospacer
 .** **********.*********     **     

480. spacer 4.10|144852|32|NC_016110|CRISPRCasFinder,CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tccgaccacgccgaaacgcaggtcc-----ccggcgg	CRISPR spacer
atcgcccacgccgaagcgcaggtccgagtgcc-----	Protospacer
 .** **********.*********     **     

481. spacer 4.10|144852|32|NC_016110|CRISPRCasFinder,CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tccgaccacgccgaaacgcaggtcc-----ccggcgg	CRISPR spacer
atcgcccacgccgaagcgcaggtccgagtgcc-----	Protospacer
 .** **********.*********     **     

482. spacer 4.10|144852|32|NC_016110|CRISPRCasFinder,CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tccgaccacgccgaaacgcaggtcc-----ccggcgg	CRISPR spacer
atcgcccacgccgaagcgcaggtccgagtgcc-----	Protospacer
 .** **********.*********     **     

483. spacer 4.10|144852|32|NC_016110|CRISPRCasFinder,CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tccgaccacgccgaaacgcaggtcc-----ccggcgg	CRISPR spacer
atcgcccacgccgaagcgcaggtccgagtgcc-----	Protospacer
 .** **********.*********     **     

484. spacer 4.10|144852|32|NC_016110|CRISPRCasFinder,CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tccgaccacgccgaaacgcaggtcc-----ccggcgg	CRISPR spacer
atcgcccacgccgaagcgcaggtccgagtgcc-----	Protospacer
 .** **********.*********     **     

485. spacer 4.10|144852|32|NC_016110|CRISPRCasFinder,CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tccgaccacgccgaaacgcaggtcc-----ccggcgg	CRISPR spacer
atcgcccacgccgaagcgcaggtccgagtgcc-----	Protospacer
 .** **********.*********     **     

486. spacer 4.10|144852|32|NC_016110|CRISPRCasFinder,CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tccgaccacgccgaaacgcaggtcc-----ccggcgg	CRISPR spacer
atcgcccacgccgaagcgcaggtccgagtgcc-----	Protospacer
 .** **********.*********     **     

487. spacer 4.10|144852|32|NC_016110|CRISPRCasFinder,CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tccgaccacgccgaaacgcaggtcc-----ccggcgg	CRISPR spacer
atcgcccacgccgaagcgcaggtccgagtgcc-----	Protospacer
 .** **********.*********     **     

488. spacer 4.10|144852|32|NC_016110|CRISPRCasFinder,CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tccgaccacgccgaaacgcaggtcc-----ccggcgg	CRISPR spacer
atcgcccacgccgaagcgcaggtccgagtgcc-----	Protospacer
 .** **********.*********     **     

489. spacer 4.10|144852|32|NC_016110|CRISPRCasFinder,CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tccgaccacgccgaaacgcaggtcc-----ccggcgg	CRISPR spacer
atcgcccacgccgaagcgcaggtccgagtgcc-----	Protospacer
 .** **********.*********     **     

490. spacer 4.10|144852|32|NC_016110|CRISPRCasFinder,CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tccgaccacgccgaaacgcaggtcc-----ccggcgg	CRISPR spacer
atcgcccacgccgaagcgcaggtccgagtgcc-----	Protospacer
 .** **********.*********     **     

491. spacer 4.10|144852|32|NC_016110|CRISPRCasFinder,CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tccgaccacgccgaaacgcaggtcc-----ccggcgg	CRISPR spacer
atcgcccacgccgaagcgcaggtccgagtgcc-----	Protospacer
 .** **********.*********     **     

492. spacer 4.10|144852|32|NC_016110|CRISPRCasFinder,CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tccgaccacgccgaaacgcaggtcc-----ccggcgg	CRISPR spacer
atcgcccacgccgaagcgcaggtccgagtgcc-----	Protospacer
 .** **********.*********     **     

493. spacer 4.10|144852|32|NC_016110|CRISPRCasFinder,CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tccgaccacgccgaaacgcaggtcc-----ccggcgg	CRISPR spacer
atcgcccacgccgaagcgcaggtccgagtgcc-----	Protospacer
 .** **********.*********     **     

494. spacer 4.10|144852|32|NC_016110|CRISPRCasFinder,CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tccgaccacgccgaaacgcaggtcc-----ccggcgg	CRISPR spacer
atcgcccacgccgaagcgcaggtccgagtgcc-----	Protospacer
 .** **********.*********     **     

495. spacer 4.10|144852|32|NC_016110|CRISPRCasFinder,CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tccgaccacgccgaaacgcaggtcc-----ccggcgg	CRISPR spacer
atcgcccacgccgaagcgcaggtccgagtgcc-----	Protospacer
 .** **********.*********     **     

496. spacer 4.10|144852|32|NC_016110|CRISPRCasFinder,CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tccgaccacgccgaaacgcaggtcc-----ccggcgg	CRISPR spacer
atcgcccacgccgaagcgcaggtccgagtgcc-----	Protospacer
 .** **********.*********     **     

497. spacer 4.10|144852|32|NC_016110|CRISPRCasFinder,CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tccgaccacgccgaaacgcaggtcc-----ccggcgg	CRISPR spacer
atcgcccacgccgaagcgcaggtccgagtgcc-----	Protospacer
 .** **********.*********     **     

498. spacer 4.12|144974|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tccgaccacgccgaaacgcaggtcc-----ccggcgg	CRISPR spacer
atcgcccacgccgaagcgcaggtccgagtgcc-----	Protospacer
 .** **********.*********     **     

499. spacer 4.12|144974|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tccgaccacgccgaaacgcaggtcc-----ccggcgg	CRISPR spacer
atcgcccacgccgaagcgcaggtccgagtgcc-----	Protospacer
 .** **********.*********     **     

500. spacer 4.12|144974|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tccgaccacgccgaaacgcaggtcc-----ccggcgg	CRISPR spacer
atcgcccacgccgaagcgcaggtccgagtgcc-----	Protospacer
 .** **********.*********     **     

501. spacer 4.12|144974|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tccgaccacgccgaaacgcaggtcc-----ccggcgg	CRISPR spacer
atcgcccacgccgaagcgcaggtccgagtgcc-----	Protospacer
 .** **********.*********     **     

502. spacer 4.12|144974|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tccgaccacgccgaaacgcaggtcc-----ccggcgg	CRISPR spacer
atcgcccacgccgaagcgcaggtccgagtgcc-----	Protospacer
 .** **********.*********     **     

503. spacer 4.12|144974|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tccgaccacgccgaaacgcaggtcc-----ccggcgg	CRISPR spacer
atcgcccacgccgaagcgcaggtccgagtgcc-----	Protospacer
 .** **********.*********     **     

504. spacer 4.12|144974|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tccgaccacgccgaaacgcaggtcc-----ccggcgg	CRISPR spacer
atcgcccacgccgaagcgcaggtccgagtgcc-----	Protospacer
 .** **********.*********     **     

505. spacer 4.12|144974|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tccgaccacgccgaaacgcaggtcc-----ccggcgg	CRISPR spacer
atcgcccacgccgaagcgcaggtccgagtgcc-----	Protospacer
 .** **********.*********     **     

506. spacer 4.12|144974|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tccgaccacgccgaaacgcaggtcc-----ccggcgg	CRISPR spacer
atcgcccacgccgaagcgcaggtccgagtgcc-----	Protospacer
 .** **********.*********     **     

507. spacer 4.12|144974|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tccgaccacgccgaaacgcaggtcc-----ccggcgg	CRISPR spacer
atcgcccacgccgaagcgcaggtccgagtgcc-----	Protospacer
 .** **********.*********     **     

508. spacer 4.12|144974|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tccgaccacgccgaaacgcaggtcc-----ccggcgg	CRISPR spacer
atcgcccacgccgaagcgcaggtccgagtgcc-----	Protospacer
 .** **********.*********     **     

509. spacer 4.12|144974|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tccgaccacgccgaaacgcaggtcc-----ccggcgg	CRISPR spacer
atcgcccacgccgaagcgcaggtccgagtgcc-----	Protospacer
 .** **********.*********     **     

510. spacer 4.12|144974|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tccgaccacgccgaaacgcaggtcc-----ccggcgg	CRISPR spacer
atcgcccacgccgaagcgcaggtccgagtgcc-----	Protospacer
 .** **********.*********     **     

511. spacer 4.12|144974|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tccgaccacgccgaaacgcaggtcc-----ccggcgg	CRISPR spacer
atcgcccacgccgaagcgcaggtccgagtgcc-----	Protospacer
 .** **********.*********     **     

512. spacer 4.12|144974|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tccgaccacgccgaaacgcaggtcc-----ccggcgg	CRISPR spacer
atcgcccacgccgaagcgcaggtccgagtgcc-----	Protospacer
 .** **********.*********     **     

513. spacer 4.12|144974|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tccgaccacgccgaaacgcaggtcc-----ccggcgg	CRISPR spacer
atcgcccacgccgaagcgcaggtccgagtgcc-----	Protospacer
 .** **********.*********     **     

514. spacer 4.12|144974|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tccgaccacgccgaaacgcaggtcc-----ccggcgg	CRISPR spacer
atcgcccacgccgaagcgcaggtccgagtgcc-----	Protospacer
 .** **********.*********     **     

515. spacer 4.12|144974|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tccgaccacgccgaaacgcaggtcc-----ccggcgg	CRISPR spacer
atcgcccacgccgaagcgcaggtccgagtgcc-----	Protospacer
 .** **********.*********     **     

516. spacer 4.12|144974|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tccgaccacgccgaaacgcaggtcc-----ccggcgg	CRISPR spacer
atcgcccacgccgaagcgcaggtccgagtgcc-----	Protospacer
 .** **********.*********     **     

517. spacer 4.12|144974|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tccgaccacgccgaaacgcaggtcc-----ccggcgg	CRISPR spacer
atcgcccacgccgaagcgcaggtccgagtgcc-----	Protospacer
 .** **********.*********     **     

518. spacer 4.12|144974|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tccgaccacgccgaaacgcaggtcc-----ccggcgg	CRISPR spacer
atcgcccacgccgaagcgcaggtccgagtgcc-----	Protospacer
 .** **********.*********     **     

519. spacer 4.12|144974|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tccgaccacgccgaaacgcaggtcc-----ccggcgg	CRISPR spacer
atcgcccacgccgaagcgcaggtccgagtgcc-----	Protospacer
 .** **********.*********     **     

520. spacer 4.12|144974|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tccgaccacgccgaaacgcaggtcc-----ccggcgg	CRISPR spacer
atcgcccacgccgaagcgcaggtccgagtgcc-----	Protospacer
 .** **********.*********     **     

521. spacer 4.12|144974|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tccgaccacgccgaaacgcaggtcc-----ccggcgg	CRISPR spacer
atcgcccacgccgaagcgcaggtccgagtgcc-----	Protospacer
 .** **********.*********     **     

522. spacer 4.14|145097|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014769 (Hymenobacter sp. PAMC 26554 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

agcttggcgtaggtgccttcgccgggtccgac	CRISPR spacer
agctgggcgtaggtgccttcggcgtagttgcg	Protospacer
**** **************** ** . ..*  

523. spacer 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134451 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence) position: , mismatch: 9, identity: 0.719

accgccgcgaacatgaccagctgcccgatgat	CRISPR spacer
ctcaccgcgaacatgacgatctgcccgccggc	Protospacer
 .*.************* * ******* .*..

524. spacer 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NC_008826 (Methylibium petroleiphilum PM1 plasmid RPME01, complete sequence) position: , mismatch: 9, identity: 0.719

accgccgcgaacatgaccagctgcccgatgat	CRISPR spacer
agcatcgcgaagatgtccagctgcccgagcgg	Protospacer
* *..****** *** ************  . 

525. spacer 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to KU985096 (Mycobacterium phage Kazan, complete genome) position: , mismatch: 9, identity: 0.719

accgccgcgaacatgaccagctgcccgatgat	CRISPR spacer
gtcctgccgaacatgaccagctcgccgatggt	Protospacer
..* .  ***************  ******.*

526. spacer 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to MH051254 (Mycobacterium phage Jabiru, complete genome) position: , mismatch: 9, identity: 0.719

accgccgcgaacatgaccagctgcccgatgat	CRISPR spacer
gtcctgccgaacatgaccaactccccgatggt	Protospacer
..* .  ************.** *******.*

527. spacer 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NC_028802 (Mycobacterium phage UnionJack, complete genome) position: , mismatch: 9, identity: 0.719

accgccgcgaacatgaccagctgcccgatgat	CRISPR spacer
gtcctgccgaacatgaccaactccccgatggt	Protospacer
..* .  ************.** *******.*

528. spacer 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NC_008203 (Mycobacterium phage Che12, complete genome) position: , mismatch: 9, identity: 0.719

accgccgcgaacatgaccagctgcccgatgat	CRISPR spacer
gtcctgccgaacatgaccagctcaccgatggt	Protospacer
..* .  ***************  ******.*

529. spacer 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to MG099947 (Mycobacterium phage Ph8s, complete genome) position: , mismatch: 9, identity: 0.719

accgccgcgaacatgaccagctgcccgatgat	CRISPR spacer
gtcctgccgaacatgaccagctcaccgatggt	Protospacer
..* .  ***************  ******.*

530. spacer 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NC_022087 (Mycobacterium phage AnnaL29, complete genome) position: , mismatch: 9, identity: 0.719

accgccgcgaacatgaccagctgcccgatgat	CRISPR spacer
gtcctgccgaacatgaccaactccccgatggt	Protospacer
..* .  ************.** *******.*

531. spacer 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to MT310878 (Mycobacterium phage MK4, complete genome) position: , mismatch: 9, identity: 0.719

accgccgcgaacatgaccagctgcccgatgat	CRISPR spacer
gtcctgccgaacatgaccagctcaccgatggt	Protospacer
..* .  ***************  ******.*

532. spacer 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to MK359352 (Mycobacterium phage JewelBug, complete genome) position: , mismatch: 9, identity: 0.719

accgccgcgaacatgaccagctgcccgatgat	CRISPR spacer
gtcctgccgaacatgaccagctcgccgatggt	Protospacer
..* .  ***************  ******.*

533. spacer 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to MN585989 (Mycobacterium phage Superchunk, complete genome) position: , mismatch: 9, identity: 0.719

accgccgcgaacatgaccagctgcccgatgat	CRISPR spacer
gtcctgccgaacatgaccagctcgccgatggt	Protospacer
..* .  ***************  ******.*

534. spacer 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to KX641260 (Mycobacterium phage Stasia, complete genome) position: , mismatch: 9, identity: 0.719

accgccgcgaacatgaccagctgcccgatgat	CRISPR spacer
gtcatgccgaacatgaccaactccccgatggt	Protospacer
..*..  ************.** *******.*

535. spacer 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to MN234188 (Mycobacterium phage Anthony, complete genome) position: , mismatch: 9, identity: 0.719

accgccgcgaacatgaccagctgcccgatgat	CRISPR spacer
gtcatgccgaacatgaccaactccccgatggt	Protospacer
..*..  ************.** *******.*

536. spacer 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NC_022058 (Mycobacterium phage Adzzy, complete genome) position: , mismatch: 9, identity: 0.719

accgccgcgaacatgaccagctgcccgatgat	CRISPR spacer
gtcctgccgaacatgaccagctcaccgatggt	Protospacer
..* .  ***************  ******.*

537. spacer 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to KU695582 (Mycobacterium phage McFly, complete genome) position: , mismatch: 9, identity: 0.719

accgccgcgaacatgaccagctgcccgatgat	CRISPR spacer
gtcctgccgaacatgaccagctcgccgatggt	Protospacer
..* .  ***************  ******.*

538. spacer 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to KF017927 (Mycobacterium phage Odin, complete genome) position: , mismatch: 9, identity: 0.719

accgccgcgaacatgaccagctgcccgatgat	CRISPR spacer
gtcctgccgaacatgaccagctcgccgatggt	Protospacer
..* .  ***************  ******.*

539. spacer 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NC_042036 (Mycobacterium phage Rockstar, complete genome) position: , mismatch: 9, identity: 0.719

accgccgcgaacatgaccagctgcccgatgat	CRISPR spacer
gtcctgccgaacatgaccagctcaccgatggt	Protospacer
..* .  ***************  ******.*

540. spacer 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to MN586063 (Mycobacterium phage Isca, complete genome) position: , mismatch: 9, identity: 0.719

accgccgcgaacatgaccagctgcccgatgat	CRISPR spacer
gtcctgccgaacatgaccagctcaccgatggt	Protospacer
..* .  ***************  ******.*

541. spacer 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to DQ398043 (Mycobacterium virus Che12, complete genome) position: , mismatch: 9, identity: 0.719

accgccgcgaacatgaccagctgcccgatgat	CRISPR spacer
gtcctgccgaacatgaccagctcaccgatggt	Protospacer
..* .  ***************  ******.*

542. spacer 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NC_023597 (Mycobacterium phage 20ES, complete genome) position: , mismatch: 9, identity: 0.719

accgccgcgaacatgaccagctgcccgatgat	CRISPR spacer
gtcctgccgaacatgaccagctcaccgatggt	Protospacer
..* .  ***************  ******.*

543. spacer 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to KU761558 (Mycobacterium phage Loser, complete genome) position: , mismatch: 9, identity: 0.719

accgccgcgaacatgaccagctgcccgatgat	CRISPR spacer
gtcctgccgaacatgaccaactccccgatggt	Protospacer
..* .  ************.** *******.*

544. spacer 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to JF937092 (Mycobacterium phage DaVinci, complete genome) position: , mismatch: 9, identity: 0.719

accgccgcgaacatgaccagctgcccgatgat	CRISPR spacer
gtcctgccgaacatgaccagctcgccgatggt	Protospacer
..* .  ***************  ******.*

545. spacer 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to GU339467 (Mycobacterium phage RedRock, complete genome) position: , mismatch: 9, identity: 0.719

accgccgcgaacatgaccagctgcccgatgat	CRISPR spacer
gtcctgccgaacatgaccaactccccgatggt	Protospacer
..* .  ************.** *******.*

546. spacer 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NC_023564 (Mycobacterium phage EagleEye, complete genome) position: , mismatch: 9, identity: 0.719

accgccgcgaacatgaccagctgcccgatgat	CRISPR spacer
gtcctgccgaacatgaccaactccccgatggt	Protospacer
..* .  ************.** *******.*

547. spacer 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to KC172839 (Mycobacterium phage BTCU-1, complete genome) position: , mismatch: 9, identity: 0.719

accgccgcgaacatgaccagctgcccgatgat	CRISPR spacer
gtcctgccgaacatgaccagctcaccgatggt	Protospacer
..* .  ***************  ******.*

548. spacer 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to MK894433 (Mycobacterium phage Kipper29, complete genome) position: , mismatch: 9, identity: 0.719

accgccgcgaacatgaccagctgcccgatgat	CRISPR spacer
gtcctgccgaacatgaccagctcgccgatggt	Protospacer
..* .  ***************  ******.*

549. spacer 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to KJ510415 (Mycobacterium phage Phantastic, complete genome) position: , mismatch: 9, identity: 0.719

accgccgcgaacatgaccagctgcccgatgat	CRISPR spacer
gtcctgccgaacatgaccaactccccgatggt	Protospacer
..* .  ************.** *******.*

550. spacer 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to JN049605 (Mycobacterium virus EricB, complete genome) position: , mismatch: 9, identity: 0.719

accgccgcgaacatgaccagctgcccgatgat	CRISPR spacer
gtcctgccgaacatgaccagctcgccgatggt	Protospacer
..* .  ***************  ******.*

551. spacer 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to MN224566 (Mycobacterium phage Herbertwm, complete genome) position: , mismatch: 9, identity: 0.719

accgccgcgaacatgaccagctgcccgatgat	CRISPR spacer
gtcctgccgaacatgaccagctcaccgatggt	Protospacer
..* .  ***************  ******.*

552. spacer 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NC_029077 (Mycobacterium phage VohminGhazi, complete genome) position: , mismatch: 9, identity: 0.719

accgccgcgaacatgaccagctgcccgatgat	CRISPR spacer
gtcctgccgaacatgaccagctcgccgatggt	Protospacer
..* .  ***************  ******.*

553. spacer 4.16|145219|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025114 (Bradyrhizobium sp. SK17 strain CBNU plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tacaacacccgaggactgatccaggtcaagaa	CRISPR spacer
cgcgacacccgaggactgatcaagctcgtggc	Protospacer
..*.***************** ** **. *. 

554. spacer 4.16|145219|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025114 (Bradyrhizobium sp. SK17 strain CBNU plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tacaacacccgaggactgatccaggtcaagaa	CRISPR spacer
cgcgacacccgaggactgatcaagctcgtggc	Protospacer
..*.***************** ** **. *. 

555. spacer 4.17|145280|32|NC_016110|CRISPRCasFinder,CRT matches to NZ_LR134460 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 18, complete sequence) position: , mismatch: 9, identity: 0.719

gacggagcgatcggccggtaccggttgaaggg	CRISPR spacer
gacggagtgatcgtccggtaccgcgccctggt	Protospacer
*******.***** *********  .   ** 

556. spacer 1.6|44999|31|NC_016110|CRISPRCasFinder matches to NZ_CP041045 (Paracoccus sp. AK26 plasmid pAK1, complete sequence) position: , mismatch: 10, identity: 0.677

cgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
gcgggatcgacgccctggtcttcaccgccgg	Protospacer
     .***.**********.********  

557. spacer 1.17|44998|32|NC_016110|PILER-CR matches to NZ_CP041045 (Paracoccus sp. AK26 plasmid pAK1, complete sequence) position: , mismatch: 10, identity: 0.688

gcgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
ggcgggatcgacgccctggtcttcaccgccgg	Protospacer
*     .***.**********.********  

558. spacer 1.17|44998|32|NC_016110|PILER-CR matches to MK967377 (Gordonia phage MagicMan, complete genome) position: , mismatch: 10, identity: 0.688

gcgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
aaccccggcggcgccctggtgctcaccgacta	Protospacer
.  ..** ************ ******* *. 

559. spacer 1.17|44998|32|NC_016110|PILER-CR matches to MN813694 (Gordonia phage Opie, complete genome) position: , mismatch: 10, identity: 0.688

gcgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
aaccccggcggcgccctggttctcaccgacta	Protospacer
.  ..** ************.******* *. 

560. spacer 1.17|44998|32|NC_016110|PILER-CR matches to NC_031255 (Gordonia phage Schwabeltier, complete genome) position: , mismatch: 10, identity: 0.688

gcgttcgtcggcgccctggtcctcaccgcccc	CRISPR spacer
aaccccggcggcgccctggtgctcaccgacta	Protospacer
.  ..** ************ ******* *. 

561. spacer 2.7|52510|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to MN018232 (Synechococcus phage S-B43, complete genome) position: , mismatch: 10, identity: 0.688

acccggaacgtctcatcgaacgatgctgcgat	CRISPR spacer
tcgacaaaggtcttatcgaacgatgctgctgc	Protospacer
 *   .** ****.*************** ..

562. spacer 2.7|52510|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to MH920638 (Synechoccus phage S-B05, partial genome) position: , mismatch: 10, identity: 0.688

acccggaacgtctcatcgaacgatgctgcgat	CRISPR spacer
tcgacaaaggtcttatcgaacgatgctgctgc	Protospacer
 *   .** ****.*************** ..

563. spacer 2.7|52510|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to MK799832 (Synechococcus phage S-B05, complete genome) position: , mismatch: 10, identity: 0.688

acccggaacgtctcatcgaacgatgctgcgat	CRISPR spacer
tcgacaaaggtcttatcgaacgatgctgctgc	Protospacer
 *   .** ****.*************** ..

564. spacer 2.9|52632|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NC_010905 (Amycolatopsis benzoatilytica strain DSM 43387 plasmid pA387, complete sequence) position: , mismatch: 10, identity: 0.688

cgctcgacgacgatgccgagttcggtgttgga	CRISPR spacer
gcaccgacgacgatgcggcgttcggtgtccag	Protospacer
   .************ * *********. ..

565. spacer 2.9|52632|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050096 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b3, complete sequence) position: , mismatch: 10, identity: 0.688

cgctcgacgacgatgccgagttcggtgttgga---	CRISPR spacer
agctcgacgacaatgccgagctc---gccaaattc	Protospacer
 **********.********.**   *....*   

566. spacer 2.9|52632|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017077 (Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence) position: , mismatch: 10, identity: 0.688

cgctcgacgacgatgccgagttcggtgttgga	CRISPR spacer
gtctcgacgacgatgccctgttcggaaaacgg	Protospacer
  ***************  ****** .   *.

567. spacer 2.9|52632|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050102 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b2, complete sequence) position: , mismatch: 10, identity: 0.688

cgctcgacgacgatgccgagttcggtgttgga---	CRISPR spacer
agctcgacgacaatgccgagctc---gccaaattc	Protospacer
 **********.********.**   *....*   

568. spacer 2.9|52632|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050107 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b1, complete sequence) position: , mismatch: 10, identity: 0.688

cgctcgacgacgatgccgagttcggtgttgga---	CRISPR spacer
agctcgacgacaatgccgagctc---gccaaattc	Protospacer
 **********.********.**   *....*   

569. spacer 2.9|52632|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023150 (Mycobacterium intracellulare strain FLAC0181 plasmid pFLAC0181, complete sequence) position: , mismatch: 10, identity: 0.688

cgctcgacgacgatgccgagttcggtgttgga	CRISPR spacer
gctccgatgacgatgccgagttcgttgaggag	Protospacer
  ..***.**************** **  *..

570. spacer 2.9|52632|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP040254 (Mycobacterium avium subsp. hominissuis strain 101115 plasmid pFLAC0181_CHOP101, complete sequence) position: , mismatch: 10, identity: 0.688

cgctcgacgacgatgccgagttcggtgttgga	CRISPR spacer
gctccgatgacgatgccgagttcgttgaggag	Protospacer
  ..***.**************** **  *..

571. spacer 2.9|52632|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053444 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eB, complete sequence) position: , mismatch: 10, identity: 0.688

cgctcgacgacgatgccgagttcggtgttgga---	CRISPR spacer
agctcgacgacaatgccgagctc---gccaaattc	Protospacer
 **********.********.**   *....*   

572. spacer 2.9|52632|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

cgctcgacgacgatgccgagttcggtgttgga	CRISPR spacer
actgtgccgacgatgccgggttcggtggtgct	Protospacer
  . .* ***********.******** **  

573. spacer 2.9|52632|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 10, identity: 0.688

cgctcgacgacgatgccgagttcggtgttgga	CRISPR spacer
acatcgacgacgatgccgcgatcggtcatccg	Protospacer
   *************** * *****  *  .

574. spacer 2.9|52632|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP040246 (Mycobacterium avium subsp. hominissuis strain 101034 plasmid pFLAC0181_CHOP1, complete sequence) position: , mismatch: 10, identity: 0.688

cgctcgacgacgatgccgagttcggtgttgga	CRISPR spacer
gctccgatgacgatgccgagttcgttgaggag	Protospacer
  ..***.**************** **  *..

575. spacer 2.9|52632|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP040248 (Mycobacterium avium subsp. hominissuis strain 101174 plasmid pFLAC0181_CHOP101, complete sequence) position: , mismatch: 10, identity: 0.688

cgctcgacgacgatgccgagttcggtgttgga	CRISPR spacer
gctccgatgacgatgccgagttcgttgaggag	Protospacer
  ..***.**************** **  *..

576. spacer 2.9|52632|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050112 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b5, complete sequence) position: , mismatch: 10, identity: 0.688

cgctcgacgacgatgccgagttcggtgttgga---	CRISPR spacer
agctcgacgacaatgccgagctc---gccaaattc	Protospacer
 **********.********.**   *....*   

577. spacer 2.9|52632|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021355 (Rhodococcus sp. S2-17 plasmid pRB98, complete sequence) position: , mismatch: 10, identity: 0.688

cgctcgacgacgatgccgagttcg---gtgttgga	CRISPR spacer
cgctcgacgacgaggccgaggtcatgcgcacc---	Protospacer
************* ****** **.   *....   

578. spacer 2.9|52632|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 10, identity: 0.688

cgctcgacgacgatgccgagttcggtgttgga	CRISPR spacer
acatcgacgacgatgccgcgatcggtcatccg	Protospacer
   *************** * *****  *  .

579. spacer 2.9|52632|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 10, identity: 0.688

cgctcgacgacgatgccgagttcggtgttgga	CRISPR spacer
gacagcgcgacgaagccgagttcggcgttgcc	Protospacer
 .*   .****** ***********.****  

580. spacer 2.9|52632|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012918 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p4, complete sequence) position: , mismatch: 10, identity: 0.688

cgctcgacgacgatgccgagttcggtgttgga	CRISPR spacer
cgttcgacgacgatgccgaggtccccagtccc	Protospacer
**.***************** **  .. *   

581. spacer 2.9|52632|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to MK937607 (Gordonia phage Zipp, complete genome) position: , mismatch: 10, identity: 0.688

cgctcgacgacgatgccgagttcggtgttgga	CRISPR spacer
tgctcggcgacgatgtcgagttcgccggcaat	Protospacer
.*****.********.******** .* ... 

582. spacer 2.12|52815|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 10, identity: 0.688

gggagctgcgcaacgacttcgacgatgcgctt	CRISPR spacer
acgagctgcgcaacgactacgccgaggactcg	Protospacer
. **************** ** *** *  .. 

583. spacer 2.12|52815|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP014580 (Burkholderia sp. RPE67 plasmid p2, complete sequence) position: , mismatch: 10, identity: 0.688

-----gggagctgcgcaacgacttcgacgatgcgctt	CRISPR spacer
tccttg-----cgcgccacgacttcgaccatgcgcgc	Protospacer
     *     .**** *********** ****** .

584. spacer 2.12|52815|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP014803 (Rhodovulum sulfidophilum plasmid Plasmid3 DNA, complete genome, strain: DSM 2351) position: , mismatch: 10, identity: 0.688

gggagctgcgcaacgacttcgacgatgcgctt	CRISPR spacer
tcgagctgcgcaacgtcttccacgaggacggg	Protospacer
  ************* **** **** *     

585. spacer 2.12|52815|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020386 (Rhodovulum sp. MB263 plasmid pRSMBB, complete sequence) position: , mismatch: 10, identity: 0.688

gggagctgcgcaacgacttcgacgatgcgctt	CRISPR spacer
tcgagctgcgcaacgtcttccacgaggacggc	Protospacer
  ************* **** **** *    .

586. spacer 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 10, identity: 0.688

gtcgcggtgtcggtggcggtggacttccgggt	CRISPR spacer
gtcgcggtgtcgtcggcggtggagccggtgaa	Protospacer
************ .********* ..   *. 

587. spacer 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 10, identity: 0.688

gtcgcggtgtcggtggcggtggacttccgggt	CRISPR spacer
tccgcgatgtcggtggcgatggactcgtcgtc	Protospacer
 .****.***********.******. . * .

588. spacer 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 10, identity: 0.688

gtcgcggtgtcggtggcggtggacttccgggt	CRISPR spacer
cggatggtgtcgctggtggtggacttcctgaa	Protospacer
   ..******* ***.*********** *. 

589. spacer 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT matches to NC_022090 (Staphylococcus phage vB_SauM_Remus, complete genome) position: , mismatch: 10, identity: 0.688

gtcgcggtgtcggtggcggtggacttccgggt	CRISPR spacer
gtggcggtggcggtggcggtggagctatacca	Protospacer
** ****** ************* .* ..   

590. spacer 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT matches to MT080595 (UNVERIFIED: Staphylococcus phage vB_SauM_EW41, partial genome) position: , mismatch: 10, identity: 0.688

gtcgcggtgtcggtggcggtggacttccgggt	CRISPR spacer
gtggcggtggcggtggcggtggagctatacca	Protospacer
** ****** ************* .* ..   

591. spacer 3.2|134017|32|NC_016110|CRISPRCasFinder,CRT matches to NC_020877 (Staphylococcus phage vB_SauM_Romulus, complete genome) position: , mismatch: 10, identity: 0.688

gtcgcggtgtcggtggcggtggacttccgggt	CRISPR spacer
gtggcggtggcggtggcggtggagctatacca	Protospacer
** ****** ************* .* ..   

592. spacer 3.4|134139|32|NC_016110|CRISPRCasFinder,CRT matches to NZ_CP009572 (Sphingomonas taxi strain ATCC 55669 plasmid STP1, complete sequence) position: , mismatch: 10, identity: 0.688

aagggagggccggcggttgcacgcacgatggc	CRISPR spacer
gcgcagcggccggcggtggcacgcgcgatgta	Protospacer
. * .. ********** ******.*****  

593. spacer 3.10|134505|32|NC_016110|CRISPRCasFinder,CRT matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 10, identity: 0.688

tccttgaagtccacgccgtgccggtcggaggg	CRISPR spacer
aaggtgaagtccacgccgggcaggtcgtcgtt	Protospacer
    ************** ** *****  *  

594. spacer 3.10|134505|32|NC_016110|CRISPRCasFinder,CRT matches to NZ_CP032676 (Rhodococcus rhodochrous strain ATCC BAA870 plasmid pNit, complete sequence) position: , mismatch: 10, identity: 0.688

tccttgaagtccacgccgtgccggtcggaggg	CRISPR spacer
aaggtgaagtccacgccgggcaggtcgtcgtt	Protospacer
    ************** ** *****  *  

595. spacer 3.10|134505|32|NC_016110|CRISPRCasFinder,CRT matches to CP003954 (Rhodococcus opacus PD630 plasmid 5, complete sequence) position: , mismatch: 10, identity: 0.688

tccttgaagtccacgccgtgccggtcggaggg	CRISPR spacer
aaggtgaagtccacgccgggcaggtcgtcgtt	Protospacer
    ************** ** *****  *  

596. spacer 4.3|144425|32|NC_016110|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 10, identity: 0.688

tgccgaccgacgcctggtcggccggttcgctc	CRISPR spacer
cgccggccgactcctggtcggccgccaccggg	Protospacer
.****.***** ************ . *    

597. spacer 4.8|144730|32|NC_016110|CRISPRCasFinder,CRT matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 10, identity: 0.688

ccgagcccgtcccggccgatccgtaggaatgc	CRISPR spacer
ccgagccggtccctgccgatccgcccgcgccg	Protospacer
******* ***** *********.  * ..  

598. spacer 4.8|144730|32|NC_016110|CRISPRCasFinder,CRT matches to NZ_CP025188 (Roseomonas mucosa strain AD2 plasmid p1-AD2, complete sequence) position: , mismatch: 10, identity: 0.688

ccgagcccgtcccggccgatccgtaggaatgc	CRISPR spacer
aggcgcccgtgccggccgatccgaaggcggcg	Protospacer
  * ****** ************ *** .   

599. spacer 4.14|145097|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NC_008713 (Paenarthrobacter aurescens TC1 plasmid pTC2, complete sequence) position: , mismatch: 10, identity: 0.688

agcttggcgtaggtgccttcgccgggtccgac	CRISPR spacer
ccgcacgcgtcggcgccttcgccgggtcccgc	Protospacer
   .  **** **.*************** .*

600. spacer 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.688

accgccgcgaacatgaccagctgcccgatgat	CRISPR spacer
accgccgcgaacatggcccgctgctgtgcttc	Protospacer
***************.** *****.  ..  .

601. spacer 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 10, identity: 0.688

accgccgcgaacatgaccagctgcccgatgat	CRISPR spacer
accgccgcgaacatggcccgctgctgtgcttc	Protospacer
***************.** *****.  ..  .

602. spacer 4.15|145158|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 10, identity: 0.688

accgccgcgaacatgaccagctgcccgatgat	CRISPR spacer
accgccgcgaacatggcccgctgctgtgcttc	Protospacer
***************.** *****.  ..  .

603. spacer 4.17|145280|32|NC_016110|CRISPRCasFinder,CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 10, identity: 0.688

gacggagcgatcggccggtaccggttgaaggg	CRISPR spacer
tgcggagcgagcggccggtacgggtacgcccg	Protospacer
 .******** ********** ***  .   *

604. spacer 4.17|145280|32|NC_016110|CRISPRCasFinder,CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 10, identity: 0.688

gacggagcgatcggccggtaccggttgaaggg	CRISPR spacer
tgcggagcgagcggccggtacgggtacgcccg	Protospacer
 .******** ********** ***  .   *

605. spacer 4.17|145280|32|NC_016110|CRISPRCasFinder,CRT matches to NZ_CP024313 (Rhizobium sp. NXC24 plasmid pRspNXC24b, complete sequence) position: , mismatch: 10, identity: 0.688

gacggagcgatcggccggtaccggttgaaggg	CRISPR spacer
gcaacggcgctcggccggtaccagttgaaaca	Protospacer
*  . .*** ************.******. .

606. spacer 2.5|52382|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to LT599585 (Pseudomonas veronii 1YdBTEX2 genome assembly, plasmid: PVE_plasmid) position: , mismatch: 11, identity: 0.656

gagtggcgttttggcatgctgcgggccgtgac	CRISPR spacer
ccccaccgtttttgcaagctgcgggccgtcga	Protospacer
   .. ****** *** ************ . 

607. spacer 2.12|52815|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 11, identity: 0.656

gggagctgcgcaacgacttcgacgatgcgctt	CRISPR spacer
tcctttcgcgccacgacttcgactatgcgcgc	Protospacer
     ..**** *********** ****** .

608. spacer 3.6|134261|32|NC_016110|CRISPRCasFinder,CRT matches to CP053577 (Salmonella enterica strain 2012K-0845 plasmid unnamed2, complete sequence) position: , mismatch: 11, identity: 0.656

ttgacaacggacttccagcgcttcggatacgc	CRISPR spacer
catgaaaccgacttccagcgcgtcggattgct	Protospacer
.  . *** ************ ******   .

609. spacer 3.6|134261|32|NC_016110|CRISPRCasFinder,CRT matches to NZ_CP022661 (Salmonella enterica subsp. enterica strain RM11065 plasmid pRM11065-1, complete sequence) position: , mismatch: 11, identity: 0.656

ttgacaacggacttccagcgcttcggatacgc	CRISPR spacer
catgaaaccgacttccagcgcgtcggattgct	Protospacer
.  . *** ************ ******   .

610. spacer 3.6|134261|32|NC_016110|CRISPRCasFinder,CRT matches to NZ_CP032697 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525a, complete sequence) position: , mismatch: 11, identity: 0.656

ttgacaacggacttccagcgcttcggatacgc	CRISPR spacer
cggataacggacttccagcgtttcgaccggca	Protospacer
. **.***************.****. ..   

611. spacer 4.6|144608|32|NC_016110|CRISPRCasFinder,CRT matches to NC_019848 (Sinorhizobium meliloti GR4 plasmid pRmeGR4c, complete sequence) position: , mismatch: 11, identity: 0.656

tgcacgacctggtcgtgggacgtgacccggct	CRISPR spacer
gcggcggcctggtcgtgggccgtgaccgcctc	Protospacer
   .**.************ *******   ..

612. spacer 4.6|144608|32|NC_016110|CRISPRCasFinder,CRT matches to NC_003037 (Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence) position: , mismatch: 11, identity: 0.656

tgcacgacctggtcgtgggacgtgacccggct	CRISPR spacer
gcggcggcctggtcgtgggccgtgaccgcctc	Protospacer
   .**.************ *******   ..

613. spacer 4.6|144608|32|NC_016110|CRISPRCasFinder,CRT matches to NZ_CP019585 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence) position: , mismatch: 11, identity: 0.656

tgcacgacctggtcgtgggacgtgacccggct	CRISPR spacer
gcggcggcctggtcgtgggccgtgaccgcctc	Protospacer
   .**.************ *******   ..

614. spacer 4.6|144608|32|NC_016110|CRISPRCasFinder,CRT matches to NC_017327 (Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence) position: , mismatch: 11, identity: 0.656

tgcacgacctggtcgtgggacgtgacccggct	CRISPR spacer
gcggcggcctggtcgtgggccgtgaccgcctc	Protospacer
   .**.************ *******   ..

615. spacer 4.6|144608|32|NC_016110|CRISPRCasFinder,CRT matches to NZ_CP021798 (Sinorhizobium meliloti strain USDA1106 plasmid psymA, complete sequence) position: , mismatch: 11, identity: 0.656

tgcacgacctggtcgtgggacgtgacccggct	CRISPR spacer
gcggcggcctggtcgtgggccgtgaccgcctc	Protospacer
   .**.************ *******   ..

616. spacer 4.6|144608|32|NC_016110|CRISPRCasFinder,CRT matches to NC_017324 (Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence) position: , mismatch: 11, identity: 0.656

tgcacgacctggtcgtgggacgtgacccggct	CRISPR spacer
gcggcggcctggtcgtgggccgtgaccgcctc	Protospacer
   .**.************ *******   ..

617. spacer 4.6|144608|32|NC_016110|CRISPRCasFinder,CRT matches to NZ_CP021827 (Sinorhizobium meliloti strain KH35c plasmid psymA, complete sequence) position: , mismatch: 11, identity: 0.656

tgcacgacctggtcgtgggacgtgacccggct	CRISPR spacer
gcggcggcctggtcgtgggccgtgaccgcctc	Protospacer
   .**.************ *******   ..

618. spacer 4.6|144608|32|NC_016110|CRISPRCasFinder,CRT matches to NZ_CP021801 (Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence) position: , mismatch: 11, identity: 0.656

tgcacgacctggtcgtgggacgtgacccggct	CRISPR spacer
gcggcggcctggtcgtgggccgtgaccgcctc	Protospacer
   .**.************ *******   ..

619. spacer 4.6|144608|32|NC_016110|CRISPRCasFinder,CRT matches to NZ_CP021830 (Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence) position: , mismatch: 11, identity: 0.656

tgcacgacctggtcgtgggacgtgacccggct	CRISPR spacer
gcggcggcctggtcgtgggccgtgaccgcctc	Protospacer
   .**.************ *******   ..

620. spacer 4.6|144608|32|NC_016110|CRISPRCasFinder,CRT matches to NZ_CP021794 (Sinorhizobium meliloti strain USDA1157 plasmid psymA, complete sequence) position: , mismatch: 11, identity: 0.656

tgcacgacctggtcgtgggacgtgacccggct	CRISPR spacer
gcggcggcctggtcgtgggccgtgaccgcctc	Protospacer
   .**.************ *******   ..

621. spacer 4.6|144608|32|NC_016110|CRISPRCasFinder,CRT matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 11, identity: 0.656

tgcacgacctggtcgtgggacgtgacccggct	CRISPR spacer
gcggcggcctggtcgtgggccgtgaccgcctc	Protospacer
   .**.************ *******   ..

622. spacer 4.6|144608|32|NC_016110|CRISPRCasFinder,CRT matches to NZ_CP021217 (Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence) position: , mismatch: 11, identity: 0.656

tgcacgacctggtcgtgggacgtgacccggct	CRISPR spacer
gcggcggcctggtcgtgggccgtgaccgcctc	Protospacer
   .**.************ *******   ..

623. spacer 4.6|144608|32|NC_016110|CRISPRCasFinder,CRT matches to NZ_CP026526 (Sinorhizobium meliloti strain AK21 plasmid pSymA, complete sequence) position: , mismatch: 11, identity: 0.656

tgcacgacctggtcgtgggacgtgacccggct	CRISPR spacer
gcggcggcctggtcgtgggccgtgaccgcctc	Protospacer
   .**.************ *******   ..

624. spacer 4.6|144608|32|NC_016110|CRISPRCasFinder,CRT matches to NZ_CP019483 (Sinorhizobium meliloti strain B401 plasmid pSymA, complete sequence) position: , mismatch: 11, identity: 0.656

tgcacgacctggtcgtgggacgtgacccggct	CRISPR spacer
gcggcggcctggtcgtgggccgtgaccgcctc	Protospacer
   .**.************ *******   ..

625. spacer 4.6|144608|32|NC_016110|CRISPRCasFinder,CRT matches to NZ_CP019486 (Sinorhizobium meliloti strain B399 plasmid pSymA, complete sequence) position: , mismatch: 11, identity: 0.656

tgcacgacctggtcgtgggacgtgacccggct	CRISPR spacer
gcggcggcctggtcgtgggccgtgaccgcctc	Protospacer
   .**.************ *******   ..

626. spacer 4.6|144608|32|NC_016110|CRISPRCasFinder,CRT matches to NC_020527 (Sinorhizobium meliloti 2011 plasmid pSymA, complete sequence) position: , mismatch: 11, identity: 0.656

tgcacgacctggtcgtgggacgtgacccggct	CRISPR spacer
gcggcggcctggtcgtgggccgtgaccgcctc	Protospacer
   .**.************ *******   ..

627. spacer 4.16|145219|32|NC_016110|CRISPRCasFinder,CRT,PILER-CR matches to MN234203 (Mycobacterium phage SemperFi, complete genome) position: , mismatch: 11, identity: 0.656

tacaacacccgaggactgatccaggtcaagaa	CRISPR spacer
gttggggatcgaggactgatgcagatcaagaa	Protospacer
  ... . .*********** ***.*******

628. spacer 4.17|145280|32|NC_016110|CRISPRCasFinder,CRT matches to NC_048733 (Microbacterium phage Burro, complete genome) position: , mismatch: 15, identity: 0.531

gacggagcgatcggccggtaccggttgaaggg------	CRISPR spacer
------cagttcgaccggtaccgggcgatcgcgcgcac	Protospacer
        * ***.********** .**  *       

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 7559 : 28171 22 Paenibacillus_phage(50.0%) transposase NA
DBSCAN-SWA_2 67497 : 115893 41 Nostoc_phage(12.5%) transposase,integrase attL 70766:70783|attR 88408:88425
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NC_016115
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_016115_1 61875-61969 Orphan N:A
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_016115_1 1.1|61898|49|NC_016115|CRISPRCasFinder 61898-61946 49 NC_016115 Streptomyces pratensis ATCC 33331 plasmid pSFLA02, complete sequence 61898-61946 0 1.0

1. spacer 1.1|61898|49|NC_016115|CRISPRCasFinder matches to NC_016115 (Streptomyces pratensis ATCC 33331 plasmid pSFLA02, complete sequence) position: , mismatch: 0, identity: 1.0

ggaaatgcacttccggcaatgccacttccggcaatgccacttccggcaa	CRISPR spacer
ggaaatgcacttccggcaatgccacttccggcaatgccacttccggcaa	Protospacer
*************************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage