Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_022534 Plautia stali symbiont plasmid pPstS2 DNA, complete genome 0 crisprs NA 0 0 0 0
NC_022533 Plautia stali symbiont plasmid pPstS1 DNA, complete genome 0 crisprs c2c9_V-U4 0 0 0 0
NC_022546 Plautia stali symbiont DNA, complete genome 4 crisprs cas3,DinG,DEDDh 0 1 11 0

Results visualization

1. NC_022546
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_022546_1 1143961-1144043 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_022546_2 1468365-1468490 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_022546_3 2582484-2582568 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_022546_4 3330276-3330372 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_022546_1 1.1|1143984|37|NC_022546|CRISPRCasFinder 1143984-1144020 37 NZ_CP040096 Pantoea sp. SO10 plasmid unnamed1, complete sequence 650658-650694 12 0.676

1. spacer 1.1|1143984|37|NC_022546|CRISPRCasFinder matches to NZ_CP040096 (Pantoea sp. SO10 plasmid unnamed1, complete sequence) position: , mismatch: 12, identity: 0.676

attcacctggtgagcatgaatgcgcaccctgcgttgt	CRISPR spacer
ttcgacctggtgcgcatcaatgcgcaccctaaaaaag	Protospacer
 *. ******** **** ************. .  . 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 484055 : 490649 10 Burkholderia_phage(33.33%) NA NA
DBSCAN-SWA_2 563157 : 571055 6 Escherichia_phage(33.33%) terminase,plate NA
DBSCAN-SWA_3 863173 : 941814 59 Burkholderia_virus(36.36%) tail,plate,protease,head,tRNA NA
DBSCAN-SWA_4 1358368 : 1498314 104 Burkholderia_phage(29.41%) tail,integrase,plate,protease,head,terminase,transposase,tRNA attL 1426601:1426622|attR 1468455:1468476
DBSCAN-SWA_5 2453005 : 2506917 51 Shigella_phage(36.36%) tail,integrase,plate,protease,head attL 2466941:2466955|attR 2507955:2507969
DBSCAN-SWA_6 2522818 : 2625169 85 Salmonella_phage(15.0%) tail,capsid,lysis,plate,holin,protease,head,terminase,transposase,tRNA NA
DBSCAN-SWA_7 3495813 : 3548977 45 Burkholderia_phage(29.17%) integrase,tail,plate,terminase,transposase,tRNA attL 3508605:3508625|attR 3549131:3549151
DBSCAN-SWA_8 3572183 : 3581057 9 Erwinia_phage(37.5%) transposase NA
DBSCAN-SWA_9 3720810 : 3789009 54 Burkholderia_phage(25.0%) tail,plate,protease,terminase,tRNA NA
DBSCAN-SWA_10 3905695 : 3987811 60 Burkholderia_virus(31.58%) integrase,tail,plate,terminase,transposase,tRNA attL 3913849:3913869|attR 3998657:3998677
DBSCAN-SWA_11 4031076 : 4035370 6 Shigella_phage(33.33%) tail NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage